Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 May 1.
Published in final edited form as: Cell Signal. 2011 Jan 14;23(5):785–793. doi: 10.1016/j.cellsig.2011.01.001

Alteration of Golgi Structure in Senescent Cells and its Regulation by a G protein γ subunit

Joon-Ho Cho 1,*, Deepak Kumar Saini 1,2,*, WK Ajith Karunarathne 1, Vani Kalyanaraman 1, N Gautam 1,3,†
PMCID: PMC3085901  NIHMSID: NIHMS280575  PMID: 21238584

Abstract

Cellular senescence is a process wherein proliferating cells undergo permanent cell cycle arrest while remaining viable. Senescence results in enhanced secretion of proteins that promote cancer and inflammation. We report here that the structure of the Golgi complex which regulates secretion is altered in senescent cells. In cells where senescence is achieved by replicative exhaustion or in cells wherein senescence has been induced with BrdU treatment dependent stress, the Golgi complex is dispersed. The expression of a G protein γ subunit, γ11, capable of translocation from the plasma membrane to the Golgi complex on receptor activation increases with senescence. Knockdown of γ11 or overexpression of a dominant negative γ3 subunit inhibits Golgi dispersal induced by senescence. Overall these results suggest that in cellular senescence an upregulated G protein gamma subunit mediates alterations in the structure of the Golgi.

1. Introduction

Replicatively senescent cells or cells that have undergone genotoxic stress exhibit increased secretion of a number of factors including cytokines, growth factors, metalloproteinases and extracellular matrix proteins [1]. The enhanced secretion of these factors is known to induce inflammation and has been demonstrated to facilitate epithelial mesenchymal transition which promotes tumorigenesis [1]. Since cellular secretion is mediated by the Golgi complex, we examined the status of the Golgi in senescent cells resulting from stress or replicative exhaustion. Based on previous reports, 5-bromo 2-deoxyuridine (BrdU) exposure to cells was used as a stress induced model for senescence [2-4] which mimics the properties of replicative senescence. It has been shown that BrdU treatment induces cellular senescence likely by inducing the DNA–damage response [5]. DNA damage has been shown to trigger senescence [6]. It has been shown that it induces senescence in stem cells and inhibits proliferation of cancer cells [15, 16]. We also confirmed a previous finding that a heterotrimeric G protein subunit, γ11 (GNG11) is upregulated in senescent cells [7]. The γ11 subunit is capable of translocation from the plasma membrane to the Golgi on receptor activation as a βγ complex [8, 9] and regulates the structure of the Golgi [10]. We therefore examined the possibility that the G protein γ11 subunit plays a role in the regulation of Golgi structure in senescence.

2. Materials and Methods

2.1. Constructs, cell lines and chemicals

The tagged and untagged G protein constructs, various Golgi markers and PH-mCh used in this study have been previously described [9-12]. Mammalian expression vector containing cDNA encoding γ11 shRNA and control scrambled shRNAs were from the TRC library of Broad Institute (Sigma) and CFP-tubulin from E. Bertrand (CNRS, Montpellier, France). HeLa cell line was from ATCC; WI-38 and IMR90 cell lines were from NIA Aging Cell Repository at Coriell Institute for Medical Research (Camden, NJ). Antibodies to Golgi network marker, TGN46 were obtained from Sigma; antibodies to cis Golgi marker, GM130 were from A. Lindstedt (Carnegie Mellon University, Pittsburgh, PA) and were used at a dilution of 1:100. TRITC – conjugated goat anti – rabbit secondary antibody was from Sigma and was used at a 1:1000 dilution. 5-bromo deoxyuridine was procured from Sigma and was dissolved in DMSO to prepare a 200 μM solution. The solution was prepared just before use.

2.2. Cell culture, transfections and lentiviral transduction

HeLa cells were cultured in DMEM (Cellgro, Manassas, VA) containing 10% dialyzed FBS (Atlanta Biologicals), while WI38 and IMR90 cells were grown in MEM containing 10% non-dialyzed FBS, at 37°C, 5% CO2. Cells were transfected with Lipofectamine 2000 (Invitrogen) as per the manufacturer's protocol. To obtain stable knock down HeLa cell lines, lentiviral particles containing specific shRNAs were used as per the protocol provided by Sigma. The cells were transduced in a 96-well plate and after 48 hours, 2 μg/ml of puromycin was added to screen for cells expressing shRNAs. The cells were cultured for several generations and the reduction in the expression of γ11 was monitored to evaluate the stability of knock down cell line. For all experiments, the cell line was evaluated for knock down before use by real time PCR.

2.3. Quantitative real time–PCR

Total cellular RNA was isolated from various cells lines using the RNeasy Plus Mini Kit (QIAGEN). Reverse transcription of RNA was performed using Themoscript RT-PCR system (Invitrogen, Carlsbad, CA) as per manufacturer's instructions and as previously described [10]. Quantitative real time PCR was performed using SYBR Green PCR master mix (Applied Biosystems) in 20 μl reaction volume as per manufacturer's instructions. Melting curve analyses were performed on all reactions to check for specificity of the amplicons. Expression levels of β-actin were used to normalize the data. The following primer pairs were used for quantitative RT-PCR analysis.

Fibronectin - 5′GGTGGCTGTCAGTCAAAGC3′ and 5′CGCATTGCCTAGGTAGGTC3′ p21 - 5′GGAGCAGGCTGAAGGGTC3′ and 5′CCGGCGTTTGGAGTGGTAG3′ γ10 - 5′TGCCTTCAAGCACAAAGTGA3′ and 5′TATAGGACCAGGCCACAGGA3′ γ11 - 5′GTGCCCTTCACATCGAAGAT3′ and 5′CACTTGTTGTCTCTGCAACTTCA3′ β-actin - 5′CCAACCGCGAGAAGATGAC3′ and 5′CAGAGGCGTACAGGGATAGC3′

2.5. IL-8 secretion

HeLa cells were seeded in 6 – well plates and were grown overnight. Next day the cells were treated with 200 μM BrdU and after 24 hours the growth media was replaced with serum free media (DMEM-F12 1:1 mix with Peprotech serum free mix 1) containing 200 μM BrdU for another 48 hours. The media and cells were collected and IL-8 levels were estimated in the media using an ELISA kit (R&D systems). The cells were lysed with M-Per protein extraction reagent (Pierce) and total protein was estimated using BCA protein estimation kit (Pierce). The IL-8 levels were then calculated per μg total protein.

2.6. Immunofluorescence microscopy

Immunofluorescence microscopy was performed as described previously [10]. Briefly, cells grown on cover slips were subjected to BrdU treatment and fixed with 4% freshly prepared paraformaldehyde for 10 min, followed by permeabilization with 0.5% Triton X-100 for 10 min. The permeabilized cells were blocked with 2% BSA in PBS for 1 hr followed by treatment with primary antibodies at recommended dilution for 2 hrs followed by incubation with goat anti-rabbit-TRITC conjugate Ab (Sigma, MO; 1:1000) for 1 hr. The coverslips were washed and mounted on a slide with antifade solution (Calbiochem, CA) and imaged using Nikon TE2000 widefield fluorescence microscope using a 60× Plan-Apochromat objective (1.4 NA) as described previously [10].

2.7. Live cell imaging

Live cell imaging was performed essentially as described [8, 9, 11, 13]. An inverted wide field epifluorescence microscope with 1.4 NA 60× Plan Apochromat objective (Nikon TE2000) was used. The microscope was equipped with Exfo X-Cite light source containing a 103W Hg-Arc lamp for illumination, Sutter lambda 10-2 optical filter wheel controller for wavelength selection (Sutter Instrument Company), specific wavelength filters (Chroma), Orca-ER CCD camera (Hamamatsu Corp.) for image acquisition, 8 – channel automated fluid delivery system (Automate Scientific) and Metamorph 6.3.7 software (Molecular Devices) for controlling all the devices. Imaging was performed at room temperature at variable exposure times with variable binning. Filters used to acquire specific fluorescence were as follows: for CFP, 436/10 excitation and D465/30 emission; YFP, D492/18 excitation and D535/30 emission; DsRed, D580/20 excitation and D630/60 emission. Endomembrane regions for intensity measurements were selected using MetaMorph. The images were enhanced for brightness and/or contrast uniformly post acquisition either using Metamorph, ImageJ or Microsoft Word image editing tool.

3. Results

3.1. BrdU (5 - bromo deoxyuridine) induces cellular senescence

We used BrdU treated HeLa cells as a rapidly assayable model for cellular senescence. It has been observed that BrdU induces cellular senescence by activating the DNA damage response [5, 14]. Consistent with previous reports [2, 4, 5, 14, 15, 17] we found that BrdU induces cellular senescence. HeLa cells treated with 200 μM BrdU for 24-48hrs showed several characteristics similar to replicatively senescent IMR90 cells. BrdU treated cells slowed down in growth, changed shape (Fig 1A and Fig 1B) and showed enhanced transcription of an inhibitor of cyclin dependent kinase 4, p21 (Fig. 1C) [18]. BrdU treated HeLa cells and replicatively senescent IMR90 and WI38 cells also expressed higher levels of fibronectin [19] and a G protein γ11 subunit type (Fig. 1C and 1D) consistent with previous reports [7]. In our experiments, G protein γ10 subunit served as an internal control that did not show any change in expression when exposed to BrdU (Fig. 1C and 1D). To further confirm that BrdU treatment mimics replicative senescence, we monitored the secreted levels of the pro-inflammatory cytokine IL-8 which has been shown to be an integral part of the senescence associated secretory phenotype [1, 20]. As expected we observed increased secretion of IL-8 levels from BrdU treated cells (Fig. 1E). These observations together confirmed that BrdU treatment mimics cellular senescence induced by replicative exhaustion.

Fig. 1. Characterization of BrdU stress induced cellular senescence in immortal HeLa cells and replicative senescence in mortal WI38 cells.

Fig. 1

HeLa cells were exposed to 200 μM BrdU to induce cellular senescence. Non senescent PDL17 and close to senescence PDL46 WI38 cells were used. A. Inhibition of cell proliferation on treatment with BrdU. Equal number of cells (0.2 million/well) were seeded in triplicate in six well plates out of which three wells were exposed to 200 μM of BrdU for 72 hours. Cell numbers were counted and ratio of the number of cells at 72 hours to the initial number at seeding was calculated. This ratio for BrdU treated cells is distinctly different from untreated cells (p<0.01) (n=3). B. Change in morphology of cells exposed to BrdU. DIC images of HeLa cells before and after exposure to BrdU are shown. Cells were imaged in glass bottom dishes using Leica DMI6000 in DIC mode using 1.4 N.A. 60× plan apochromat objective. C. Changes in gene expression in BrdU treated senescent cells. Quantitative real time PCR was performed for measuring mRNA levels for p21, fibronectin, G protein γ10 and γ11 subunits as described in Materials and Methods. Cells were treated with 200 μM BrdU for 24 hours and 48 hours. Levels of RNAs were normalized using β-actin as an internal control, and relative expression was calculated using the 2-ΔΔCt method. Error bars represent SEM (n=3). D. Changes in gene expression in replicatively senescent cells. Early PDL and late PDL WI38 cells were used for expression analysis as above. E. Induction of IL-8 secretion from senescent cells. IL-8 was measured as described in Materials and Methods. Error bars represent SEM (n=3).

3.2. The G protein βγ complex translocates from the plasma membrane to the Golgi complex on receptor activation

Recent results show that the γ11 subunit type is capable of translocating from the plasma membrane to the Golgi complex on receptor activation [8, 9], regulating the structure of the Golgi [10]. Here, we examined the potential role of the G protein γ11 subunit in regulating the structure of the Golgi in senescent cells since its transcript levels are upregulated in these cells (Fig. 1C and 1D). First, we examined whether the upregulation of the γ11 transcript was reflected in its translocation properties in senescent cells. The β1 subunit tagged with a fluorescent protein (FP) was cotransfected with the M3 muscarinic receptor and αq into HeLa cells. We utilized this strategy based on our previous observations wherein we have detected co-translocation of tagged β1 in cells which endogenously contain a translocation proficient γ subunit [10]. Receptor mediated translocation was examined before and after BrdU treatment. In untreated cells, agonist stimulation (100 μM carbachol) did not evoke significantly detectable translocation of the YFP-β1 subunit to the inside of the cell (Fig. 2A upper panel). In contrast, when cells were treated with BrdU, significant YFP-β1 translocation to the intracellular region was detected (Fig. 2B). The translocation was reversible and rapid (Fig. 2C) as reported previously [8-10]. To confirm that the observed effect was due to activation of the M3 muscarinic receptor, we also monitored the activation of PLCβ by monitoring the generation of IP3 inside the same cell using the PH-mCh sensor as previously [11] (Fig 2A lower panels and 2D).

Fig. 2. Cotranslocation of YFP-β1 in HeLa cells.

Fig. 2

HeLa cells expressing M3, αq, YFP-β1 and PH-mCh were used. The cells were treated with 200 μM BrdU for 48 hours. The cells were mounted on a 25 μl volume perfusion chamber (RC30, Warner Instruments) and imaged in a continuous flow of HBSS at a rate of 0.5ml/ml. The cells were stimulated with M3 receptor agonist, 100 μM carbachol followed by antagonist, 100 μM atropine. The images show distribution of YFP-β1 and PH-mCh before and after agonist treatment in the same cell. Representative images are shown (n>4). A. YFP-β1 translocation is not detectable in basal state HeLa cells. Images from basal HeLa cells (not exposed to BrdU) depicting no translocation of YFP-β1 on receptor activation (upper panel). Lower panel shows translocation of PH-mCh in the same cells to confirm the presence of the receptor. B. YFP-β1 translocation is detectable in BrdU treated HeLa cells. Images were taken at 5 sec interval. Representative images of cell before and after agonist treatment. The images shown were acquired at 10 sec (basal) and at 2′20 sec (agonist treated). The intracellular region used for intensity measurements is shown (white circle). C. Plot showing translocation of YFP-β1 to the endomembranes. The intensity measurement from the endomembranes is plotted as a function of time (sec). Arrows indicate the point at which agonist and antagonist were added. D. Plot showing translocation of PH-mCh to the endomembranes (as reported previously) [11]. The intensity measurement from the endomembranes (white circle) is plotted as a function of time (sec). Arrows indicate the point at which agonist and antagonist were added. The translocation of PH domain confirmed that the introduced receptor is present in the cells and is active.

3.3. The Golgi complex is dispersed in senescent cells

To observe the status of the Golgi complex in HeLa cells, a marker for the Golgi region, Galactosyl transferase tagged with red fluorescent protein, DsRed (GalT-DsRed) [21] was transiently expressed in the cells. Senescence was induced post transfection by treating the cells with BrdU. While untreated cells contained compact trans Golgi, BrdU treated senescent cells contained dispersed Golgi (Fig.3A). Similarly, when replicatively senescent IMR-90 and WI-38 cells were examined by immunofluorescence microscopy using antibodies specific to the endogenous trans Golgi network marker, TGN46 [21], early PDL cells contained predominantly compact TGN and late PDL cells contained TGN that was dispersed (Fig.3B). The cells were scored for compact versus dispersed Golgi. For both IMR-90 and WI-38 cells, ∼70% of cells exhibited compact Golgi in the pre-senescent (early PDL) stage and the profile was reversed in senescent cells (late PDL) where more than 70% of cells had dispersed Golgi (Fig. 3C). These results suggested that (i) the Golgi structure is altered in senescent cells and (ii) the changes in the Golgi structure alternations were not peculiar to BrdU treatment but were common to cellular senescence.

Fig. 3. Dispersal of trans Golgi and trans Golgi network (TGN) in senescent cells.

Fig. 3

A. Dispersal of Golgi in stress induced senescence in HeLa cells. For trans Golgi labeling, HeLa cells were transfected with GalT- DsRed using lipofectamine 2000 (Invitrogen, Carlsbad, CA). The localization of GalT in live cells was monitored by epifluorescence microscopy. For trans Golgi network labeling, HeLa cells were grown on coverslips, treated for 24 hrs with BrdU to induce senescence, fixed and stained using the anti-TGN46 antibody (Sigma, St.Louis, MO). Top panels, basal cells, bottom panel, senescent cells (n>3). B. Replicative senescence in IMR90 and WI-38 cells. Early (16-17 PDL) and late PDL (46 PDL) IMR90 and WI38 cells were fixed and stained for TGN46 distribution. Images were acquired using widefield microscopy. Top panels, early PDL cells, and bottom panels, late PDL cells. C. Bar graph depicting the number of cells with compact or dispersed TGN in late and early PDL IMR90 and WI38 cells. Average plot of two experiments. The percentage variability across the experiments was <10%.

3.4. The cis and medial Golgi are also altered in senescent cells

We examined whether the alterations in the Golgi structure were restricted to the trans Golgi and trans Golgi network. A specific antibody for GM130 which localizes to the cis Golgi [22] was used to examine the cis Golgi structure in control and BrdU treated Hela cells as well as early and late PDL IMR-90 and WI-38 cells. Similarly, the structure of the medial Golgi was examined by expressing CFP-mannosidase II which is known to be localized specifically to this region of the Golgi complex [23]. The results showed that both the cis and medial Golgi were dispersed in senescent cells (Fig. 4).

Fig. 4. Redistribution of cis and medial Golgi in senescent cells.

Fig. 4

A. Control and BrdU treated senescent HeLa cells. B. Early and late PDLs of WI38 and IMR90 cells. In A & B cis Golgi structure was observed using anti-GM130 antibodies. Representative cells with compact or dispersed cis Golgi (n=2). C. Redistribution of α mannosidase, medial Golgi marker, in senescent HeLa cells. HeLa cells were transfected with CFP - α mannosidase. The distribution of α mannosidase was monitored by fluorescence microscopy (n=2).

3.5. Golgi alterations in senescent cells are not due to microtubule disassembly

Microtubule disassembly is known to disrupt the structure of the Golgi [24]. We examined whether the senescence associated changes are due to microtubule disassembly during senescence. Tubulin tagged with CFP was coexpressed with GalT-DsRed and their distribution was examined in HeLa cells before and after treatment with BrdU. Cells treated with BrdU showed GalT-DsRed scattered over the cells suggesting disruption of the trans Golgi. But the microtubule distribution in these cells was unaltered and similar to the control untreated cells (Fig. 5A and 5B, right panels). When HeLa cells were treated with nocodazole, an agent known to lead to the depolymerization of microtubules [24, 25], the microtubule polymers were no longer detectable (Fig. 5C). In these cells, GalT-DsRed was distributed in dispersed structures indicating that the trans Golgi was broken down as expected from previous reports [24]. The pattern of trans Golgi distribution was distinctly different in nocodazole treated cells compared to BrdU treated cells (left panels of Fig. 5B & 5C) suggesting that the Golgi dispersal which occurs during senescence induction is distinct from the Golgi fragmentation due to microtubule depolymerization. Overall, these results suggested that the structural changes observed in the Golgi in senescent cells are not likely to be a result of microtubule depolymerization.

Fig. 5. Tubulin independent redistribution of trans Golgi in stress induced senescent HeLa cells.

Fig. 5

HeLa cells transfected with GalT-DsRed and CFP-tubulin were treated with 200 μM BrdU to induce senescence. The cells were then visualized for GalT and tubulin distribution using epifluorescence microscopy. A. Basal HeLa cells. B. BrdU treated senescent HeLa cells. C. Nocodazole treated HeLa cells, which leads to both depolymerization of microtubules as well as Golgi redistribution (note that tubulin distribution is distinctly absent in the nuclear region due to depolymerization) (n=2).

3.6. Knockdown of γ11 inhibits senescence associated Golgi dispersal

Previous results have shown that receptor activated translocation of the G protein γ11 subunit from the plasma membrane to the Golgi complex mediates the fragmentation of the Golgi complex [10]. As mentioned in section 3.2, we also observed upregulation of the γ11 subunit in senescent cells as visualized by β1-cotranslocation (Fig. 2B). To examine further whether the translocation of β1 in response to M3 activation in BrdU treated cells was due to co-translocation with endogenous γ11, we knocked down the γ11 subunit expression in HeLa cells using a γ11 specific shRNA. Introduction of γ11 shRNA into HeLa cells reduced the transcript specific to γ11 by about ∼70% (Fig. 6A). Cells expressing shRNA specific to γ11 were then treated with BrdU and the translocation of β1 examined by activation of the M3 receptors as described in section 3.2. Significant β1 translocation was not detected in these cells (Fig. 6B, upper panels) in comparison to cells expressing a shRNA with a scrambled sequence (not shown). The presence of receptors in the cells was confirmed by detecting PH-mCh translocation as above (Fig. 6B, lower panel). This result suggests that endogenous γ11 is a major mediator of the receptor dependent translocation of the β1 subunit in senescent cells. This result also provides support for the γ11 knockdown effect reducing γ11 protein levels.

Fig. 6. Effect of G protein γ11 subunit knockdown on Golgi structure in HeLa cells.

Fig. 6

Fig. 6

Fig. 6

A. Specificity of γ11-shRNA on expression of G protein γ10 and γ11 subunits in HeLa cells. HeLa cells stably transfected with γ11-shRNA and control scrambled shRNAs were used. RNA was isolated from stable cell lines and mRNA expression of the γ10 and γ11 subunits was analysed by real time PCR. The expression levels were normalized to β-actin expression levels (n=3). B. YFP-β1 translocation is not detectable in HeLa cells expressing γ11-shRNA. HeLa cells expressing M3, αq, YFP-β1, PH-mCh and γ11-shRNA were treated with 200 μM BrdU for 24 hours. Representative images of cells at basal level and after agonist treatment are shown. Upper panel shows images of YFP-β1 indicating absence of translocation on receptor activation. Lower panel shows translocation of PH-mCh in the same cells to confirm the presence of receptor in the same cell. C. Knock down of γ11 in HeLa cells reduces senescence induced Golgi dispersal (n=4). Bar graphs from representative experiments depict percentage of cells with compact or dispersed trans Golgi detected by TGN46 staining. Stable knock down of the γ11 subunit was generated using lentiviral transduction containing specific shRNA particles (Sigma) and Golgi structure was analysed using TGN46 staining as mentioned above. A scrambled shRNA was used as a control. Representative images of cells expressing control shRNA and γ11-shRNA are shown. An averaged plot of all the experiments is shown. Golgi structure in wild type BrdU treated cells was significantly different from basal cells and similarly BrdU treated γ11-shRNA were significantly different from control-shRNA expressing cells (t test) (p<0.01). Representative images of BrdU treated cells expressing various shRNAs immunostained with TGN46 antibodies are shown. D. Effect of introducing the mouse YFP-γ11 subunit into γ11 knock down HeLa cells. Mouse YFP-γ11 was introduced transiently into cells expressing γ11 shRNA or scrambled shRNA. Only cells transfected with YFP were counted for compact or dispersed Golgi (n=2). Plots are mean of two experiments. Percentage variability across experiments was <30%. Representative images of basal and BrdU treated cells expressing γ11-shRNA and mouse γ11-cDNA are shown.

To evaluate if the changes in the Golgi structure observed here are mediated through the γ11 subunit, we knocked down the G protein γ11 subunit stably using a specific shRNA targeted against it [10]. HeLa cells were stably transduced with lentiviruses expressing γ11 specific shRNA which were previously confirmed to be capable of significantly reducing γ11 subunit expression [10]. Quantitative real time PCR analysis was used to determine the expression level of γ11 in the cells expressing the shRNA. γ11 mRNA expression was reduced by ∼70-80% compared to cells in which a control scrambled shRNA was expressed (Fig. 6A). When these cells were exposed to BrdU to induce senescence and the Golgi complex examined as above, dispersal of the trans Golgi was significantly inhibited compared to control cells (Fig 6C).

To examine whether the effect of the γ11 shRNA was specific, we introduced the mouse γ11 cDNA into the knockdown cells tagged with YFP. Since there was a mismatch in the shRNA targeting the human γ11 and mouse γ11, the γ11 shRNA had no effect on the mouse γ11. When the Golgi structure in the cells expressing YFP was examined they were similar to wild type cells (Fig. 6D). These results showed that the effect of the γ11 shRNA was specifically due to the depletion of the G protein γ11 subunit and not due to non-specific effects and the Golgi structure is indeed regulated by the presence of the G protein γ11 subunit in these cells.

3.7. Translocation of the G protein βγ complex is likely required to mediate the Golgi structural changes associated with senescence

Receptor stimulated translocation of the G protein βγ complex from the plasma membrane to the Golgi complex has been shown to lead to structural changes in the Golgi complex [10]. We examined if a mechanism similar to that seen here was at the basis of the dispersal of Golgi elements in cellular senescence. We have previously reported that activation of the muscarinic receptor leads to the translocation of six members of the G protein γ subunit family while translocation of the remaining six members was not detected under the conditions used [9]. We have also shown that one of these γ subunits, γ3 whose translocation could not be detected, is dominant negative and reduces the translocation of an endogenous γ subunit so that it is not detectable on receptor activation and inhibits the breakdown of the Golgi complex mediated by the translocation [10]. Using a similar strategy, we expressed YFP-γ3 in HeLa cells and induced senescence with BrdU. The structure of the Golgi complex in these cells in comparison to control cells in which YFP alone was expressed was then observed using TGN46 as a marker for the trans Golgi network (Fig. 7). A significant decrease in the number of cells containing dispersed Golgi was noted in cells expressing the dominant negative γ3 subunit. These observations suggest that the translocation ability of the γ11 subunit is a likely requirement for Golgi dispersal during senescence.

Fig. 7. Inhibition of Golgi dispersal in BrdU treated senescent HeLa cells by the γ3 subunit.

Fig. 7

Trans Golgi dispersal induced by incubation of HeLa cells with 200 μM BrdU for 48 hours is inhibited in HeLa cells transiently transfected with G protein γ3 subunit. The Golgi structure was observed by immunofluorescence using an antibody specific to the trans Golgi network, TGN46. Bar diagram representing the percentage of cells (± SEM) that contained either compact or dispersed Golgi. Total cells analyzed range from 100-250 (n=3). Representative images of cells expressing YFP-γ3 are shown. Upper panel, control untreated cells and lower panel, BrdU treated cells.

4. Discussion

The structure of the Golgi complex in senescent cells has not been examined before to our knowledge. Results here show that the Golgi complex is compact in non-senescent or pre-senescent cells but is dispersed in senescent cells. The consistently altered appearance of the Golgi in both stress induced senescent cells and replicatively senescent cells suggests that the Golgi structure could serve as a useful marker for cellular senescence. Senescent cells show significantly increased secretion of cytokines such as IL-6, IL-8; growth factors such as VEGF and extracellular matrix proteins such as fibronectin [1, 19, 27]. One potential reason for the alteration in the structure of the Golgi complex could be that it is a result of the increased secretion of various proteins which traffic from the Golgi to the plasma membrane.

It has been shown that the G protein γ11 subunit is upregulated in stress induced and replicatively senescent cells [7] and we have confirmed this finding here. We show here that the upregulated G protein γ11 subunit in senescent cells mediates the translocation of the βγ11 complex from the plasma membrane to the Golgi in response to receptor activation. The translocation is mediated by the upregulated γ11 subunit because in the presence of the γ11 shRNA, translocation is not seen. Recent evidence shows that receptor mediated translocation of the βγ complex breaks down the Golgi complex [10]. The changes seen in the structure of the Golgi complex in senescent cells are similarly mediated by the βγ11 complex because the γ11 shRNA inhibits the dispersal of trans Golgi and trans Golgi network. Furthermore, the ability of a known γ subunit whose translocation could not be detected, γ3, to inhibit senescence associated Golgi structure alterations suggests strongly that it is mediated by the translocation of the βγ complex from the plasma membrane to the Golgi.

The results here suggest that G protein γ11 upregulation plays a role in senescence and are consistent with an earlier report that overexpression of γ11 shortens the number of PDLs required to reach replicative senescence [7]. Cellular senescence is thought to be cancer protective since cell division is arrested. Consistent with such a role γ11 transcription levels have been reported to be reduced in medullary thyroid carcinoma [29] and splenic marginal zone lymphoma [30] indicating that its downregulation is accompanied by cell proliferation.

It is expected that secretory changes in a cell will be primarily reflected at the level of the trans Golgi network and trans Golgi regions. However, the structurally altered cis and medial Golgi seen here in senescent cells may be because of the increased secretion of a large number of proteins from senescent cells [1]. There is previous evidence that the entire Golgi can be broken down when regulators of secretory vesicle formation such as the translocating βγ complexes and PKD are overactive [10, 26]. An alternative possibility is that the Golgi structure changes seen in senescent cells are due to the cell division arrest which is a consequence of senescence induction. It is known that during cell division and specifically mitosis, the Golgi complex breaks down completely and is then reassembled in daughter cells [31]. It is possible that during senescence the initial changes in the Golgi that occur in mitosis are observed but the process does not continue further than the dispersal of the Golgi elements.

Is it possible that Golgi structural changes accompany senescence but do not directly play a role in regulating senescence? Previous results show that overexpression of the G protein γ11 protein induces senescent growth arrest at an earlier PDL compared to control mortal cells [7]. This result suggests that the translocation of the γ11 subunit from the plasma membrane to the Golgi likely plays a direct role in regulating senescence. The results here also suggest that a G protein coupled receptor (GPCR) regulates senescence through the translocation of the βγ11 complex. GPCRs are the single most important target for therapeutic drugs because they are accessible to extracellular ligands and modulate an enormous variety of physiological processes. The results here suggest that it may be possible to target a specific GPCR to regulate senescence.

Acknowledgments

This work was supported by NIH grants (GM69027 and GM080558) to N.G. and an AHA postdoctoral fellowship (D.K.S.).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Coppe JP, Desprez PY, Krtolica A, Campisi J. Annu Rev Pathol. 2010;5:99–118. doi: 10.1146/annurev-pathol-121808-102144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Michishita E, Nakabayashi K, Suzuki T, Kaul SC, Ogino H, Fujii M, Mitsui Y, Ayusawa D. J Biochem. 1999;126(6):1052–1059. doi: 10.1093/oxfordjournals.jbchem.a022549. [DOI] [PubMed] [Google Scholar]
  • 3.Suzuki T, Minagawa S, Michishita E, Ogino H, Fujii M, Mitsui Y, Ayusawa D. Exp Gerontol. 2001;36(3):465–474. doi: 10.1016/s0531-5565(00)00223-0. [DOI] [PubMed] [Google Scholar]
  • 4.Minagawa S, Nakabayashi K, Fujii M, Scherer SW, Ayusawa D. Exp Cell Res. 2005;304(2):552–558. doi: 10.1016/j.yexcr.2004.10.036. [DOI] [PubMed] [Google Scholar]
  • 5.Masterson JC, O'Dea S. Anticancer Drugs. 2007;18(9):1053–1068. doi: 10.1097/CAD.0b013e32825209f6. [DOI] [PubMed] [Google Scholar]
  • 6.Rodier F, Coppe JP, Patil CK, Hoeijmakers WA, Munoz DP, Raza SR, Freund A, Campeau E, Davalos AR, Campisi J. Nat Cell Biol. 2009;11(8):973–979. doi: 10.1038/ncb1909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Hossain MN, Sakemura R, Fujii M, Ayusawa D. Biochem Biophys Res Commun. 2006;351(3):645–650. doi: 10.1016/j.bbrc.2006.10.112. [DOI] [PubMed] [Google Scholar]
  • 8.Akgoz M, Kalyanaraman V, Gautam N. J Biol Chem. 2004;279(49):51541–51544. doi: 10.1074/jbc.M410639200. [DOI] [PubMed] [Google Scholar]
  • 9.Saini DK, Kalyanaraman V, Chisari M, Gautam N. J Biol Chem. 2007;282(33):24099–24108. doi: 10.1074/jbc.M701191200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Saini DK, Karunarathne WK, Angaswamy N, Saini D, Cho JH, Kalyanaraman V, Gautam N. Proc Natl Acad Sci U S A. 2010;107(25):11417–11422. doi: 10.1073/pnas.1003042107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Chisari M, Saini DK, Cho J, Kalyanaraman V, Gautam N. PLoS One. 2009;4(11):e7797. doi: 10.1371/journal.pone.0007797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chisari M, Saini DK, Kalyanaraman V, Gautam N. J Biol Chem. 2007;282(33):24092–24098. doi: 10.1074/jbc.M704246200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Saini DK, Gautam N. Methods Mol Biol. 2010;617:191–207. doi: 10.1007/978-1-60327-323-7_16. [DOI] [PubMed] [Google Scholar]
  • 14.Hubackova S, Novakova Z, Krejcikova K, Kosar M, Dobrovolna J, Duskova P, Hanzlikova H, Vancurova M, Barath P, Bartek J, Hodny Z. Cell Cycle. 2010;9(15):3085–3099. doi: 10.4161/cc.9.15.12521. [DOI] [PubMed] [Google Scholar]
  • 15.Levkoff LH, Marshall GP, 2nd, Ross HH, Caldeira M, Reynolds BA, Cakiroglu M, Mariani CL, Streit WJ, Laywell ED. Neoplasia. 2008;10(8):804–816. doi: 10.1593/neo.08382. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ross HH, Levkoff LH, Marshall GP, 2nd, Caldeira M, Steindler DA, Reynolds BA, Laywell ED. Stem Cells. 2008;26(12):3218–3227. doi: 10.1634/stemcells.2008-0299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Novakova Z, Hubackova S, Kosar M, Janderova-Rossmeislova L, Dobrovolna J, Vasicova P, Vancurova M, Horejsi Z, Hozak P, Bartek J, Hodny Z. Oncogene. 2010;29(2):273–284. doi: 10.1038/onc.2009.318. [DOI] [PubMed] [Google Scholar]
  • 18.Roninson IB. Cancer Lett. 2002;179(1):1–14. doi: 10.1016/s0304-3835(01)00847-3. [DOI] [PubMed] [Google Scholar]
  • 19.Kumazaki T, Robetorye RS, Robetorye SC, Smith JR. Exp Cell Res. 1991;195(1):13–19. doi: 10.1016/0014-4827(91)90494-f. [DOI] [PubMed] [Google Scholar]
  • 20.Acosta JC, O'Loghlen A, Banito A, Guijarro MV, Augert A, Raguz S, Fumagalli M, Da Costa M, Brown C, Popov N, Takatsu Y, Melamed J, d'Adda di Fagagna F, Bernard D, Hernando E, Gil J. Cell. 2008;133(6):1006–1018. doi: 10.1016/j.cell.2008.03.038. [DOI] [PubMed] [Google Scholar]
  • 21.Prescott AR, Lucocq JM, James J, Lister JM, Ponnambalam S. Eur J Cell Biol. 1997;72(3):238–246. [PubMed] [Google Scholar]
  • 22.Nakamura N, Rabouille C, Watson R, Nilsson T, Hui N, Slusarewicz P, Kreis TE, Warren G. J Cell Biol. 1995;131(6 Pt 2):1715–1726. doi: 10.1083/jcb.131.6.1715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wilson BS, Nuoffer C, Meinkoth JL, McCaffery M, Feramisco JR, Balch WE, Farquhar MG. J Cell Biol. 1994;125(3):557–571. doi: 10.1083/jcb.125.3.557. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Storrie B, Yang W. Biochim Biophys Acta. 1998;1404(1-2):127–137. doi: 10.1016/s0167-4889(98)00053-6. [DOI] [PubMed] [Google Scholar]
  • 25.Hoebeke J, Van Nijen G, De Brabander M. Biochem Biophys Res Commun. 1976;69(2):319–324. doi: 10.1016/0006-291x(76)90524-6. [DOI] [PubMed] [Google Scholar]
  • 26.Bossard C, Bresson D, Polishchuk RS, Malhotra V. J Cell Biol. 2007;179(6):1123–1131. doi: 10.1083/jcb.200703166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Davalos AR, Coppe JP, Campisi J, Desprez PY. Cancer Metastasis Rev. 2010;29(2):273–283. doi: 10.1007/s10555-010-9220-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Li J, Chen LA, Townsend CM, Jr, Evers BM. J Biol Chem. 2007 doi: 10.1074/jbc.M707513200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Musholt TJ, Hanack J, Brehm C, von Wasielewski R, Musholt PB. World J Surg. 2005;29(4):472–482. doi: 10.1007/s00268-004-7748-y. [DOI] [PubMed] [Google Scholar]
  • 30.Ruiz-Ballesteros E, Mollejo M, Rodriguez A, Camacho FI, Algara P, Martinez N, Pollan M, Sanchez-Aguilera A, Menarguez J, Campo E, Martinez P, Mateo M, Piris MA. Blood. 2005;106(5):1831–1838. doi: 10.1182/blood-2004-10-3898. [DOI] [PubMed] [Google Scholar]
  • 31.Puri S, Telfer H, Velliste M, Murphy RF, Linstedt AD. J Cell Sci. 2004;117(Pt 3):451–456. doi: 10.1242/jcs.00863. [DOI] [PubMed] [Google Scholar]

RESOURCES