Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2011 May;55(5):1896–1905. doi: 10.1128/AAC.01756-10

Characterization of a Novel Arginine Catabolic Mobile Element (ACME) and Staphylococcal Chromosomal Cassette mec Composite Island with Significant Homology to Staphylococcus epidermidis ACME Type II in Methicillin-Resistant Staphylococcus aureus Genotype ST22-MRSA-IV▿

Anna C Shore 1, Angela S Rossney 2, Orla M Brennan 1, Peter M Kinnevey 1, Hilary Humphreys 3,4, Derek J Sullivan 1, Richard V Goering 5, Ralf Ehricht 6, Stefan Monecke 7, David C Coleman 1,*
PMCID: PMC3088263  PMID: 21343442

Abstract

The arginine catabolic mobile element (ACME) is prevalent among methicillin-resistant Staphylococcus aureus (MRSA) isolates of sequence type 8 (ST8) and staphylococcal chromosomal cassette mec (SCCmec) type IVa (USA300) (ST8-MRSA-IVa isolates), and evidence suggests that ACME enhances the ability of ST8-MRSA-IVa to grow and survive on its host. ACME has been identified in a small number of isolates belonging to other MRSA clones but is widespread among coagulase-negative staphylococci (CoNS). This study reports the first description of ACME in two distinct strains of the pandemic ST22-MRSA-IV clone. A total of 238 MRSA isolates recovered in Ireland between 1971 and 2008 were investigated for ACME using a DNA microarray. Twenty-three isolates (9.7%) were ACME positive, and all were either MRSA genotype ST8-MRSA-IVa (7/23, 30%) or MRSA genotype ST22-MRSA-IV (16/23, 70%). Whole-genome sequencing and comprehensive molecular characterization revealed the presence of a novel 46-kb ACME and staphylococcal chromosomal cassette mec (SCCmec) composite island (ACME/SCCmec-CI) in ST22-MRSA-IVh isolates (n = 15). This ACME/SCCmec-CI consists of a 12-kb DNA region previously identified in ACME type II in S. epidermidis ATCC 12228, a truncated copy of the J1 region of SCCmec type I, and a complete SCCmec type IVh element. The composite island has a novel genetic organization, with ACME located within orfX and SCCmec located downstream of ACME. One PVL locus-positive ST22-MRSA-IVa isolate carried ACME located downstream of SCCmec type IVa, as previously described in ST8-MRSA-IVa. These results suggest that ACME has been acquired by ST22-MRSA-IV on two independent occasions. At least one of these instances may have involved horizontal transfer and recombination events between MRSA and CoNS. The presence of ACME may enhance dissemination of ST22-MRSA-IV, an already successful MRSA clone.

INTRODUCTION

Methicillin-resistant Staphylococcus aureus (MRSA) has become a major cause of infection among patients in hospitals and in the community worldwide. The success of MRSA is partly due to its ability to adapt rapidly and to survive mainly through the acquisition and expression of exogenous genes from plasmids, bacteriophages, and other mobile genetic elements from other S. aureus strains and from coagulase-negative staphylococci (CoNS) (2, 9, 11, 20).

MRSA isolates of sequence type 8 (ST8) and staphylococcal chromosomal cassette mec (SCCmec) type IVa (ST8-MRSA-IVa; also known as USA300) is the predominant community-acquired (CA) MRSA strain in the United States, where its incidence is also increasing in health care settings, but this clone has also been recovered in many other countries worldwide (28). The extensive spread and success of ST8-MRSA-IVa has been partially attributed to the presence of a mobile genetic element, termed the arginine catabolic mobile element (ACME), which is thought to play an important role in its growth and survival (3). While most ST8-MRSA-IVa isolates identified to date contain ACME (8, 15, 28), it has been identified in only a small number of other MRSA genotypes, including ST5-MRSA-II (4, 8), ST59-MRSA-IVa (4), ST97-MRSA-V (5), ST1-MRSA-IVa (5), ST5-MRSA-IV (6), and ST239-MRSA-III (7), and among just two ST8-methicillin-susceptible S. aureus (MSSA) isolates (8). ACME has also been identified among CoNS, including S. epidermidis, S. haemolyticus, and S. capitis, in which it appears to be more prevalent and to have a more diverse genetic organization than in S. aureus (1, 3, 13, 21).

The ACMEs described in detail to date range in size from 31 kb in ST8-MRSA-IVa to 34 kb in S. epidermidis (3). They are integrated downstream of the staphylococcal chromosomal cassette (SCC) harboring the methicillin resistance gene mecA (SCCmec) and use the same attachment site as SCCmec for integration within orfX. Similar to SCCmec elements, ACME is flanked by repeat sequences, and SCCmec-encoded cassette chromosome recombinase (ccr) genes catalyze integration and excision of ACME from the staphylococcal chromosome (3). ACME exists as a composite island with SCCmec IVa (ACME/SCCmec-CI) in ST8-MRSA-IVa and within the staphylococcal composite island (SCC-CI) in S. epidermidis strain ATCC 12228 (3).

The two main gene clusters identified in ACME include the arc genes (arcA, arcB, arcC, and arcD) and the oligopeptide permease operon (opp) genes (opp-3A, opp-3B, opp-3C, opp-3D, and opp-3E) (3). Both arc and opp are homologs of genes that are recognized bacterial virulence factors (3). The ACME arc genes encode a complete arginine deiminase pathway that converts l-arginine to carbon dioxide, ATP, and ammonia. Arginine deiminase is a virulence factor in the human pathogen Streptococcus pyogenes (3). All S. aureus isolates carry an arc operon on the chromosome. Diep et al. (3) speculated that the presence of a second ACME-encoded arc operon in ST8-MRSA-IVa may enhance the ability of ST8-MRSA-IVa to grow and survive within its host. Similar to the arc operon, all S. aureus isolates have native opp operons (opp-1 and opp-2) which are also found in many other bacterial species and encode ABC transporter systems (3). Disruption of opp-1 and opp-2 has been shown to result in significant growth defects and attenuated virulence in S. aureus (3). The precise function of ACME has not yet been determined, but studies using animal models have shown that while ACME does not directly enhance virulence in ST8-MRSA-IVa, it does improve its fitness and ability to colonize skin and mucous membranes (4, 19).

Three ACME allotypes have been described to date in staphylococci. Type I ACME harbors both the arc and opp-3 gene clusters and has been identified in MRSA and S. epidermidis (1, 3, 13). Type II ACME harbors the arc genes but lacks opp-3, while type III harbors opp-3 but lacks the arc genes (3, 13). To date, types II and III ACME have been identified only in S. epidermidis, and variants of ACME I, II, and III have also been identified in S. epidermidis (1, 13).

MRSA has been endemic in Irish hospitals for more than 3 decades, and different MRSA clones have emerged, spread, and predominated during different time periods (e.g., ST250-MRSA-I/I-pls, ST239-MRSA-III/III-p1258/Tn554, ST8-MRSA-IIA-E, and ST22-MRSA-IV in the 1970s, 1980s, 1990s, and 2000s, respectively) (24). Since 2002, isolates belonging to the pandemic clone ST22-MRSA-IV have predominated and now account for more than 80% of MRSA isolates recovered from patients in Irish hospitals (26). CA-MRSA isolates harboring the Panton-Valentine leukocidin genes lukF-PV and lukS-PV have also been recovered in Ireland and belong predominantly to the ST8-MRSA-IV and ST30-MRSA-IV genotypes, but PVL locus-positive ST22-MRSA-IV, ST80-MRSA-IV, and ST154-MRSA-IV isolates have also been recognized (22).

The purpose of the present study was to investigate hospital-acquired MRSA (HA-MRSA) and CA-MRSA isolates from Ireland for the presence of ACME. The results of this investigation identified, for the first time, ACME in ST22-MRSA-IV. Comprehensive molecular characterization identified a novel ACME/SCCmec-CI with DNA sequence identity with regions of ACME type II previously described only in S. epidermidis, the J1 region of SCCmec type I, and an SCCmec type IVh element, together with a novel genomic organization of ACME and SCCmec.

MATERIALS AND METHODS

MRSA isolates.

A total of 238 MRSA isolates recovered in Ireland between 1971 and 2008 were investigated for the presence of ACME. Isolate details are shown in Table 1. Isolates representative of diverse genetic backgrounds were selected and comprised (i) 107 MRSA isolates representative of each different antibiogram-resistogram (AR) type, multilocus sequence type (MLST), and SCCmec type combination identified among MRSA isolates recovered from patients in Irish hospitals between 1971 and 2002 (24), (ii) 25 MRSA isolates representative of the MLST and SCCmec type combinations identified among PVL locus-positive MRSA isolates recovered from patients in Ireland between 1999 and 2005 (22), and (iii) 106 MRSA isolates recovered from patients and environmental sites in four wards of a 700-bed acute-care hospital in Dublin, Ireland, in 2007 and 2008 (26).

Table 1.

MRSA isolates investigated for the presence of ACME arc genes by DNA microarray analysisa

MRSA source/description Time period (yr) Reference MRSA genotype No. (%) of isolates
Investigated ACME arc positive
Irish hospitals 1971–2002 24 ST250-MRSA-I/I-pls 10 0
ST239-MRSA-III/III-Tn554/pI258 12 0
ST247-MRSA-Ia 3 0
ST8-MRSA-IIA/IIB/IIC/IID/IIE 33 0
ST8-MRSA-IVE/IVF 6 0
ST22-MRSA-IVh 11 0
ST22-MRSA-IVa 2 0
ST36-MRSA-II 6 0
ST5-MRSA-II 14 0
ST30-MRSA-IV nonsubtypeable 4 0
ST45-MRSA-IVa 1 0
ST496-MRSA-II 1 0
ST12-MRSA-IVc 1 0
ST609-MRSA-VA 1 0
ST94-MRSA-IVg 1 0
ST5-MRSA-IV nonsubtypeable 1 0
PVL locus-positive CA-MRSA 1999–2005 22 ST8-MRSA-IVa 8 7
ST22-MRSA-IVa 1 1
ST22-MRSA-IVh 1 0
ST30-MRSA-IVc 4 0
ST30-MRSA-IV nonsubtyeable 7 0
ST154-MRSA-IVg 1 0
ST80-MRSA-IVc 2 0
ST5-MRSA-IVa 1 0
Four wards in one Irish hospital 2007–2008 26 ST22-MRSA-IVh 100 15
ST22-MRSA-IVa 1 0
ST8-MRSA-IIE 2 0
ST8-MRSA-II novel subtypes 1 0
ST87-MRSA-IVb 1 0
ST36-MRSA-II 1 0
Total 238 23 (9.7)
a

The StaphyType kit DNA microarray (Alere Technologies) was used (16).

All isolates were previously typed by AR typing, pulsed-field gel electrophoresis (PFGE), and SCCmec typing as described elsewhere (22, 24, 26). Isolates carrying the SCCmec IV element recovered in 2007 and 2008 had previously undergone SCCmec IV subtyping for subtypes IVa, IVb, IVc, IVd, IVE, IVF, IVg, and IVh (Table 1) (26). All PVL locus-positive SCCmec IV isolates had previously been subtyped for SCCmec IVa to IVF only (22), but any nonsubtypeable isolates were subtyped as part of the present study using the method of Milheirico et al. (2007) (12), which also recognizes SCCmec IV subtypes IVg and IVh (Table 1). Isolates recovered between 1971 and 2002 had not previously undergone SCCmec IV subtyping, but as part of the present study they were also subtyped using the method of Milheirico et al. (2007) (12) (Table 1). All PVL locus-positive isolates and isolates recovered between 1971 and 2002 had previously undergone MLST (22, 24). Isolates recovered in 2007 and 2008 previously underwent typing by sequencing of the SCCmec-associated direct repeat unit (dru) and the staphylococcal protein A (spa) gene (26). One isolate representative of each spa type underwent MLST, and the STs of all other isolates belonging to the same spa type were inferred from this ST (26).

DNA microarray analysis.

All isolates were investigated using a DNA microarray system, the StaphyType kit (Alere Technologies GmbH, Jena, Germany). The StaphyType kit consists of individual DNA microarrays mounted in 8-well microtiter strips which detect 334 S. aureus gene sequences and alleles, including species-specific, antimicrobial resistance-associated, and virulence-associated genes and typing markers. Virulence genes investigated include the ACME arcA, arcB, arcC, and arcD genes (referred to here as ACME arc). The ArrayMate software (Alere Technologies), which was used to analyze data generated by the microarray system, can assign isolates to inferred MLST STs and/or clonal complexes (CCs) by comparing the DNA microarray results of the test isolates to microarray profiles from a collection of reference strains held in the ArrayMate database that have been previously typed by MLST (16, 17). Genomic DNA was extracted from all isolates by enzymatic lysis and a DNeasy kit (Qiagen, Crawley, West Sussex, United Kingdom) as described previously (16). The DNA microarray procedures have been described previously and were performed according to the manufacturer's instructions (14, 16).

Molecular typing of ACME arc-positive MRSA isolates.

All ACME arc-positive MRSA isolates that had not previously been typed by spa and dru typing were subjected to spa and dru typing as described previously (26, 27). Any ACME arc-positive isolate that had not previously undergone MLST analysis had its ST assigned using the DNA microarray.

ACME arcA PCR and sequencing.

Previously described primers (3) and conditions (5) were used to confirm the presence of the ACME arcA gene in all ACME arc-positive isolates detected by microarray analysis. DNA fragments were obtained by PCR amplification of chromosomal DNA using GoTaq DNA polymerase (Promega Corporation, Madison, WI) according to the manufacturer's instructions. PCR products were visualized by agarose gel electrophoresis.

Whole-genome sequencing and PCR to close gaps between contigs.

The whole genome of one MRSA isolate representative of the predominant spa, dru, and SCCmec type combination of ST22-MRSA-IV isolates identified to be harboring ACME arc genes (M08/0126) was sequenced to determine the location and genetic organization of ACME. High-throughput de novo sequencing was undertaken commercially by Geneservice (Source BioScience plc, Nottingham, United Kingdom) using an Illumina genome analyzer system (Essex, United Kingdom). Contigs were analyzed using the Artemis DNA sequence viewer and annotation tool (23) and BLAST software (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Contigs that were identified as containing ACME- or SCCmec-associated DNA sequences were aligned using the BioNumerics (version 5.1; Applied Maths, Ghent, Belgium) and DNA Strider (version 1.3f11; CEA Saclay, Gif-sur-Yvette, France) software packages. Any gaps identified between ACME- and SCCmec-related contigs in the whole-genome sequence of M08/0126 were closed by primer walking using PCR with primers based on the surrounding contigs and the Expand long-template PCR system (Roche Diagnostics Ltd., West Sussex, United Kingdom), followed by amplimer sequencing. Data were analyzed and overlapping sequences were assembled using the BLAST, Bionumerics, and DNA Strider software packages.

Confirmation of genetic organization and location of ACME and SCCmec.

Having determined the genetic organization of ACME and SCCmec in ST22-MRSA-IVh isolate M08/0126 using the whole-genome sequence, the inferred genetic organization was confirmed by designing three overlapping primer pairs based on this sequence to amplify the ACME and SCCmec regions of M08/0126 extending from (i) orfX to ACME arcA (Table 2, primers orfX F1 and arcA R1), (ii) ACME arcA to the region with homology to the J1 region of SCCmec I (Table 2, primers arcA F1 and ΔCE010 R1), and (iii) the SCCmec I J1 region to SCCmec IVh (Table 2, primers ΔCE010 F1 and J3IVh R1). These PCR assays were performed by amplifying chromosomal DNA using the Expand long-template PCR system (Roche Diagnostics Ltd.). PCR products were visualized by agarose gel electrophoresis, and the sizes of the amplicons obtained were compared to the expected size of amplicons based on the whole-genome sequence (Table 2).

Table 2.

Primers designed and used in the present study

Primer application Primer pair Nucleotide sequence (5′–3′) Nucleotide coordinates Region amplified Product size (bp)
Long-range PCR to confirm orfX F1 CATTCAGCAAAATGACATTC 377–396a orfX to ACME arcA 7,887
    the genetic organization arcA R1 AATGGTACAAGGACCCATTC 8264–8245a
    of the ACME/SCCmec
    region in ST22-MRSA- arcA F1 GTTTGAGCAAATTTGTCATG 8088–8107a arcA to SCCmec I 8,647
    IVh M08/0126     J1-like region
ΔCE010 R1 ATCAGGACTACCTGGTTCCA 16735–16716a
ΔCE010 F1 CATATGAAACTAAACGCGTA 16683–16702a SCCmec I J1-like region to J3 region of SCCmec IVh 8,284
J3IVh R1 ACCAAGCTATCATAGGATGT 24967–24948a
Confirmation of genetic orfX F1 CATTCAGCAAAATGACATTC 377–396a orfX to ACME 943
    organization of ACME ACMEII R1 GAGACTGCTTCTTTGCTCAC 1320–1301a
    and SCCmec in all
    ACME arc-positive ST22-MRSA-IVh isolates ACME/SCCmecI F1 AGTTACTGCTAATGGAACGG 23808–23827a SCCmec I J1-like region to J3 region of SCCmec IVh 1,159
J3IVh R1 ACCAAGCTATCATAGGATGT 24967–24948a
Confirmation of location of IVa R1 CACGTTATGGAGGTGCTCTG 57628–57647b J1 region of SCCmec 495
    ACME in all ACME arc-     IVa to ACME I
    positive ST8-MRSA-IVa isolates and ST22-MRSA-IVa isolate E1401 C CCTCCTTCACTTAGCACTG 58123–58092b
a

Nucleotide coordinates based on the nucleotide sequence of the orfX-ACME-SCCmec region of ST22-MRSA-IVh isolate M08/0126 (GenBank accession number FR753166).

b

Nucleotide coordinates based on the nucleotide sequence of ST8-MRSA-IVa (USA300) strain FPR3757 (GenBank accession number NC007793).

Confirmation of the genetic organization of ACME and SCCmec in all ACME arc-positive ST22-MRSA-IVh isolates was performed using primer pairs designed to amplify the junction regions between orfX and ACME (Table 2, primers orfX F1 and ACMEII R1) and the region with homology to J1 of SCCmec I and SCCmec IVh (Table 2, primers ACME/SCCmec I F1 and J3IVh R1). PCR assays were performed using GoTaq DNA polymerase (Promega). PCR products were visualized by agarose gel electrophoresis, and the sizes of the amplicons were compared to those obtained with template DNA from the whole-genome-sequenced isolate M08/0126 and to the expected size of amplicons based on the whole-genome sequence of this isolate (Table 2). Since all isolates yielded amplicons of the same size using these PCR assays, the PCR products for the whole-genome-sequenced isolate (M08/0126) and one other isolate (M08/0119) were sequenced commercially by Geneservice to confirm the DNA sequence of these junction regions.

Confirmation of the location of ACME in all ACME arc-positive ST8-MRSA-IVa isolates was performed using PCR with primers C and IVa R1 (Table 2) to amplify from the J1 region of SCCmec IVa to ACME I, based on the previously published whole-genome sequence of ST8-MRSA-IVa isolate FPR3757 (GenBank accession number NC007793). Template DNA from one ACME arc-positive ST22-MRSA-IVa isolate (E1401) which failed to yield any amplicons using the primers based on the ACME/SCCmec region of whole-genome-sequenced ST22-MRSA-IVh isolate M08/0126 was also investigated using the ST8-MRSA-IVa (USA300)-specific primers. PCR assays were performed as described above, and the sizes of the amplicons were compared to the expected sizes of the amplicons on the basis of the whole-genome sequence of ST8-MRSA-IVa isolate FPR3757 (Table 2). The PCR products obtained for one ST8-MRSA-IVa isolate (ML224) and the ST22-MRSA-IVa isolate (E1401) were sequenced by Geneservice to confirm the DNA sequence of this junction region in these isolates.

Nucleotide sequence accession number.

The nucleotide sequence of the ACME/SCCmec-CI of ST22-MRSA-IVh has been deposited in GenBank under accession number FR753166.

RESULTS

Identification of ACME arc-positive MRSA isolates.

Twenty-three of the 238 isolates investigated (9.7%) were found to be positive for ACME arc genes (Table 3). Using MLST, SCCmec typing and the DNA microarray, the ACME arc-positive isolates were assigned to two distinct genotypes, ST8-MRSA-IVa (7/23, 30%) and ST22-MRSA-IV (16/23, 70%) (Table 3). The DNA microarray results for the ACME arc-positive isolates are shown in Table 4.

Table 3.

Details of 23 ACME arc-positive MRSA isolates

MRSA description/source Isolate no. Yr of isolation Isolate source Antimicrobial resistance patterna ST SCCmec type spa type dru type PFT DNA microarray groupc
PVL locus positive ML224 2003 Skin abscess AMP, CAD, CIP, ERY, KAN, NEO 8 IVa t008 dt9g 99023 ST8-MRSA-IV (a)
M05/0199 2005 Pneumonia (USA travel) AMP, CIP, ERY, KAN, NEO 8 IVa t008 dt9g 99025 ST8-MRSA-IV (a)
M05/0259 2005 Face infection AMP, ERY, KAN, NEO 8 IVa t008 dt9g 99023 ST8-MRSA-IV (a)
M05/0028 2005 Buttock abscess AMI, AMP, ERY, KAN, NEO 8 IVa t008 dt9g 99023 ST8-MRSA-IV (a)
M04/0266 2005 Inguinal lymphadenitis AMI, AMP, ERY, KAN, NEO 8 IVa t4306 dt9g 99017 ST8-MRSA-IV (a)
M05/0060 2005 Skin scalp abscess AMI, AMP, CHL, ERY, KAN, LIN, NEO 8 IVa t008 dt9g 99024 ST8-MRSA-IV (b)
M05/0100 2005 Staff screening AMP, CIP, ERY 8 IVa t008 dt9z 99023 ST8-MRSA-IV (c)
E1401 2003 Blood/bacteremia AMP, ERY 22 IVa t2480 dt10am 01003 ST22-MRSA-IV (a)
Four-ward study M08/0119 2008 Nasal AMP, CAD, CIP, ERY, KAN, LIN, MUP, TOB 22 IVh t3185 dt10o 01154 ST22-MRSA-IV (b)
M08/0121 2008 Air AMP, CAD, CIP, ERY, KAN, LIN, MUP, TOB 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (b)
M08/0122 2008 Air AMP, CAD, CIP, ERY, GEN, KAN, LIN, MUP, TOB 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (b)
M08/0123 2008 Air AMP, CAD, CIP, ERY, GEN, KAN, LIN, MUP, TOB 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (b)
M08/0124 2008 Air AMP, CAD, CIP, ERY, GEN, KAN, LIN, MUP, TOB 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (b)
M08/0126 2008 Mattress AMP, CAD, CIP, ERY, GEN, KAN, LIN, MUP, TOB 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (b)
M08/0129 2008 Bathroom floor AMP, CAD, CIP, ERY, GEN, KAN, LIN, MUP, TOB 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (b)
M08/0131 2008 Air AMP, CAD, CIP, ERY, GEN, KAN, LIN, MUP, TOB 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (b)
M08/0132 2008 Air AMP, CAD, CIP, ERY, GEN, KAN, LIN, MUP, TOB 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (b)
M08/0133 2008 Air AMP, CAD, CIP, ERY, GEN, KAN, LIN, MUP, TOB 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (b)
M08/0135 2008 Mattress AMP, CAD, CIP, ERY, GEN, KAN, LIN, MUP, TOB 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (b)
M08/0161 2008 Bathroom floor AMP, CAD, CIP, ERY, GEN, KAN, LIN, MUP, TOB 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (b)
M08/0128 2008 Air AMP, CAD, CIP, ERY, GEN, KAN, LIN, MUP, TOB 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (c)
M08/0134 2008 Air AMP, CAD, CIP, ERY 22 IVh t3185 dt10o 01154 ST22-MRSA-IV (d)
M08/0136 2008 Mattress AMP, CAD, CIP, ERY 22b IVh t3185 dt10o 01154 ST22-MRSA-IV (d)
a

Antimicrobials tested included amikacin (AMI), ampicillin (AMP), cadmium acetate (CAD), chloramphenicol (CHL), ciprofloxacin (CIP), erythromycin (ERY), ethidium bromide, fusidic acid, gentamicin (GEN), kanamycin (KAN), lincomycin (LIN), mercuric chloride, mupirocin (MUP), neomycin (NEO), phenyl mercuric acetate, rifampin, spectinomycin (SPC), streptomycin, sulfonamide, tetracycline, tobramycin (TOB), trimethoprim, and vancomycin.

b

ST assigned by DNA microarray analysis using the StaphyType kit (Alere Technologies). Other STs were also determined by MLST.

c

Isolates within each ST-SCCmec type (ST8-MRSA-IV or ST22-MRSA-IV) were assigned to DNA microarray groups on the basis of the presence of a unique combination of virulence and/or antimicrobial resistance genes. DNA microarray results are shown in Table 4.

Table 4.

DNA microarraya hybridization profiles of the ACME arc-positive ST8-MRSA-IVa, ST22-MRSA-IVh, and ST22-MRSA-IVa isolates identified in the present study

Gene class Gene(s) Result for the following genotype/DNA microarray type of the indicated groupb (no. of isolates):
ST8-MRSA-IVa/ST8-MRSA-IV
ST22-MRSA-IVa/ST22-MRSA-IV (a) (1) ST22-MRSA-IVh/ST22-MRSA-IV
(a) (5) (b) (1) (c) (1) (b) (12) (c) (1) (d) (2)
Species markers katA, coa, nuc, spa Pos Pos Pos Pos Pos Pos Pos
agr group agr group I Pos Pos Pos Pos Pos Pos Pos
SCCmec-associated mecA Pos Pos Pos Pos Pos Pos Pos
    markers ΔmecR Pos Pos Pos Pos Pos Pos Pos
mecR-mecI Neg Neg Neg Neg Neg Neg Neg
ccrA-1 and ccrB-1 Neg Neg Neg Neg Neg Neg Neg
Q9XB68-dcs Pos Pos Pos Pos Pos Pos Pos
ccrA-2 and ccrB-2 Pos Pos Pos Pos Pos Pos Pos
kdp-SCC locus Neg Neg Neg Neg Neg Neg Neg
ccrA-3 and ccrB-3 Neg Neg Neg Neg Neg Neg Neg
ccrC, ccrA-4, and ccrB-4 Neg Neg Neg Neg Neg Neg Neg
Antimicrobial resistance blaZ-blaI-blaR1 Pos Pos Pos Pos Pos Neg Pos
    genes erm(A), erm(B) Neg Neg Neg Neg Neg Neg Neg
erm(C) Neg Neg Neg Pos Pos Pos Pos
lnu(A) Neg Neg Neg Neg Pos Neg Neg
msr(A), mph(C) Pos Pos Pos Neg Neg Neg Neg
aacA-aphD Neg Neg Neg Neg Pos Neg Neg
aadD Neg Neg Neg Neg Pos Neg Neg
aphA3-sat Pos Pos Neg Neg Neg Neg Neg
dfrS1 Neg Neg Neg Neg Neg Neg Neg
far1 Neg Neg Neg Neg Neg Neg Neg
mupA Neg Neg Neg Neg Pos Neg Neg
tet(K) Neg Neg Neg Neg Neg Neg Neg
tet(M) Neg Neg Neg Neg Neg Neg Neg
cat Neg Neg Neg Neg Neg Neg Neg
cfr Neg Pos Neg Neg Neg Neg Neg
fexA Neg Pos Neg Neg Neg Neg Neg
fosB Pos Pos Pos Neg Neg Neg Neg
Virulence-associated tst1 Neg Neg Neg Neg Neg Neg Neg
    genes sea, seb, see, seh Neg Neg Neg Neg Neg Neg Neg
sec and sel, sed, sej, and ser Neg Neg Neg Neg Neg Neg Neg
seg, sei, sem, sen, seo, and seu Neg Neg Neg Pos Posc Pos Pos
sek and seq Pos Pos Pos Neg Neg Neg Neg
lukF-PV, lukS-PV Pos Pos Pos Pos Neg Neg Neg
sak, chp, and scn Pos Pos Pos Neg Pos Pos Pos
etA, etB, and etC Neg Neg Neg Neg Neg Neg Neg
edinA, edinB, and edinC Neg Neg Neg Neg Neg Neg Neg
arcA, arcB, arcC, and arcD Pos Pos Pos Pos Pos Pos Pos
Capsule type Capsule type 5 Pos Pos Pos Pos Pos Pos Pos
Capsule type 8 Neg Neg Neg Neg Neg Neg Neg
a

The StaphyType kit (Alere Technologies) was used for DNA microarray analysis. Full data sets are available upon request.

b

Isolates within each ST-SCCmec type were assigned to DNA microarray groups on the basis of the presence of a unique combination of virulence and/or antimicrobial resistance genes. The ST8-MRSA-IV and ST22-MRSA-IV isolates were differentiated into three groups and four groups, respectively (shown in Table 3). Pos, positive; Neg, negative.

c

One isolate, M08/0122, in microarray group ST22-MRSA-IV (b) was positive for the enterotoxin gene cluster genes seg, sem, sen, seo, and seu/y but lacked sei.

ACME arc-positive ST8-MRSA-IVa isolates.

The seven ACME arc-positive ST8 isolates were PVL locus positive, harbored SCCmec IVa, exhibited four pulsed-field types (PFTs), and belonged to spa type t008 (6/7 isolates) or t4306 (1/7 isolates) and to dru type dt9g (6/7 isolates) or dt9z (1/7 isolates). Each of these spa or dru type pairs differs in single repeats only (Table 4).

The DNA microarray assigned these isolates to the ST8-MRSA-IV clone and, in addition to detecting mecA and the ACME arc genes, showed that they all harbored the beta-lactam resistance gene blaZ, the erythromycin resistance genes msr(A) and mph(C), the fosfomycin resistance gene fosB, enterotoxins K and Q (sek and seq, respectively), the PVL loci lukF-PV and lukS-PV, and the immune evasion cluster (IEC) genes sak, chp, and scn (Table 4). The DNA microarray differentiated these seven isolates into three microarray groups, designated ST8-MRSA-IV (a) to (c) (Table 4). Microarray group ST8-MRSA-IV (a) contained five isolates harboring the aminoglycoside and streptothricin genes aphA3 and sat, respectively. The single isolate in microarray group ST8-MRSA-IV (b) also harbored aphA3 and sat, but in addition, it carried the multidrug resistance gene cfr and the chloramphenicol resistance gene fexA. This is the first ST8-MRSA-IVa (USA300) isolate reported to carry cfr; detailed localization of cfr and fexA to a novel conjugative plasmid (pCSFS7) in this isolate has been described in a recent study (25). The single isolate in microarray group ST8-MRSA-IV (c) lacked aphA3, sat, cfr, and fexA (Table 4).

ACME arc-positive ST22-MRSA-IV isolates.

Fifteen of the 16 ACME arc-positive ST22-MRSA-IV isolates (94%) were PVL locus negative, harbored SCCmec IVh, and exhibited PFT 01154, spa type t3185, and dru type dt10o (Table 3). One ST22-MRSA-IV isolate was PVL locus positive, harbored SCCmec IVa (22), and exhibited a PFT (01003), spa type (t2480), and dru type (dt10am) different from those exhibited by the other ACME arc-positive ST22-MRSA-IV isolates (Table 3).

The DNA microarray assigned these 16 ACME arc-positive isolates to the ST22-MRSA-IV clone and, in addition to detecting mecA and the ACME arc genes, showed that they all carried the macrolide, lincosamide, and streptogramin B resistance gene erm(C) and the enterotoxin gene cluster (egc), consisting of seg, sei, sem, sen, seo, and seu-sey (Table 4). Fifteen of the 16 ST22-MRSA-IV isolates harbored the beta-lactam resistance gene blaZ. These isolates were differentiated into four microarray groups designated ST22-MRSA-IV (a) to (d) (Table 4). Microarray group ST22-MRSA-IV (a) consisted of the single PVL locus-positive ST22-MRSA-IVa isolate. This was the only ST22-MRSA-IV isolate that harbored the PVL locus genes but lacked the IEC genes sak, chp, and scn. Microarray group ST22-MRSA-IV (b) contained 12 ST22-MRSA-IVh isolates, characterized by the presence of genes encoding resistance to lincomycin [lnu(A)], aminoglycosides (aacA-aphD and aadD), and mupirocin (mupA), as well as the IEC genes. Microarray groups ST22-MRSA-IV (c) and (d) consisted of one and two isolates, respectively. Isolates in both groups harbored the IEC genes but lacked the antimicrobial resistance genes lnu(A), aacA-aphD, aadD, and mupA, characteristic of microarray group ST22-MRSA-IV (b) isolates. In addition, microarray group ST22-MRSA-IV (c) isolates lacked the blaZ gene (Table 4).

Confirmation of ACME arcA in isolates identified to be ACME arc positive by DNA microarray analysis.

The presence of ACME in the 23 ACME arc-positive isolates was confirmed by PCR using previously described primers specific for the ACME arcA region. All isolates yielded amplicons of the expected size, corresponding to the amplification of an internal segment of ACME arcA.

Novel ACME and SCCmec composite island in ST22-MRSA-IVh isolate M08/0126.

Whole-genome sequencing of ST22-MRSA-IVh isolate M08/0126 yielded 272 contigs ranging in size from ca. 200 bp to 200 kb. ACME- and/or SCCmec-associated DNA sequences were identified in five contigs ranging in size from 1.4 kb to 73 kb. The gaps between ACME- and SCCmec-related contigs were closed using long-range PCR amplification and sequencing with primers based on the surrounding contigs. This analysis revealed the presence of a novel ca. 46-kb ACME/SCCmec-CI in M08/0126 consisting of a 12-kb DNA region previously identified in ACME type II in S. epidermidis ATCC 12228, a truncated copy of the J1 region of SCCmec I, and a complete SCCmec IVh element (Fig. 1a). Because the present study focused on the novel 46-kb ACME/SCCmec-CI element, DNA regions outside the SCCmec and/or ACME sequences of any of these or the other contigs are not discussed further here.

Fig. 1.

Fig. 1.

Schematic diagram showing the genetic organization of the novel ACME/SCCmec-CI identified in the present study in ST22-MRSA-IVh isolate M08/0126 (GenBank accession number FR753166) (a), the ACME-CI previously reported in S. epidermidis ATCC 12228 (NC004461) (b), and the ACME and SCCmec elements previously identified in the ST8-MRSA-IVa (USA300) isolate FPR3757 (c). The structure of the novel ACME-CI was determined by high-throughput whole-genome sequencing of M08/0126 and was confirmed using primers spanning the ACME/SCCmec region. Abbreviations: DR, direct repeat sequence; IR, inverted repeat sequence.

In all MRSA and methicillin-resistant S. epidermidis (MRSE) isolates reported to harbor SCCmec and ACME, SCCmec has always been found to be located within orfX, with ACME being downstream of SCCmec (Fig. 1b and c). While ACME/SCCmec-CI was integrated at the same nucleotide position within orfX in M08/0126 as in all other MRSA/MRSE isolates described to date, ACME was located within orfX and the SCCmec element was located downstream of ACME (Fig. 1a).

The ACME-CI was flanked by 18-bp direct repeat (DR) sequences, one abutting the orfX-ACME junction within the ACME-CI (DR-1; Fig. 1a) and the other in the chromosomal region immediately adjacent to the right terminus of SCCmec IVh (DR-2; Fig. 1a). Identical 7-bp inverted repeat (IR) sequences were also identified within DR-1 (IR-1; Fig. 1a) and immediately preceding DR-2 (IR-2; Fig. 1a). Two additional 18-bp DRs and three additional 7-bp IRs were also identified within the ACME-CI. The two additional DRs were identified in the DNA sequence between ACME and the region with homology to the J1 region of SCCmec I (Fig. 1a, DR-3; 13/18 nucleotides identical to DR-1 and DR-2) and within SCCmec IVh adjacent to the J1 SCCmec I-SCCmec IVh junction (Fig. 1a). The three additional IRs were identified within DR-3 (Fig. 1) and DR-4 (Fig. 1a) and at the J1 SCCmec I-SCCmec IVh junction region within J1 SCCmec I (Fig. 1a).

The ACME region in M08/0126 consisted of a ca. 12-kb DNA sequence and included the ACME arc genes in the same order and orientation as previously described for ACME (Fig. 1a). The ACME arc genes (including argR) exhibited ≥99.8% DNA sequence identity with those of ST8-MRSA-IVa (USA300) isolate FPR3757 and S. epidermidis ATCC 12228 (Fig. 1b and c). The ACME arc genes were surrounded by a ca. 5.8-kb DNA sequence (2.7 kb downstream and 3.1 kb upstream) with 99% DNA sequence identity with the region surrounding the ACME arc in S. epidermidis ATCC 12228 (Fig. 1). A complete IS431 element was identified immediately adjacent to the ACME region (Fig. 1a). A ca. 9.5-kb region consisting of several open reading frames (ORFs) in the same order and orientation as previously found only in the J1 region of SCCmec I (GenBank accession number AB033763) was identified ca. 1.5 kb upstream of IS431 in the ACME-CI (Fig. 1a). This region included all ORFs previously identified within the J1 region of SCCmec I extending from the SCCmec I-chromosomal junction to within ORF CE010. ORF CE010 contains a Shine-Dalgarno repeat and is similar to the gene encoding the S. aureus plasmin-sensitive surface protein (pls). All ORFs within this region of ACME-CI, except for the one ORF with homology with CE010, exhibited 99 to 100% DNA sequence identity with the corresponding ORFs from SCCmec I. The CE010 region in SCCmec I consists of a 5,097-bp DNA sequence, while in ACME-CI it was 3,451 bp and exhibited 50% DNA sequence identity with CE010; and no other significant homology was found with any sequence in the GenBank database. A complete SCCmec IVh element with a class A mec complex and type 2 ccr genes was identified adjacent to this SCCmec I region in ACME-CI (Fig. 1a).

Confirmation of presence of ACME-CI in other ST22-MRSA-IVh isolates.

The presence of the ACME-CI in the remaining 14 ACME arc-positive ST22-MRSA-IVh isolates was confirmed by PCR using primers designed to amplify the orfX-ACME and the J1 SCCmec I-SCCmec IVh junction regions in ACME-CI (Table 2). All isolates yielded amplicons of the expected size using both primer pairs. Sequencing of the amplicons from M08/0126 and one other isolate (M08/1119) confirmed that these junction regions were identical to the corresponding region determined by whole-genome sequencing of M08/0126. PCR amplification using these two primer pairs was also attempted on template DNA from ACME arc-positive ST22-MRSA-IVa isolate E1401 (Table 2), but no amplicons were obtained.

Determination of location of ACME in ST8-MRSA-IVa and ST22-MRSA-IVa isolates.

Investigation of the location of ACME in the seven ACME arc-positive ST8-MRSA-IVa isolates was performed using PCR and primers to amplify from the J1 region of SCCmec IVa to within ACME type I, based on the previously published whole-genome sequence of ACME-positive ST8-MRSA-IVa (USA300) isolate FPR3757. In addition, PCR using this SCCmec IVa/ACME primer pair was also performed on ST22-MRSA-IVa isolate E1401 because this isolate failed to yield any amplicons using ACME-CI-specific primers and, unlike the other ACME-positive ST22-MRSA-IV isolates, E1401 harbored SCCmec IVa, which is the same SCCmec type identified in the ACME-positive ST8 isolates recognized in the present study. All isolates yielded amplicons of the expected size, indicating the presence of ACME adjacent to SCCmec in these isolates, similar to the location described previously for ST8-MRSA-IVa (USA300). Sequencing of the amplicons from one ST8-MRSA-IVa isolate (ML224) and the ST22-MRSA-IVa isolate (E1401) revealed that the SCCmec IVa-ACME junction regions in these two isolates exhibited 100% DNA sequence identity with each other and with that of ST8-MRSA-IVa (USA300) isolate FPR3757.

DISCUSSION

Although ACME is widespread among ST8-MRSA-IVa (USA300) isolates, it has been identified only in a small number of isolates belonging to other MRSA clones. This report is, to the best of our knowledge, the first description of ACME with significant DNA sequence identity with ACME type II from S. epidermidis in the pandemic ST22-MRSA-IV clone. The emergence of an ACME-positive variant of ST22-MRSA-IV may have the potential to enhance the growth and survival of this already successful MRSA clone. This is especially worrying because, like ST8-MRSA-IVa (USA300), one of the ACME-positive ST22-MRSA-IV isolates was also PVL locus positive. While ACME does not directly act as a virulence factor or contribute directly to the ability of staphylococci to cause disease, evidence suggests that it contributes to bacterial growth, survival, transmission, and colonization within the host (3, 4, 13, 19).

In the present study, ACME was identified in two distinct strains of ST22-MRSA-IV; one strain (represented by a single isolate) was PVL locus positive, while the other (represented by 15 isolates) was PVL locus negative. The PVL locus-positive strain was recovered in 2004 from a 69-year-old Irish male with CA-MRSA bacteremia; it had distinct spa (t2480), dru (dt10am), pulsed-field (01003), and SCCmec (IVa) types. Isolates of the PVL locus-negative strain (spa type t3185, dru type dt10o, PFT 01154, and SCCmec IVh) were recovered from one patient and a variety of environmental sites in one ward in a Dublin hospital during a 4-week period in 2008. Isolates of the latter strain were differentiated into three subgroups using the DNA microarray; the largest group (represented by 12 isolates) harbored genes encoding lincomycin, aminoglycoside, and high-level mupirocin resistance and a lysogenic bacteriophage encoding IEC. The combination of ACME and high-level mupirocin resistance in ST22-MRSA-IV is an important finding, because while ACME may enhance host tissue colonization, high-level mupirocin resistance may also play a role in successful host colonization by resisting nasal decolonization by mupirocin therapy, a major strategy in preventing the spread of MRSA.

The ACME-positive ST22-MRSA-IVh isolates harbored a 46-kb ACME/SCCmec- CI with several novel characteristics. First, this ACME/SCCmec-CI consisted of a 12-kb ACME region with >99% DNA sequence identity with part of ACME II previously described only in S. epidermidis, a 9.5-kb DNA region with significant homology to part of the J1 region of SCCmec I, and an SCCmec IVh element. The presence of a DNA sequence with significant identity to the J1 region of SCCmec I was a surprising finding, since SCCmec types I and Ia have not been identified among Irish MRSA isolates since 1999. MRSA strains that predominated in Irish hospitals in the 1970s and 1980s harbored SCCmec I, and strains harboring SCCmec Ia were recovered sporadically between 1989 and 1999 (24). It is interesting to speculate that both ACME and the SCCmec I J1 region of the ST22-MRSA-IVh ACME/SCCmec-CI may have originated in CoNS and that recombination and horizontal transfer of DNA occurred between CoNS and an ST22-MRSA-IVh isolate, resulting in this novel ACME/SCCmec-CI. While the precise order of these events and the direction of transfer are unknown, the higher prevalence and diversity of ACME and SCCmec among CoNS and the fact that the ACME II allotype has not previously been identified in MRSA suggest that it may have originated in CoNS with subsequent transfer to S. aureus (13). However, confirmation of this hypothesis requires detailed molecular characterization of ACME and SCCmec in CoNS. Other studies have also found evidence to suggest interspecies transfer of DNA, including ACME, SCCmec, SCC-CI, and antimicrobial resistance genes, between S. aureus and CoNS (13, 18, 25, 27).

Another unique and striking feature of the novel ACME/SCCmec-CI reported in the present study is the location of ACME and SCCmec relative to orfX. In contrast to previously described ACME/SCC-CIs, in which ACME is located downstream of SCCmec (3), SCCmec was located downstream of ACME in the ST22-MRSA-IVh isolates. This suggests that ACME may have integrated into the chromosomes of these isolates prior to the integration of SCCmec. Future analysis of ST22 MSSA isolates for the presence of ACME may help to further clarify this. The IS431 element identified adjacent to the ACME region of ST22-MRSA-IVh may have played a role in the emergence of this novel ACME/SCCmec element, as insertion sequence elements have previously been shown to promote genetic rearrangements (10).

In the ACME-positive PVL locus-positive ST22-MRSA-IVa isolate reported in the present study, ACME was located downstream of SCCmec IVa, as previously described in ST8-MRSA-IVa (USA300) isolates (3). The same ACME and SCCmec IVa genetic organization was also found among ACME-positive PVL locus-positive ST8-MRSA-IVa isolates recovered in Ireland between 2003 and 2005, suggesting that such isolates may be a more likely source of ACME in the PVL locus-positive ST22-MRSA-IVa isolate than the ST22-MRSA-IVh isolates with the novel ACME/SCCmec-CI first recognized in 2008. However, CoNS may also have been the source of ACME in the earlier isolate. More detailed studies of ACME and SCCmec in S. aureus and CoNS are required to clarify this.

In conclusion, the finding of ACME in two distinct strains of ST22-MRSA-IV and the significant differences in the genetic organization of ACME identified in both strains suggest that ACME has been acquired by ST22-MRSA-IV on at least two independent occasions and that this acquisition may have involved interspecies transfer of ACME between CoNS and S. aureus. This finding also suggests that ACME has the potential to spread widely not only among ST8-MRSA-IV and ST22-MRSA-IV isolates but also among other MRSA clones. To date, the horizontal transfer of ACME appears to be a relatively rare event, because although it is widespread among ST8-MRSA-IVa isolates, it has been identified only among a small number of isolates belonging to other MRSA clones (4, 5, 6, 7, 8), and only 10% of MRSA isolates in the present study were found to harbor ACME. While the reasons for this are still unclear, it may be that acquisition of a large mobile genetic element such as ACME, which has previously been reported to be >30 kb in size, can compromise the fitness of the host. However, the ACME identified in the ST22-MRSA-IVh isolates in the present study was the smallest ACME described to date (ca. 14 kb from DR-1 to DR-3) and therefore may be a more competitive mobile genetic element and may not adversely affect bacterial fitness. The presence of ACME may provide a selective advantage to ST22-MRSA-IV isolates and may therefore enhance further dissemination of this already successful MRSA clone. Confirmation of this suggestion requires ongoing surveillance of ST22-MRSA-IV and other MRSA strains to determine if ACME-positive ST22-MRSA-IV isolates become widespread and if this ACME successfully spreads among other MRSA strains. This study provides further evidence of the ongoing and rapid evolution of MRSA and of the importance of CoNS as a potential reservoir of virulence-associated and antimicrobial resistance genes in S. aureus.

ACKNOWLEDGMENTS

This work was supported by Irish Health Research Board grant TRA/2006/4 and by the Microbiology Research Unit, Dublin Dental University Hospital.

We thank Eilish Creamer and Orla Sherlock (RCSI, Dublin, Ireland) for sample collection and MRSA isolate recovery during 2007 and 2008. We also thank the staff of the Irish National MRSA Reference Laboratory for AR typing and PFGE of all isolates.

Footnotes

▿

Published ahead of print on 22 February 2011.

REFERENCES

  • 1. Barbier F., et al. 2010. High prevalence of the arginine catabolic mobile element in carriage isolates of methicillin-resistant Staphylococcus epidermidis. J. Antimicrob. Chemother. 66:29–36 [DOI] [PubMed] [Google Scholar]
  • 2. Carroll D., Kehoe M. A., Cavanagh D., Coleman D. C. 1995. Novel organization of the site-specific integration and excision recombination functions of the Staphylococcus aureus serotype F virulence-converting phages phi 13 and phi 42. Mol. Microbiol. 16:877–893 [DOI] [PubMed] [Google Scholar]
  • 3. Diep B. A., et al. 2006. Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus. Lancet 367:731–739 [DOI] [PubMed] [Google Scholar]
  • 4. Diep B. A., et al. 2008. The arginine catabolic mobile element and staphylococcal chromosomal cassette mec linkage: convergence of virulence and resistance in the USA300 clone of methicillin-resistant Staphylococcus aureus. J. Infect. Dis. 197:1523–1530 [DOI] [PubMed] [Google Scholar]
  • 5. Ellington M. J., Yearwood L., Ganner M., East C., Kearns A. M. 2008. Distribution of the ACME-arcA gene among methicillin-resistant Staphylococcus aureus from England and Wales. J. Antimicrob. Chemother. 61:73–77 [DOI] [PubMed] [Google Scholar]
  • 6. Ellis M. W., et al. 2009. Presence and molecular epidemiology of virulence factors in methicillin-resistant Staphylococcus aureus strains colonizing and infecting soldiers. J. Clin. Microbiol. 47:940–945 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Ghaznavi-Rad E., et al. 2010. Predominance and emergence of clones of hospital-acquired methicillin-resistant Staphylococcus aureus in Malaysia. J. Clin. Microbiol. 48:867–872 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Goering R. V., et al. 2007. Epidemiologic distribution of the arginine catabolic mobile element among selected methicillin-resistant and methicillin-susceptible Staphylococcus aureus isolates. J. Clin. Microbiol. 45:1981–1984 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. International Working Group on the Classification of Staphylococcal Cassette Chromosome Elements (IWG-SCC). 2009. Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrob. Agents Chemother. 53:4961–4967 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Mahillon J., Leonard C., Chandler M. 1999. IS elements as constituents of bacterial genomes. Res. Microbiol. 150:675–687 [DOI] [PubMed] [Google Scholar]
  • 11. Malachowa N., Deleo F. R. 2010. Mobile genetic elements of Staphylococcus aureus. Cell. Mol. Life Sci. 67:3057–3071 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Milheirico C., Oliveira D. C., de Lencastre H. 2007. Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: ‘SCCmec IV multiplex.’ J. Antimicrob. Chemother. 60:42–48 [DOI] [PubMed] [Google Scholar]
  • 13. Miragaia M., et al. 2009. Genetic diversity of arginine catabolic mobile element in Staphylococcus epidermidis. PLoS One 4:e7722. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Monecke S., Ehricht R. 2005. Rapid genotyping of methicillin-resistant Staphylococcus aureus (MRSA) isolates using miniaturised oligonucleotide arrays. Clin. Microbiol. Infect. 11:825–833 [DOI] [PubMed] [Google Scholar]
  • 15. Monecke S., Ehricht R., Slickers P., Tan H. L., Coombs G. 2009. The molecular epidemiology and evolution of the Panton-Valentine leukocidin-positive, methicillin-resistant Staphylococcus aureus strain USA300 in Western Australia. Clin. Microbiol. Infect. 15:770–776 [DOI] [PubMed] [Google Scholar]
  • 16. Monecke S., Jatzwauk L., Weber S., Slickers P., Ehricht R. 2008. DNA microarray-based genotyping of methicillin-resistant Staphylococcus aureus strains from Eastern Saxony. Clin. Microbiol. Infect. 14:534–545 [DOI] [PubMed] [Google Scholar]
  • 17. Monecke S., Slickers P., Ehricht R. 2008. Assignment of Staphylococcus aureus isolates to clonal complexes based on microarray analysis and pattern recognition. FEMS Immunol. Med. Microbiol. 53:237–251 [DOI] [PubMed] [Google Scholar]
  • 18. Mongkolrattanothai K., Boyle S., Murphy T. V., Daum R. S. 2004. Novel non-mecA-containing staphylococcal chromosomal cassette composite island containing pbp4 and tagF genes in a commensal staphylococcal species: a possible reservoir for antibiotic resistance islands in Staphylococcus aureus. Antimicrob. Agents Chemother. 48:1823–1836 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Montgomery C. P., Boyle-Vavra S., Daum R. S. 2009. The arginine catabolic mobile element is not associated with enhanced virulence in experimental invasive disease caused by the community-associated methicillin-resistant Staphylococcus aureus USA300 genetic background. Infect. Immun. 77:2650–2656 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Novick R. P., Subedi A. 2007. The SaPIs: mobile pathogenicity islands of Staphylococcus. Chem. Immunol. Allergy 93:42–57 [DOI] [PubMed] [Google Scholar]
  • 21. Pi B., Yu M., Chen Y., Yu Y., Li L. 2009. Distribution of the ACME-arcA gene among meticillin-resistant Staphylococcus haemolyticus and identification of a novel ccr allotype in ACME-arcA-positive isolates. J. Med. Microbiol. 58:731–736 [DOI] [PubMed] [Google Scholar]
  • 22. Rossney A. S., et al. 2007. The emergence and importation of diverse genotypes of methicillin-resistant Staphylococcus aureus (MRSA) harboring the Panton-Valentine leukocidin gene (pvl) reveal that pvl is a poor marker for community-acquired MRSA strains in Ireland. J. Clin. Microbiol. 45:2554–2563 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Rutherford K., et al. 2000. Artemis: sequence visualization and annotation. Bioinformatics 16:944–945 [DOI] [PubMed] [Google Scholar]
  • 24. Shore A., Rossney A. S., Keane C. T., Enright M. C., Coleman D. C. 2005. Seven novel variants of the staphylococcal chromosomal cassette mec in methicillin-resistant Staphylococcus aureus isolates from Ireland. Antimicrob. Agents Chemother. 49:2070–2083 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Shore A. C., et al. 2010. Identification and characterization of the multidrug resistance gene cfr in a Panton-Valentine leukocidin-positive sequence type 8 methicillin-resistant Staphylococcus aureus IVa (USA300) isolate. Antimicrob. Agents Chemother. 54:4978–4984 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Shore A. C., et al. 2010. Enhanced discrimination of highly clonal ST22-methicillin-resistant Staphylococcus aureus IV isolates achieved by combining spa, dru, and pulsed-field gel electrophoresis typing data. J. Clin. Microbiol. 48:1839–1852 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Shore A. C., et al. 2008. Detection of staphylococcal cassette chromosome mec-associated DNA segments in multiresistant methicillin-susceptible Staphylococcus aureus (MSSA) and identification of Staphylococcus epidermidis ccrAB4 in both methicillin-resistant S. aureus and MSSA. Antimicrob. Agents Chemother. 52:4407–4419 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Tenover F. C., Goering R. V. 2009. Methicillin-resistant Staphylococcus aureus strain USA300: origin and epidemiology. J. Antimicrob. Chemother. 64:441–446 [DOI] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES