Abstract
This study determined the antimicrobial susceptibilities of 186 clinical isolates of Nocardia spp. isolated in Gipuzkoa, northern Spain, between 1998 and 2009. Most isolates were recovered from respiratory samples, Nocardia nova, N. farcinica, N. cyriacigeorgica, N. abscessus, and N. carnea being the species most frequently isolated. Linezolid and amikacin were the only two antimicrobials to which all isolates were susceptible. The majority of N. flavorosea, N. carnea, and N. farcinica isolates were trimethoprim-sulfamethoxazole resistant.
TEXT
Nocardia species are ubiquitous in the environment and can be found worldwide as saprophytic components in water, soil, dust, decaying vegetation, and animal excrement. Only a small proportion of the currently described Nocardia species are known to be human pathogens, pulmonary nocardiosis being the most common manifestation of human disease (2). Prior to the introduction of sulfonamides in therapy, mortality from invasive Nocardia infections was close to 100%, but current cure rates range from 50% of brain abscess cases to 90% of pleuropulmonary disease and almost 100% of skin and soft tissue disease cases (11).
In this study, the in vitro activities of 20 antimicrobial agents against 186 clinical Nocardia isolates recovered from 178 patients between 1990 and 2009 in Gipuzkoa, northern Spain, were determined. Presumptive identification was performed according to the colony morphology on solid medium, Gram stain appearance, and positive modified acid-fast staining. Definitive species identification was performed by sequencing a fragment of the 16S rRNA gene using primers 5F (TGGAGAGTTTGATCCTGGCTCAG) and 1193R (ACGTCATCCCCGCCTTCCTC) and a finding of a sequence similarity of >99% with the sequence of a Nocardia type species. If similarities of >99% with more than one different Nocardia species were observed, species identification was done by sequencing a fragment of the hsp65 gene using the primers described by Telenti et al. (12, 13). The sequences obtained were compared with those available at GenBank using BLAST software (http://www.ncbi.nlm.nih.gov) and with those at the leBIBI database (Bio Informatic Bacteria Identification tool; htpp://pbil.univ-lyon1.fr/bibi).
Susceptibility testing was performed by the broth microdilution method using the CLSI criteria (9) with Sensititre microtiter trays (Sensititre; Trek Diagnostics Systems, West Sussex, England) specially designed for this study and cation-adjusted Mueller-Hinton broth using the concentration range shown in Table 1. MICs were recorded after 3 days of incubation or after 5 days for slow-growing species, such as some N. nova isolates. Because there are no CLSI interpretative criteria for Nocardia for some of the antimicrobials tested in this study, arbitrary breakpoints were used for tigecycline, moxifloxacin, clindamycin, vancomycin, and dalbavancin (Table 1). Nocardia ATCC 19247, N. farcinica ATCC 3318, Staphylococcus aureus ATCC 29213, and Escherichia coli ATCC 35218 were used as controls.
Table 1.
Broth microdilution breakpoints for Nocardia and other aerobic actinomycetes, according to the CLSI interpretive criteria (9), and concentration ranges of the antimicrobials studied
| Antimicrobial(s) | Broth microdilution breakpoint (μg/ml) |
Concentration range | ||
|---|---|---|---|---|
| Susceptible | Intermediate | Resistant | ||
| Ampicillin | ≤8 | 16 | ≥32 | 0.25–32 |
| Amoxicillin-clavulanic acid | ≤8/4 | 16/8 | ≥32/16 | 0.5/0.25–32/16 |
| Cefotaxime | ≤8 | 16–32 | ≥64 | 8–64 |
| Ceftriaxone | ≤8 | 16–32 | ≥64 | 8–64 |
| Cefepime | ≤8 | 16 | ≥32 | 8–64 |
| Imipenem | ≤4 | 8 | ≥16 | 2–16 |
| Gentamicin | ≤4 | 8 | ≥16 | 4–16 |
| Tobramycin | ≤4 | 8 | ≥16 | 2–16 |
| Amikacin | ≤8 | ≥16 | 8–64 | |
| Ciprofloxacin | ≤1 | 2 | ≥4 | 1–4 |
| Moxifloxacina | ≤1 | 2 | ≥4 | 1–4 |
| Clarithromycin | ≤2 | 4 | ≥8 | 1–8 |
| Clindamycina | ≤0.5 | 1–2 | ≥4 | 0.5–4 |
| Minocycline | ≤1 | 2–4 | ≥8 | 1–16 |
| Doxycycline | ≤1 | 2–4 | ≥8 | 1–16 |
| Tigecyclinea | ≤1 | 0.25–4 | ||
| Trimethoprim-sulfamethoxazole | ≤2/38 | ≥4/76 | 1/19–4/76 | |
| Linezolid | ≤8 | 0.5–8 | ||
| Vancomycina | ≤2 | 4–8 | ≥16 | 0.25–8 |
| Dalbavancina | ≤2 | 4–8 | ≥16 | 0.01–8 |
Breakpoints are arbitrary since there are currently no CLSI interpretive criteria.
Overall, 186 nonduplicated isolates were obtained from 178 different patients. Four patients had two isolates each that were of different species, and two patients had three isolates each that were of different species. Of the 186 isolates, 177 were recovered from respiratory samples. The remaining nine Nocardia isolates were obtained from three cutaneous abscesses (all N. farcinica), three blood cultures (two N. farcinica and one N. nova), two urine cultures (both N. nova), and one brain abscess (N. abscessus).
Fourteen different species were detected, the most prevalent being N. nova, followed by N. farcinica, N. cyriacigeorgica, N. abscessus, and N. carnea. These five species represented 86.6% of all isolates. The remaining species isolated were N. rhamnosiphila (5 isolates), N. flavorosea (4 isolates), N. veterana (4 isolates), N. takedensis (3 isolates), N. sienata (2 isolates), N. niigatensis (1 isolate), N. otitidiscaviarum (1 isolate), N. shimofusensis (1 isolate), N. alboflava (1 isolate), and Nocardia spp. (4 isolates).
It is generally accepted that the incidence of nocardial disease is increasing (7, 10). The development of microorganism identification based on molecular biology techniques has allowed a greater number of species within the Nocardia genus to be described (2). Until 1995, less than 15 species were known (1), but in the last 10 years, more than 50 new species have been described. The species found in our study were those that are the most prevalent in different parts of the world (2). Other species common in tropical countries (3, 8) were very infrequent in our temperate climate region. Thus, we only found one N. otitidiscaviarum and no N. brasiliensis isolates, species that are frequently found in other regions (15).
Currently, trimethoprim-sulfamethoxazole (SXT) remains the drug of choice in the treatment of nocardiosis, the most recent therapeutic alternative being linezolid (6, 11). In our study, all of the N. flavorosea isolates and about half of the N. carnea and N. farcinica isolates showed SXT resistance (Table 2). Cercenado et al. (3) and Torres et al. (14) found 18% and 53% SXT resistance in N. farcinica isolates, respectively.
Table 2.
MIC range, MIC50, and MIC90 of antimicrobials tested for the Nocardia species most frequently found in this study
| Antimicrobial(s)a | MIC for species (no. of isolates) |
||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
N. nova (55) |
N. farcinica (43) |
N. cyriacigeorgica (28) |
N. abscessus (23) |
N. carnea (12) |
Range |
||||||||||||||
| Range | MIC50 | MIC90 | Range | MIC50 | MIC90 | Range | MIC50 | MIC90 | Range | MIC50 | MIC90 | Range | MIC50 | MIC90 | N. ramnosiphila (5) | N. veterana (4) | N. flavorosea (4) | N. takedensis (3) | |
| AMP | ≤0.25–>32 | 8 | 16 | >32 | >32 | >32 | 16–>32 | >32 | >32 | 1–>32 | 8 | 16 | 2–8 | 2 | 8 | 1–2 | 4–8 | 2–8 | 1–2 |
| AMC | 1–>32 | >32 | >32 | 4–>32 | 8 | 16 | 16–>32 | 32 | >32 | 0.5–>32 | 1 | 4 | 8–>32 | 16 | >32 | 32–>32 | 4–>32 | 16–32 | 1–32 |
| CTX | ≤8–64 | ≤8 | 16 | 16–>64 | 64 | >64 | ≤8–32 | ≤8 | ≤8 | ≤8–16 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8–16 | ≤8 | ≤8 |
| CRO | ≤8–32 | ≤8 | 16 | 16–>64 | 64 | >64 | ≤8–32 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8–16 | ≤8 | ≤8 |
| FEP | ≤8–>64 | ≤8 | 16 | 16–>64 | 64 | >64 | ≤8–32 | ≤8 | 16 | ≤8 | ≤8 | ≤8 | ≤8–16 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 |
| IPM | ≤2–16 | ≤2 | 4 | ≤2–>16 | 4 | 16 | ≤2–8 | ≤2 | 8 | ≤2–>16 | 8 | >16 | ≤2–4 | ≤2 | 4 | ≤2–4 | ≤2–4 | ≤2–4 | ≤2 |
| GEN | ≤4–>16 | ≤4 | 8 | 16–>16 | >16 | >16 | ≤4 | ≤4 | ≤4 | ≤4 | ≤4 | ≤4 | ≤4 | ≤4 | ≤4 | 8–16 | ≤4–16 | ≤4 | ≤4 |
| TOB | ≤2–>16 | >16 | >16 | 16–>16 | >16 | >16 | ≤2 | ≤2 | ≤2 | ≤2 | ≤2 | ≤2 | ≤2 | ≤2 | ≤2 | ≤2 | ≤2–>16 | ≤2 | ≤2 |
| AMK | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 | ≤8 |
| CIP | 2–>4 | >4 | >4 | ≤1–>4 | >4 | >4 | 2–>4 | >4 | >4 | 4–>4 | >4 | >4 | ≤1 | ≤1 | ≤1 | ≤1 | >4 | ≤1 | 4–>4 |
| MXF | ≤1–>4 | 4 | >4 | ≤1–>4 | 2 | 4 | ≤1–>4 | >4 | >4 | 2–>4 | 4 | >4 | ≤1 | ≤1 | ≤1 | ≤1 | 2–4 | ≤1 | 1–4 |
| CLR | ≤1–>8 | ≤1 | ≤1 | 8–>8 | >8 | >8 | ≤1–>8 | >8 | >8 | ≤1–>8 | 8 | >8 | ≤1–>8 | >8 | >8 | ≤1–>8 | ≤1–>8 | 2–>8 | ≤1 |
| CLI | ≤0.5–>4 | 1 | 4 | >4 | >4 | >4 | ≤0.5–>4 | >4 | >4 | ≤0.5–>4 | >4 | >4 | >4 | >4 | >4 | 4–>4 | ≤0.5–>4 | >4 | ≤0.5–2 |
| MIN | ≤1–8 | 2 | 4 | ≤1–8 | 4 | 8 | ≤1–4 | 2 | 4 | ≤1–2 | ≤1 | 2 | ≤1–2 | 2 | 2 | ≤1–2 | ≤1–4 | ≤1–4 | ≤1 |
| DOX | ≤1–16 | 4 | 8 | ≤1–>16 | 4 | 8 | ≤1–8 | 4 | 4 | ≤1–4 | ≤1 | 2 | ≤1–4 | 2 | 2 | ≤1–4 | 4–8 | 2 | ≤1 |
| TGC | 0.5–>4 | 1 | 4 | ≤0.25–>4 | 2 | >4 | ≤0.25–4 | 0.5 | 1 | ≤0.25–2 | ≤0.25 | 1 | ≤0.25–1 | 0.5 | 0.5 | ≤0.25–0.5 | 1–4 | ≤0.25–0.5 | ≤0.25–1 |
| SXT | ≤1–2 | ≤1 | ≤1 | ≤1–>4 | 2 | 4 | ≤1–2 | ≤1 | 2 | ≤1–2 | ≤1 | ≤1 | ≤1–>4 | 4 | >4 | ≤1–2 | ≤1–4 | 4–>4 | ≤1 |
| LZD | ≤0.5–4 | 1 | 2 | 1–4 | 2 | 4 | ≤0.5–4 | 2 | 4 | ≤0.5–2 | 1 | 2 | ≤0.5–1 | 1 | 1 | ≤0.5–1 | 1 | ≤0.5–1 | ≤0.5–1 |
| VAN | 1–>8 | >8 | >8 | 4–>8 | >8 | >8 | 8–>8 | >8 | >8 | 8–>8 | >8 | >8 | 8–>8 | >8 | >8 | >8 | 8–>8 | >8 | 4–8 |
| DAL | 0.5–>8 | 8 | >8 | 2–>8 | 8 | >8 | 4–>8 | >8 | >8 | 2–>8 | >8 | >8 | 0.5–>8 | 8 | 8 | 8 | 2–>8 | 4–>8 | ≤0.25–1 |
AMK, amikacin; AMC, amoxicillin-clavulanic acid; AMP, ampicillin; FEP, cefepime; CTX, cefotaxime; CRO, ceftriaxone; CIP, ciprofloxacin; CLR, clarithromycin; CLI, clindamycin; DAL, dalbavancin; DOX, doxycycline; GEN, gentamicin; IPM, imipenem; LZD, linezolid; MIN, minocycline; MXF, moxifloxacin; TGC, tigecycline; TOB, tobramycin; SXT, trimethoprim-sulfamethoxazole; VAN, vancomycin.
Like those in other studies (3, 5), all of our isolates were linezolid and amikacin susceptible and most species were also imipenem susceptible, similar to the findings reported by Wallace et al. (16). However, only 72% of N. farcinica and 39% of N. abscessus isolates were imipenem susceptible. Our isolates showed various susceptibilities to other beta-lactam antibiotics (Table 3). Susceptibility to the different members of the tetracycline family was uneven, but only N. abscessus and N. takedensis showed high susceptibility. Because of the high proportion of resistance to fluoroquinolones, glycopeptides, vancomycin, and dalbavancin, together with the scarce experience of their use in the treatment of nocardiosis, these drugs will probably remain as alternatives when other antimicrobials cannot be used and their susceptibilities are known. Ciprofloxacin showed a species-specific susceptibility: all N. carnea isolates were susceptible, while only 18% of N. farcinica, 2% of N. nova, and none of the N. abscessus and N. cyriacigeorgica isolates were susceptible. Intrinsic activity was slightly higher for moxifloxacin than for ciprofloxacin.
Table 3.
Percentages of susceptible isolates of the different Nocardia species isolated in this study
| Antimicrobial(s)a | % of susceptible isolates of species (no. of isolates) |
||||||||
|---|---|---|---|---|---|---|---|---|---|
| N. nova (55) | N. farcinica (43) | N. cyriacigeorgica (28) | N. abscessus (23) | N. carnea (12) | N. rhamnosiphila (5) | N. veterana (4) | N. flavorosea (4) | N. takedensis (3) | |
| AMP | 80 | 0 | 0 | 78.3 | 100 | 100 | 100 | 100 | 100 |
| AMC | 7.3 | 81.4 | 0 | 91.3 | 25 | 0 | 75 | 0 | 66.7 |
| CTX | 81.8 | 0 | 92.9 | 95.7 | 100 | 100 | 75 | 100 | 100 |
| CRO | 74.5 | 0 | 92.9 | 100 | 100 | 100 | 75 | 100 | 100 |
| FEP | 83.6 | 0 | 78.6 | 100 | 91.7 | 100 | 100 | 100 | 100 |
| IPM | 98.2 | 72.1 | 89.3 | 39.1 | 100 | 100 | 100 | 100 | 100 |
| GEN | 60 | 0 | 100 | 100 | 100 | 0 | 75 | 100 | 100 |
| TOB | 10.9 | 0 | 100 | 100 | 100 | 100 | 50 | 100 | 100 |
| AMK | 100 | 107 | 100 | 100 | 100 | 100 | 100 | 100 | 100 |
| CIP | 0 | 18.6 | 0 | 0 | 100 | 100 | 0 | 100 | 0 |
| MXF | 1.8 | 25.6 | 3.6 | 0 | 100 | 100 | 0 | 100 | 33.3 |
| CLR | 96.4 | 0 | 10.7 | 21.7 | 33.3 | 40 | 50 | 50 | 100 |
| CLI | 30.9 | 0 | 3.6 | 4.3 | 0 | 0 | 25 | 0 | 66.7 |
| MIN | 16.4 | 9.3 | 14.3 | 87 | 50 | 60 | 25 | 25 | 100 |
| DOX | 7.3 | 7.0 | 14.3 | 82.6 | 33.3 | 40 | 0 | 0 | 100 |
| TGC | 58.2 | 23.3 | 92.9 | 95.7 | 100 | 100 | 25 | 100 | 100 |
| SXT | 100 | 58.1 | 100 | 100 | 41.7 | 100 | 75 | 0 | 100 |
| LZD | 100 | 100 | 100 | 100 | 100 | 100 | 100 | 100 | 100 |
| VAN | 5.5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| DAL | 25.5 | 2.3 | 0 | 4.3 | 16.7 | 0 | 25 | 0 | 100 |
AMK, amikacin; AMC, amoxicillin-clavulanic acid; AMP, ampicillin; FEP, cefepime; CTX, cefotaxime; CRO, ceftriaxone; CIP, ciprofloxacin; CLR, clarithromycin; CLI, clindamycin; DAL, dalbavancin; DOX, doxycycline; GEN, gentamicin; IPM, imipenem; LZD, linezolid; MIN, minocycline; MXF, moxifloxacin; TGC, tigecycline; TOB, tobramycin; SXT, trimethoprim-sulfamethoxazole; VAN, vancomycin.
Susceptibility patterns per se are not indicative of a particular species, but if associated with other phenotypic characteristics, they can suggest classification within a Nocardia species or group (Table 4). Amoxicillin susceptibility together with amoxicillin-clavulanate resistance in slow-growing isolates suggests their membership in the N. nova complex (2, 5, 17), although in our study, this susceptibility pattern was also characteristic of N. carnea. Rapid growth in a multiresistant strain, including cefotaxime resistance, suggests the presence of N. farcinica, of which all isolates were also clarithromycin resistant. Species of the Nocardia transvalensis complex (none in this series) have intrinsic amikacin resistance (2–4).
Table 4.
Antimicrobial susceptibility patterns of the most frequently isolated species in this study compared with the patterns reported by Brown-Elliot et al. (2)
| Species | Pattern | Resistant |
Susceptible |
||
|---|---|---|---|---|---|
| Brown-Elliot antibiotypea | This study (%) | Brown-Elliot antibiotypea | This study (%) | ||
| N. nova | III | AMC | 89.1 (92.7)b | AMP | 80 |
| AMK | 100 | ||||
| CLR | 96.4 | ||||
| CRO | 74.5 | ||||
| IPM | 98.2 | ||||
| LZD | 100 | ||||
| N. farcinica | V | AMP | 100 | AMK | 100 |
| CLR | 100 | CIP | 18.6 | ||
| CRO | 51.2 (100) | IPM | 72.1 | ||
| GEN | 100 | LZD | 100 | ||
| TOB | 100 | ||||
| N. abscessus | I | CIP | 100 | AMP | 78.3 |
| CLR | 69.6 (78.3) | AMC | 91.3 | ||
| IPM | 39.1 (60.9) | AMK | 100 | ||
| CRO | 100 | ||||
| LZD | 100 | ||||
| N. cyriacigeorgica | VI | AMP | 96.4 (100) | AMK | 100 |
| AMC | 78.6 (100) | CRO | 92.9 | ||
| CIP | 96.4 (100) | IPM | 89.3 | ||
| CLR | 82.1 (89.3) | LZD | 100 | ||
AMK, amikacin; AMC, amoxicillin-clavulanic acid; AMP, ampicillin; CRO, ceftriaxone; CIP, ciprofloxacin; CLR, clarithromycin; GEN, gentamicin; IPM, imipenem; LZD, linezolid; TOB, tobramycin.
Values in parentheses indicate the percentage of isolates with resistant and intermediate susceptibilities.
Nocardia is an opportunistic pathogen that can cause serious infections, especially in immunocompromised patients. To our knowledge, this is the largest study of Nocardia susceptibility performed in the era of molecular identification of isolates, and the aim is to reduce the lack of information on antimicrobial activities in specific species of Nocardia clinical isolates.
Acknowledgments
This work was supported in part by a grant from Pfizer and by grant GIU09-59 from the University of the Basque Country, UPV/EHU, Spain.
Footnotes
Published ahead of print on 14 March 2011.
REFERENCES
- 1. Beaman B. L., Saubolle M. A., Wallace R. J. 1995. Nocardia, Rhodococcus, Streptomyces, Oerskovia, and other aerobic actinomycetes of medical importance, p. 379–399 In Murray P. R., Baron E. J., Pfaller M. A., Tenover F. C., Yolken R. H. (ed.), Manual of Clinical Microbiology, 6th ed American Society for Microbiology, Washington, DC [Google Scholar]
- 2. Brown-Elliott B. A., Brown J. M., Conville P. S., Wallace R. J., Jr 2006. Clinical and laboratory features of the Nocardia spp. based on current molecular taxonomy. Clin. Microbiol. Rev. 19:259–282 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Cercenado E., et al. 2007. In vitro activities of tigecycline and eight other antimicrobials against different Nocardia species identified by molecular methods. Antimicrob. Agents Chemother. 51:1102–1104 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Conville P. S., Brown J. M., Steigerwalt A. G., Brown-Elliott B. A., Witebsky F. G. 2008. Nocardia wallacei sp. nov. and Nocardia blacklockiae sp. nov., human pathogens and members of the “Nocardia transvalensis complex.” J. Clin. Microbiol. 46:1178–1184 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Glupczynski Y., Berhin C., Janssens M., Wauters G. 2006. Determination of antimicrobial susceptibility patterns of Nocardia spp. from clinical specimens by Etest. Clin. Microbiol. Infect. 12:905–912 [DOI] [PubMed] [Google Scholar]
- 6. Lai C. C., et al. 2009. Comparative in vitro activities of nemonoxacin, doripenem, tigecycline and 16 other antimicrobials against Nocardia brasiliensis, Nocardia asteroides and unusual Nocardia species. J. Antimicrob. Chemother. 64:73–78 [DOI] [PubMed] [Google Scholar]
- 7. Martínez R., Reyes S., Menéndez R. 2008. Pulmonary nocardiosis: risk factors, clinical features, diagnosis and prognosis. Curr. Opin. Pulm. Med. 14:219–227 [DOI] [PubMed] [Google Scholar]
- 8. Muñoz J., et al. 2007. Clinical and microbiological features of nocardiosis 1997-2003. J. Med. Microbiol. 56:545–550 [DOI] [PubMed] [Google Scholar]
- 9. National Committee for Clinical Laboratory Standards 2003. Susceptibility testing of mycobacteria, nocardiae, and other aerobic actinomycetes. Approved standard M24-A. National Committee for Clinical Laboratory Standards, Wayne, PA: [PubMed] [Google Scholar]
- 10. Saubolle M. A., Sussland D. 2003. Nocardiosis: review and laboratory experience. J. Clin. Microbiol. 41:4497–4501 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Sorrell T. C., Mitchell D. H., Iredell J. R. 2005. Nocardia species, p. 2916–2924 In Bennett J. E., Mandell G. L, Dolin R. (ed.), Mandell, Douglas, and Bennett's principles and practice of infectious diseases, 6th ed Elsevier, Philadelphia, PA [Google Scholar]
- 12. Steingrube V. A., et al. 1997. Rapid identification of clinically significant species and taxa of aerobic actinomycetes, including Actinomadura, Gordona, Nocardia, Rhodococcus, Streptomyces, and Tsukamurella isolates, by DNA amplification and restriction endonuclease analysis. J. Clin. Microbiol. 35:817–822 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Telenti A., et al. 1993. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J. Clin. Microbiol. 31:175–178 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Torres O. H., et al. 2000. Infection caused by Nocardia farcinica: case report and review. Eur. J. Clin. Microbiol. Infect. Dis. 19:205–212 [DOI] [PubMed] [Google Scholar]
- 15. Vera-Cabrera L., et al. 2010. In vitro activity of ACH-702, a new isothiazoloquinolone, against Nocardia brasiliensis compared with econazole and the carbapenems imipenem and meropenem alone or in combination with clavulanic acid. Antimicrob. Agents Chemother. 54:2191–2193 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Wallace R. J., Jr., Steele L. C., Sumter G., Smith J. M. 1988. Antimicrobial susceptibility patterns of Nocardia asteroides. Antimicrob. Agents Chemother. 32:1776–1779 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Wallace R. J., Jr., Brown B. A., Tsukamura M., Brown J. M., Onyi G. O. 1991. Clinical and laboratory features of Nocardia nova. J. Clin. Microbiol. 29:2407–2411 [DOI] [PMC free article] [PubMed] [Google Scholar]