Association of Composite IS26-sul3 Elements with Highly Transmissible IncI1 Plasmids in Extended-Spectrum-β-Lactamase-Producing Escherichia coli Clones from Humans

Abstract

The association of an IS440-sul3 platform with Tn21 class 1 integrons carried by IncI1 plasmids encoding extended-spectrum β-lactamases (ESBLs; mainly SHV-12 and CTX-M-14) among worldwide Escherichia coli clones of phylogroups A (ST10, ST23, and ST46), B1 (ST155, ST351, and ST359), and D/B2 (ST131) is reported. An in silico comparative analysis of sul3 elements available in the GenBank database shows the evolution of sul3 platforms by hosting different transposable elements facilitating the potential genesis of IS26 composite transposons and further insertion element-mediated promoted arrangements.

INTRODUCTION

Acquired resistance to sulfonamides is due to the presence of dihydropteroate synthase (DHPS) genes located on class 1 integrons (sul1 and sul3) or genetic islands bearing Tn5393 and ISCR2 (sul2) (14, 23, 25). Since its first description in the early 1960s, there is evidence of the spread of plasmids containing sul1 and sul2 among different hosts (10, 12, 13, 19, 26). The sul3 integrons have been increasingly reported among animals and, to a lesser extent, among humans since they were identified in the mid-1990s (2, 4, 11, 23, 24, 32). However, the genetic elements linked to their spread remain scarcely explored (2, 23, 32).

We analyzed 344 clonally unrelated Enterobacteriaceae isolates (249 Escherichia coli, 56 Klebsiella pneumoniae, 20 Enterobacter cloacae, 3 Enterobacter aerogenes, 7 Klebsiella oxytoca, 6 Salmonella enterica serovar Paratyphi, and 3 Citrobacter isolates). They included 244 extended-spectrum-β-lactamase (ESBL) or metallo-β-lactamase (MBL) producers obtained from hospitalized and healthy humans (1988 to 2006) and 100 non-ESBL producers (66 obtained from blood samples from inpatients and 34 obtained from feces samples from healthy volunteers without recent exposure to antibiotics or hospital environments; 1988 to 2006) (see Table 2). Species identification and susceptibility testing were performed by using the automated WIDER system (Fco. Soria Melguizo, Madrid, Spain) and standard methods (7). Clonal relatedness among Escherichia coli isolates was established by pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST) (30; http://www.mlst.net), and determination of phylogenetic groups by a multiplex PCR assay (6).

Table 2.

Epidemiological data of isolates producing sul3 integrons in Hospital Ramón y Cajal^a

Integron type (no. of isolates)	sul3 plasmid (kb)b	Inc group(s) (no. of isolates)	RFLP type (no. of isolates)c	pMLST IncI1d				ESBL(s) (no. of isolates)	E. coli MLST result(s)	Yr	Origin (no. of isolates)	Antibiotic resistancee	sul gene(s) (no. of isolates)g
				ardA	trbA-pndA	sogS	pilV
I (2)	100	I1, B/O	A (2)	4	3	DLV 4	1	CTX-M-14	ST57, ST350	2000–2001	Urine/P	Sm, Na, Su, (W), (Te), Ch, Km	sul1 (1)
II (3)	125	Y	G					SHV-12	ST48/ST10	2000	Blood/P	Sm, (Sp), (Cip), (Na), Su, W, Ch, (Ap), (Te)	sul2
	125, 55	B/O and NTf	ND					SHV-12		2000	Feces/HV
	100	I1, B/O	F	4	16	9	2	CTX-M-1	ST131	2002	Urine/P
III (15)	100	I1 (6)	B (6)	4	3	DLV 4	1	SHV-12, CTX-M-14 (2), CTX-M-15 (1), VIM-1 (1)	ST359, ST155, DLV ST155, ST156, ST46; ND	1997–2006	Urine (2)/P, blood/P, feces/HV, gangrene/P	(Sm), (Sp), (Na), (Su), (W), (Te), (Ch), (Nt), (Km), (Gm), (Tb), (Ak)	sul1, sul2
	150	FIB+B/Of	D	4	3	DLV 4	1	SHV-12	ST695	2002	Urine/P		sul1, sul2
	100	I1+B/Of
	100	I1, B/O	C1	4	3	DLV 4	1	SHV-12	ST10	2002	Urine/P		sul1, sul2
	100	I1, B/O	C2	4	13	2	1	CTX-M-14	ST359	2002	Urine/P		sul1
	50	I1, K, FIB, F	ND					CTX-M-14, SHV-12	ST167	2001–2002	Urine (3)/P, cutaneous/P, genital/P, epidemic surveillance/P		sul1, sul2
	70	Y, FIA, F						CTX-M-9	ST351, ST648
	90	K, B/O, F						CTX-M-14	ST624
	105	A/C2, F						TEM-24	ST131, ST648; ST46 (2)
	150	FIA, (no F)						SHV-12
	220	I1, N, B/O						CTX-M-14
IV (1)	100	I1	E	1	4	1	2	SHV-12	ST23	2002	Urine/P	Sm, Sp, Na, Su, W, Ch, Te	sul1, sul2

^asul3 was detected among a collection of strains which included (i) 244 ESBL or MBL producers [TEM (−4, −12, −24, −27, and −52), SHV (−2, −2a, −5, −12, and −13), CTX-M (−1, −3, −9, −10, −14, −15, and −32), VIM-1, and OXA-30], representatives of ESBL clones recovered in Hospital Ramón y Cajal from 1988 to 2006, a collection partially explored in other studies with other purposes (18, 19, 21, 30) (1988 to 2006) and (ii) 66 non-ESBL isolates from blood samples obtained from different inpatients and 34 fecal isolates obtained from healthy volunteers living in the Madrid area (18). Abbreviations: Sm, streptomycin; Sp, spectinomycin; Na, nalidixic acid; Cip, ciprofloxacin; Te, tetracycline; Sul, sulfonamide; W, trimethoprim; Ch, chloramphenicol; Ak, amikacin; Km, kanamycin; Gm, gentamicin; Nt, netilmicin; Tb, tobramycin; Ap, apramycin; DLV, double-locus variant; NT, not typeable; ND, not done; P, hospitalized patient; HV, healthy volunteer. Names in boldface indicate either an ESBL encoded by bla genes or a sulz gene located on plasmids carrying sul3.

^bPlasmids transferred by conjugation to E. coli K-12 BM21 (rifampin and nalidixic acid resistant, Lac⁺, and plasmid free) are underlined (18).

^cDetailed analysis of 13 IncI1-like transferable plasmids revealed 8 RFLP patterns, designated with capital letters (A to G). Plasmids from six isolates were not studied further since they were cotransferred with other plasmids carrying different ESBL genes.

^dDiversity of five genes corresponding to the backbone of IncI plasmids (repY = replicase, see the text; ardA = gene encoding a type I restriction-modification enzyme; trbA = gene involved in maintenance and plasmid transfer; pndA = gene involved in plasmid transfer; sogS = gene coding for a DNA primase; pill = gene associated with type IV pilus biogenesis) following the allele designation given and used in the MLST scheme proposed by Alessandra Carattoli (http://pubmlst.org/perl/bigsdb/bigsdb.pl?db=pubmlst_plasmid_seqdef). Numbers represent different alleles for each gene.

^eSusceptibility to non-beta-lactam antibiotics was determined by using the standard disk diffusion method (7). Antibiotics in parentheses indicate that resistance was not present in all isolates. Cotransference with sul3 is indicated by underlining.

^fStrains containing two copies of a given sul3 integron carried by different plasmids.

^gUnderlined genes were cotransferred with sul3.

The sul3 gene was detected in 6% of the strains (22 strains from 12 hospitalized patients, 8 outpatients, and 2 healthy humans; 1997 to 2006). All were ESBL/MBL-producing E. coli strains showing different PFGE patterns and sequence types (ST) linked to phylogroups A (n = 9; ST10, ST23, ST46, ST156, and ST695), B1 (n = 6; ST155, ST351, and ST359), and D/B2, (n = 7; ST131, ST350, ST624, and ST648). The most common ESBLs/MBLs were SHV-12 (n = 13) and CTX-M-14 (n = 8), followed by CTX-M-15 (n = 2), CTX-M-1, CTX-M-9, VIM-1, and TEM-24 (n = 1 each) (see Table 2). Four strains produced two ESBL/MBL enzymes (CTX-M-14, CTX-M-15, or VIM-1 plus SHV-12). The sul3 strains often carried other sul genes (sul1, sul2, and sul3, n = 16/22; sul1 and sul3, n = 2; sul2 and sul3, n = 1; sul3 only, n = 3) and expressed resistance to sulfonamides (86%), streptomycin (86%), trimethoprim (77%), tetracycline (77%), and chloramphenicol (64%). The low prevalence of the sul3 gene is similar to that reported by other studies (2, 4, 15), in contrast to that reported for the sul1 or sul2 gene (14, 19, 26). The association of sul3 with ESBL E. coli producers with zoonotic potential (phylogroup B2 E. coli O25:H4-ST131 and phylogroup D E. coli O25a-ST648, -ST69, and -ST393) (8, 31) highlights the role of these frequent clones in the evolution of antibiotic resistance to sulfonamides and beta-lactams in areas of common exposure to these antibiotics, such as farms or hospitals.

Characterization of sul3 class 1 integrons and linkage to Tn21 derivatives were accomplished by analyzing the presence of intI1, sul3, qacI, tnpM₂₁, and mer₂₁ by PCR/hybridization and further PCR mapping (Fig. 1 and Table 1). The diversity of sul3 platforms was established by comparison of restriction fragment length polymorphism (RFLP) patterns of HindIII-, EcoRI-, or PstI-digested amplicons, primer walking sequencing of representatives types, and further analysis of all sul3 elements available in the GenBank database. We detected four sul3 integron arrangements arbitrarily designated types I_S3 to IV_S3 (Table 2; Fig. 1). The predominant one was type III_S3, intI1-estX-psp-aadA2-cmlA1-aadA1-qacI-IS440-sul3, present in 15 ESBL/MBL E. coli strains in our collection since 1997 and also globally distributed among Enterobacteriaceae of different origins (2, 3, 16, 17, 28). Two integrons similar to type III_S3 were intI1-estX-psp-qacI-IS440-sul3 (type I_S3) and intI1-estX-psp-aadA2/aadA1a-qacI-IS440-sul3 (from farm animals in Switzerland; GenBank accession no. FM242710) (Fig. 2). Differences in attC carried by the psp and aadA2 gene cassettes of different integrons suggest arrangements. Type II_S3, intI1-dfrA12-gcuF-aadA2-cmlA1-aadA1-qacI-IS440-sul3, has also been detected in humans, animals, and foods in Europe and Asia since 2003. Finally, a few sul3 platforms lacking qacI included intI1-estX-psp-aadA2-cmlA1-aadA1-IS440-sul3 (type IV_S3; GenBank accession no. HQ875017), intI1-dfrA12-gcuF-aadA2-cmlA1-aadA1-IS440-sul3 (27), and partial sequences aadA1-IS440-sul3-orf1-mefB and aadA3-IS440-sul3-orf1-mefB (GenBank accession no. FJ196384 and FJ196388, respectively). The sul3 integrons obtained from E. coli and Salmonella enterica isolates from humans and farm animals were associated with Tn21 platforms often interrupted by IS26 at different positions (Fig. 1 and 2). Analysis of sequences revealed that a genetic platform, IS440-sul3-orf1-mefB, is specifically located beyond the attC sites of the qacI, aadA1, and aadA3 gene cassettes of integrons (Fig. 2). The lack of identifiable boundaries for IS440, a putative IS256 family member, reflects either a single insertion downstream of the last gene cassette (most probably qacI) of an ancestral integron, followed by further excisions and insertions of different gene cassettes or independent insertions at the end of different attC sites. The existence of identical integron arrangements lacking and containing IS26 and IS10 surrounded by direct repeats of the original target sequence indicates that the IS440-sul3 platform, once acquired, has been the target of further lateral transfer events. Moreover, complete or partial copies of IS26 at the boundaries of different integrons led to the genesis of putative IS26 composite transposons (Fig. 1 and 2). The lack of target site duplication at the sides of these IS26 copies might indicate the transference of either IS26 composite elements by homologous recombination among diverse plasmids or larger platforms in which they were located.

Fig. 1.

Schematic representation of sul3 genetic elements characterized by PCR mapping based on the Tn402 and Tn21 sequences. (Top) The locations of the primers used for the PCR mapping assay are represented with black arrowheads. P13 and P14 hybridize in the qacI gene. (Middle) The attC sites or 59-base elements were represented by circles patterned as corresponding gene cassettes. (Bottom) Preliminary screening of sul3 elements related to Tn402 and Tn21 was performed as shown in the table. ++, amplicon of larger size; (+), variable amplification results, with the number of positive results indicated; ^a, mefB was complete in only two isolates, and in most cases, the gene was truncated at different points by IS26 (GenBank accession no. HQ875016, HQ875014, and HQ875015); ^b, this isolate harbors an integron with insertions b and c; ^c, integron amplification was reached using primers P9 and P5. tnp21 was found upstream of the integrases of different sul3 integron types (n = 10), and a copy of IS26 was detected downstream of the sul3 gene (n = 8). Coexistence of both of the boundaries was detected for 7 isolates. The presence of the mer operon of Tn21 was inferred by merA.

Table 1.

Oligonucleotides used in this study^b

Primer no.	Primer	Sequence (5′–3′)	GenBank accession no.	Nucleotide positions	Source/reference(s)
1	sul1F	CGGCGTGGGCTACCTGAACG	EU622038	3508–3528	15
2	sul1R	GCCGATCGCGTGAAGTTCCG	EU622038	3921–3940	15
3	sul2F	GCGCTCAAGGCAGATGGCATT	M36657	534–555	15
4	sul2R	GCGTTTGATACCGGCACCCGT	M36657	819–798	15
5	sul3F	GAGCAAGATTTTTGGAATCGT	AJ459418	2980–3001	23
6	sul3R	CTAACCTAGGGCTTTGGATA	AJ459418	3770–3750	This study
7	sul3F2	TATCCAAAGCCCTAGGTTAG	AJ459418	3750–3770	This study
8	sul3R2	GAACTACGACTGGTTTC	AJ459418	2797–2780	This study
9	IntI1F	GGGTCAAGGATCTGGATTTCG	AF071413	4775–4755	21
10	IntI1R	ACATGCGTGTAAATCATCGTCG	AF071413	4333–4312	21
11	5′CS	GGCATCCAAGCAGCAAG	AF174129	1236–1252	21
12	3′CS	AAGCAGACTTGACCTGAT	AF174129	2813–2830	21
13	qacIF	ACTGGCTCTTTCTGGCTATT	EF051039	5064–5084	This study
14	qacIR	TAACGATAAGTCCCATGCCA	EF051039	5343–5323	This study
15	cmlA1F	CACTTCCAAGAACGCAGACA	EF051039	2621–2641	This study
16	cmlA1R	TTCCGATGCTTCCTAGCAGT	U12338	8020–8000	This study
17	cmlA1FR	ACTGCTAGGAAGCATCGGAA	EF051039	3823–3803	This study
18	aadA2R	TGACTTGATGATCTCGCC	AF174129	2692–2709	21
19	estX	TTCCTTATGTGCATGGGTT	EF051039	794–813	This study
20	dfrA12F	TTACGTCCAACGTTAGCAC	EF051037	1088–1107	This study
21	aadA1R	ATTGCGCTGCCATTCTCCA	EF051037	4179–4160	This study
22	psp R	ATCAGGGTGCCAGACAAGA	EF051039	1189–1170	This study
23	IS26F	AGCGGTAAATCGTGGAGTGA	AF205943	324–344	21
24	IS26R	AGGCCGGCATTTTCAGCGTG	AF205943	979–960	21
25	IS440R	TGCGGGTACTTACTCCTTG	FJ587511	6415–6396	This study
26	Orf1R	GCAATCCATTAGATTCATAC	FJ196385	10347–10327	This study
27	TnpM Fw	CCGTGGTGGTGCATAGCAT	AF071413	4020–4002	21
28	merA1	ACCATCGGCGGCACCTGCGT	AF071413	17597–17578	21
29	merA5	ACCATCGTCAGGTAGGGGAACAA	AF071413	16360–16382	21
30	copAF	ATGCGCCATAAGGCATTCA	NC_0050144	215–234	30
31	repAR	AGTCGCTTCAGATGGTCAT	NC_005014	1427–1408	30
32	mobP12F	GCAAAAGATGACACTGAYCCYGTTTT	NC_005014	67717–67743	1, 30
33	mobP12R	AGCGATGTGGATGTGAAGGTTATCHGTRTC	NC_002122	31165–31120	1, 30
34	ardAF	ATGTCTGTTGTTGCACCTGC	AP005147	61469–61811	PubMLSTa
35	ardAR	TCACCGACGGAACACATGACC	AP005147	61926–61906	PubMLST
36	trbAF	GCGGTTATCGGGCTACTA	AP005147	74976–74959	This study
37	pndAF	GAATTCGTTGTCTGTAGCA	AP005147	73503–73521	This study
38	sogSF	TTCCGGGGCGTAGACAATACT	AP005147	93088–93108	PubMLST
39	sogSR	AACAGTGATATGCCGTCGC	AP005147	93378–93360	PubMLST
40	pilVF	CCATATGACCATCCAGTGCG	AP005147	114765–114784	PubMLST
41	pilVR	AACCACTATCTCGCCAGCAG	AP005147	115080–115061	PubMLST

^ahttp://pubmlst.org/perl/bigsdb/bigsdb.pl?db=pubmlst_plasmid_seqdef.

^bThe primer sequences used in primer walking assays are available upon request.

Fig. 2.

Diversity of the sul3 integrons based on published studies and sequences deposited in the GenBank database. In silico comparative analysis was made using BLAST and CLUSTAL softwares available at the BLAST (http://www.ncbi.nlm.nih.gov/blast//) and ClustalW2 (http://www.ebi.ac.uk/Tools/clustalw2/index.html) websites. The sul3 gene is associated with class 1 integrons that differ from class 1 sul1 integrons in the 3′ region, which comprise the gene cassette initially annotated qacH but called qacI afterward in order to distinguish it from the unrelated qacH gene of Staphylococcus aureus (GenBank accession no. AF205943) (20, 22). ^a, the first described sul3 platform recovered from an E. coli swine isolate in Switzerland in 2002 (GenBank accession no. AJ459418); ^b, orf1 is also annotated as yqkA-yusZ or orfA-orfB (GenBank accession no. AY509004, EU219534, FM242710, FM244708, FM244709, FM244710, FM244712, and FM244713); ^c, insertions of IS10 or IS26 within IS440-sul3 were found in some isolates (GenBank accession no. FJ587511, HQ875013, and HQ875016) (Fig. 1); ^d, the orf1-mefB sequence was absent or not determined; ^e, the presence of sequences upstream of intI1 or downstream of tniC was not determined or was absent; ^f, mefB is absent or truncated. aadA2 corresponding to FM242710 is a hybrid of aadA1a and aadA2 containing attC_aadA1a. It is annotated aadA2 in the GenBank database.

Plasmids carrying sul3 belonged to a diversity of IncI1, IncY, and IncB/O groups (55 to 220 kb), mostly conjugative ones (86%). They were identified by PCR typing methods targeting replication and conjugation sequences of plasmids of Enterobacteriaceae (1, 5) and further hybridization of S1 nuclease-digested genomic DNA from E. coli transconjugants or wild-type strains with appropriate probes (30). Characterization of IncI1 plasmids also required RFLP profile comparison and sequencing of the whole replication region, relaxase (nikB) (1, 30), and genes included in the plasmid MLST scheme (http://pubmlst.org/perl/bigsdb/bigsdb.pl?db=pubmlst_plasmid_seqdef). Type III_S3 was identified on bla_SHV-12-IncI1 plasmids designated B, C1, C2, and D (100 to 150 kb). Genes linked to replication (cop, repY, and repA), transfer (nikB, trbA-pndA, sogS, and pilV), or restriction-modification systems (ardA) of plasmids B and D were identical to those carried by pCVM29188_101 from Salmonella enterica, an IncI1 plasmid carrying sul3 and bla_CMY-2 (GenBank accession no. CP001121). Plasmid B was identified from 1997 to 2006 in ESBL strains from different continents (data not shown). Plasmids C1 and C2 were considered IncI1-mosaic plasmids, as repA carried by plasmid C1 was similar to that carried by IncK plasmid R387, and plasmid C2 harbors repA and sogS alleles that are different from those harbored by pCVM29188_101. The repY and nikB genes carried by plasmid E were identical to those carried by IncI1 pSL476_91 and pRYC106 (GenBank accession no. NC_011081 and GQ892053, respectively). The type I_S3 integron was located on IncI1 plasmids similar to those of types B and D, while the type II_S3 integron was linked to nontransferable IncY, IncI1/Iγ, or IncB/O plasmids.

In summary, this work describes the recent spread of the IS440-sul3 platform, facilitated by its location on highly IncI1-transferable plasmids and by IS26-promoted rearrangements among multidrug resistance transposons and/or plasmids harbored by frequent E. coli clones. Coselection exerted by other antibiotics and/or biocides to which sulfonamide-resistant strains are also resistant, and the low fitness cost of plasmids in which sul genes are located, might be responsible for the spread and persistence of sul3, as suggested for other genes encoding trimethoprim-sulfonamide resistance (9, 29). The concurrent emergence and dissemination of the DHPS sul3 and ESBL genes among human Enterobacteriaceae since the early 1990s suggest the recent recruitment of adaptive mechanisms in different environments (animals and humans exposed to beta-lactams and sulfonamides) by the same predominant genetic platforms.