Functional Apical Large Conductance, Ca²⁺-activated, and Voltage-dependent K⁺ Channels Are Required for Maintenance of Airway Surface Liquid Volume

Abstract

Large conductance, Ca²⁺-activated, and voltage-dependent K⁺ (BK) channels control a variety of physiological processes in nervous, muscular, and renal epithelial tissues. In bronchial airway epithelia, extracellular ATP-mediated, apical increases in intracellular Ca²⁺ are important signals for ion movement through the apical membrane and regulation of water secretion. Although other, mainly basolaterally expressed K⁺ channels are recognized as modulators of ion transport in airway epithelial cells, the role of BK in this process, especially as a regulator of airway surface liquid volume, has not been examined. Using patch clamp and Ussing chamber approaches, this study reveals that BK channels are present and functional at the apical membrane of airway epithelial cells. BK channels open in response to ATP stimulation at the apical membrane and allow K⁺ flux to the airway surface liquid, whereas no functional BK channels were found basolaterally. Ion transport modeling supports the notion that apically expressed BK channels are part of an apical loop current, favoring apical Cl⁻ efflux. Importantly, apical BK channels were found to be critical for the maintenance of adequate airway surface liquid volume because continuous inhibition of BK channels or knockdown of KCNMA1, the gene coding for the BK α subunit (KCNMA1), lead to airway surface dehydration and thus periciliary fluid height collapse revealed by low ciliary beat frequency that could be fully rescued by addition of apical fluid. Thus, apical BK channels play an important, previously unrecognized role in maintaining adequate airway surface hydration.

Introduction

Large conductance, voltage- and Ca²⁺-activated K⁺ (BK)³ channels control a variety of physiological processes in different tissues. The BK pore-forming structure is a homotetramer of the α subunit (KCNMA1, Slo1, KCa1.1), which is encoded by a single gene (Slo1 gene, named KCNMA1). Four β regulatory subunits (KCNMβ1–4), encoded by the genes KCNMB1–B4, modulate the kinetics and the calcium and voltage dependence of BK channels, thereby contributing to the functional versatility of BK in different tissues (1–6).

Ion transport plays an important role in maintaining adequate water supply for the apical airway surface, which is critical for mucus hydration and ciliary beating because the periciliary fluid level has to be maintained for cilia to be effective. Both mucus hydration and ciliary beating are critical components of mucociliary function. The importance of ion transport for adequate airway surface liquid (ASL) volume is illustrated by multiple airway diseases where decreased Cl⁻ secretion and increased Na⁺ absorption cause airway surface dehydration and thereby mucociliary dysfunction. A prime example is cystic fibrosis, a disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (7, 8). However, other channels contribute directly to or maintain the electrochemical gradient necessary for apical Cl⁻ secretion. For example, calcium-activated chloride channels, recently identified as TMEM16 (9–11), secrete Cl⁻ and are important for airway hydration (12). In addition, basolateral K⁺ channels contribute to apical Cl⁻ transport by maintaining the electrochemical gradient required for Cl⁻ movement (13–17). Mall et al. (17) found that UTP-induced Cl⁻ currents in human nasal tissue were dependent on both clotrimazole-sensitive, calcium-activated K⁺ channels (SK4, KCa3.1, gene KCNN4) and clofilium-sensitive voltage-activated K⁺ channels (hKvLQT1, gene KCNQ1). Bernard et al. (18) also found that SK4 channels contribute to calcium-dependent chloride secretion in the human bronchial cell line 16HBE14o-.

Physiological ATP release onto apical surfaces of airway epithelial cells plays an important role in regulating water balance (19–21) and thereby mucociliary transport (22). Apical ATP is well known to increase [Ca²⁺]_i via P₂Y₂ receptors. Because BK channels are sensitive to intracellular Ca²⁺, we hypothesized that these channels may be involved in ion transport responses to apically released ATP in human bronchial epithelia, which would make these channels important for the regulation of ASL volume in normal human bronchial epithelial (NHBE) cells.

Using electrophysiological techniques (patch clamp and Ussing chamber) and RNA level modifications, we identified functional BK channels at the apical but not basolateral membrane of fully differentiated NHBE cells. These apical BK channels play a key role in ion transport in response to apically released ATP as loss of their activity results in airway surface dehydration. Thus, apical BK channels physiologically modulate ASL volume, which is critical for mucus hydration and ciliary beating.

EXPERIMENTAL PROCEDURES

Chemicals and Solutions

All media and Hank's balanced salt solution were purchased from Invitrogen. Unless stated otherwise, all other materials were obtained from Sigma Aldrich.

Air-liquid Interface (ALI) Cell Culture

Normal human airways were obtained from organ donors whose lungs were rejected for transplant. Institutional Review Board-approved consent for research with these tissues was obtained by the Life Alliance Organ Recovery Agency of the University of Miami and conformed to the declaration of Helsinki. Airway epithelial cells were isolated and used for experiments or dedifferentiated through expansion. Passage 1 cells were redifferentiated at an air-liquid interface (ALI) on collagen-coated 24-mm T-clear or 12 mm Snapwell filters (Costar Corning) for ∼3–4 weeks (at which time cultures were ciliated and secreted mucus) as described previously (23–26). All experiments were repeated ≥3 times from at least two different lungs.

RNA Expression

Total RNA was extracted using an RNeasy Plus Mini Kit (Qiagen, Valencia, CA) and reverse-transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad) according to the manufacturer's instructions. Quantitative PCR (qPCR) was performed using a TaqMan Universal PCR Master Mix (Applied Biosystems) with the TaqMan Gene Expression Assays (Applied Biosystems) described in Table 1 according to the manufacturer's instructions. Thermal cycling was carried out using an ICycler IQ apparatus (Bio-Rad). Each sample was analyzed in triplicate. The difference in the threshold cycle between the targeted gene and the housekeeping gene GAPDH (ΔCt) was used as an estimation of the relative level of expression. qPCR was also used to calculate relative gene expression after knockdown experiments (see below).

TABLE 1.

Taqman assay for qPCR of BK α and β subunits

Assay ID	mRNA	Gene	Gene name (alias)
Hs00266938_m1	NM_001014797, NM_002247, NM_001161352.1, NM_001161353.1	KCNMA1	Potassium large conductance calcium-activated channel, subfamily M, α member 1 (MaxiK, BKCa, KCa1.1)
Hs00188073_m1	NM_004137.2	KCNMB1	Potassium large conductance calcium-activated channel, subfamily M ß member 1
Hs00175772_m1	NM_181361.1, NM_005832.3	KCNMB2	Potassium large conductance calcium-activated channel, subfamily M β member 2
Hs00205246_m1	NM_171828.1, NM_171829.1, NM_171830.1, NM_014407.3	KCNMB3	Potassium large conductance calcium-activated channel, subfamily M β member 3
Hs00205704_m1	NM_014505.4	KCNMB4	Potassium large conductance calcium-activated channel, subfamily M, β member 4
Hs99999905_m1	NM_002046.3	GAPDH	Glyceraldehyde-3-phosphate dehydrogenase (G3PD, GAPD)

Western Blot

ALI cultured cells were solubilized in SDS, and proteins were separated by PAGE and blotted onto Immobilon-P membranes (Millipore, Billerica, MA). For detection of the BK α subunit, a primary rabbit anti-human BK (α subunit) antibody (Sigma-Aldrich catalog no. P4872) was used, and a secondary horseradish peroxidase (HRP)-conjugated anti-rabbit IgG was used for chemiluminescence. To normalize for protein loading, membranes were reprobed with rabbit anti-β-actin (1:100) (Sigma-Aldrich). Band intensities were quantified in the linear range using a Bio-Rad Chemidoc XRS.

Single Channel Current Experiments

Freshly isolated cells or fully differentiated NHBE cells after trypsinization were plated on collagen-coated 35-mm Petri dishes in ALI medium and kept from 20 to 24 h for recovery. Patch pipettes of 0.2 μm in diameter were pulled from melting point tubes (product no. 9530-1; Corning Glass Works) and had a resistance between 10–15 mΩ. No series resistance compensation was used, but the error due to uncompensated series resistance was never >5 mV. Single-channel K⁺ currents were recorded from excised patches of membranes from ciliated cells (inside-out or outside-out) with the pipette and bath solutions both containing 150 mm KCl, 20 mm sucrose, 10–100 μm CaCl₂, 10 mm N-tris-(hydroxymethyl) methyl-2-amino-ethane-sulfonic acid (TES), adjusted to pH 7.0. Experiments were performed at room temperature (21–23 °C), and data were collected with an Axopatch 200B amplifier (Molecular Devices, Sunnyvale, CA), filtered with a low-pass Bessel filter at 5 kHz, and sampled at 200 kHz with a Digidata 1322A, driving a 16-bit analog interface. The acquisition and basic analysis of the data were performed with pClamp software (version 9.2; Axon Instruments, Inc.).

Macroscopic Current Experiments

Intact, fully differentiated NHBE cells cultured at the ALI were recorded for macroscopic currents in cell-attached, outside-out, and excised inside-out patches, using the same glass patch pipettes with diameter 1–3 μm and 1–3 mΩ resistance. Intracellular solutions contained the following: 110 mm potassium methanesulphonate, 10 mm HEPES, 2 mm CaCl₂, pH 7.2. Extracellular solution contained ND-96: 96 mm NaCl, 2 mm KCl, 1 mm MgCl₂, 1.8 mm CaCl₂, 500 mg/ml gentamycin, 5 mm HEPES, pH 7.2. For macroscopic current relaxation experiments, the membrane was held at −60 mV. Each experiment consisted of a time at the holding potential, followed by a depolarization to test voltages between −60 mV to 100 mV, in 20-mV increments, separated by 10 s. The tail currents were at −60 mV. The analog signal was filtered before digitization with an eight-pole low-pass Bessel filter with a cutoff frequency of 1/5 of the conversion frequency.

Ussing Chamber Experiments

Fully differentiated NHBE cells grown on Snapwell filters (1.13 cm²) were mounted in Ussing chambers (EasyMount Chamber) connected to a VCC MC6 voltage clamp unit (both from Physiologic Instruments, San Diego, CA). Solutions were maintained at 37 °C by heated water jackets. To monitor short circuit current (I_sc), transepithelial membrane potential was clamped to 0 mV. Only cultures with >200 Ω cm⁻² were used for the experiments. Signals were digitized and recorded with DAQplot software (VVI Software, College Station, PA) via a LabJack A/D converter (LabJack Corp., Lakewood, CO). All experiments were conducted with culture and date matched filters.

Apical K⁺ currents were measured 30 min after permeabilization according a protocol published by Namkung et al. (27) (20 μm amphotericin B, 10 μm valinomycin, 10 μm nigericin), in the presence of apical 10 μm amiloride. A K⁺ gradient was created with one solution containing 145 mm K⁺ gluconate, 1 mm MgSO₄, 1 mm Ca²⁺ gluconate, 10 mm glucose, 10 mm HEPES, pH 7.4, and a another solution in which 140 mm K⁺ gluconate was replaced by Na⁺ gluconate. Resistance measurements showed complete permeabilization of the basolateral membrane within 30 min of addition of amphotericin B, valinomycin, and nigericin, indicated by a decrease of 16 ± 3% in total resistance (n = 8), which is within a reasonable range of the theoretical drop of 17% in total resistance when fully permeabilizing the basolateral membrane calculated from the measured apical and basolateral membrane (in series) as well as paracellular resistances (in parallel) reported by Willumsen et al. (28).

KCNMA1 Knockdown

Lentiviral pLKO plasmids were used as described (24, 29). From 14 to 21 days at the ALI, when beating cilia became apparent, KCNMA1 knockdown cells and nontargeting lentivirus infected cells (Table 2) were used for qPCR, Western blots, Ussing chamber experiments, and ciliary beat measurements (CBF).

TABLE 2.

Hairpin sequences used to knockdown KCNMA1 in NHBE cells

Mature sense and antisense sequences are in boldface letters. TRC, The RNAi Consortium Library Database.

TRC no.	Targeted RNA	Hairpin sequence
SHC002	MISSION nontarget shRNA Control Vector	CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTT
TRCN0000000212	NM_001014797 NM_002247	CCGGGTCAAGATAGAGTCAGCAGATCTCGAGATCTGCTGACTCTATCTTGACTTTTT

Computer Simulations

Computer simulations were done using the model of Cook and Young (30) with modifications and in-house software. The model contains the following assumptions (30): (a) the secreted fluid was assumed to be isotonic, i.e. [Cl]_l = [Na]_l + [K]_l = [Na]_i + [K]_i = [Cl]_I where l is luminal and i is interstitial; (b) the cytosolic composition was assumed to not vary with the secretory rate; (c) the ion transport across the epithelia was assumed to be at steady state; (d) the net ion fluxes into the luminal compartment determine the composition of the luminal fluid, i.e. [Na]_l = [Cl]_i (I_i^Na + I_a^Na)/I_a^Cl; (e) the pump current (I_p) is one sixth of the apical Cl⁻ current; and (f) the resistances of the tight junctions are inversely proportional to the mean of the concentrations of Na⁺ (or K⁺) in the luminal and interstitial solutions, e.g. R_j^Na = (2 × 155) p_j^Na/([Na]_i + [Na]_l). The parameters used in the simulations are shown in Table 3.

TABLE 3.

Parameters used in the computer simulations

Parameters as in Cook and Young (30) based on values from dog tracheal mucosa (62, 63). R_a^K(min) is the apical K⁺ resistance at the maximum apical K⁺ conductance used in the simulations (Fig. 5). We used two different values for the junctional resistance: 300 or 600 Ω cm², which are close to the estimated paracellular resistance of 412 Ω cm² in normal nasal epithelia (28). R_a^Na was chosen to yield an amiloride-sensitive I_sc that was 35% of the total I_sc, as found experimentally with our cells (data not shown).

piNa	300 or 600 Ω cm2
piK	300 or 600 Ω cm2
RaCl	274 Ω cm2
1/(1/RblK + 1/RaK(min))	154 Ω cm2
RaNa	8000 Ω cm2
[Cl]i	160 mmol/liter
[Na]i	155 mmol/liter
[K]i	5 mmol/liter
[Cl]c	54 mmol/liter
[K]c	155 mmol/liter
[Na]c	5 mmol/liter

[Ca²⁺]_i Estimates in NHBE Cells

NHBE cells were loaded with 5 μm fura-2/AM. Ratiometric fura-2 fluorescence in single cells was measured as described (31).

Measurement of CBF as a Surrogate for ASL Volume

Adequate ASL volume maintains an appropriate periciliary fluid height that allows normal ciliary activity. Thus, conditions that are associated with a CBF reduction that is fully rescued upon fluid addition to the apical compartment indicate ASL volume depletion. For these experiments, regular washing of the apical surface with Dulbecco's PBS was not performed for 3–4 days. Cells were imaged on a Zeiss Axiovert 200, equipped with phase contrast optics. CBF was measured as described (32). All the measurements were done within a 0.5-cm radius from the center of each 24-mm filter (no influence of possible water menisci at the edges of the cultures).

Statistics

Results were analyzed by a Student's t test for comparing two groups. One-way analysis of variance followed by a Tukey honestly significant difference test for mean comparison was used for more than two groups. p < 0.05 was accepted as significant. Other statistics are indicated in the figures. Data are presented as mean ± S.E.

RESULTS

BK Channels Are Expressed in Freshly Isolated and ALI-cultured NHBE Cells

qPCR using RNA isolated from freshly isolated airway epithelial cells and NHBE cells redifferentiated at the ALI revealed mRNA expression of the α subunit and the β2 and β4 regulatory subunits, whereas the β3 subunit expression was low, and the β1 mRNA expression was low to undetectable (Fig. 1A). Both β2 (1, 33, 34) and three of the four splice variants of the β3 subunit (1, 33–36) inactivate BK channel currents. The β4 subunit changes the kinetics of the channel (1) and its calcium dependence (37). Therefore, the kinetics of BK activity is probably modulated by the presence of several regulatory subunits in NHBE cells. By Western blot, an immunoreactive band of the predicted size for KCNMA1 at ∼110 kDa was detected at approximately the same amount in both NHBE cells cultured at the ALI and in freshly isolated cells (Fig. 1B).

FIGURE 1.

BK channels are expressed in freshly isolated airway epithelial cells and NHBE cells redifferentiated at the ALI. A, qPCR analysis of the expression of KCNMA1 (mRNA) and KCNMB1–4 (mRNA) in freshly isolated airway epithelial cells (black bars) and NHBE cells fully redifferentiated at the ALI (gray bars). Values shown are mean ± S.E. of relative expression levels compared with GAPDH (mRNA) (each n shows the number of qPCRs from >3 different lungs, indicated in parentheses above the corresponding bar). B, Western blot for BK α subunit. Lysates from fully differentiated NHBE cells (20 μg total protein in each lane) were electrophoresed, transferred, and probed with a polyclonal antibody to the α subunit of the BK channel (Sigma-Aldrich, P4872). Freshly isolated cells express similar amounts of the BK α subunit protein when loading was normalized with β-actin.

BK Channels Are Functional at Apical Membrane

To prove that BK channels were functional in our cells, single channel currents were measured in inside-out patches of trypsinized NHBE cells (Fig. 2A). At 0 mV, currents were close to 0, suggesting that the reversal potential matched the expected potential for K⁺ currents in symmetrical K⁺ solutions. When screened from −70 to +70 mV, all currents were found to have a single conductance of ∼290 picosiemens. The voltage dependence of the currents and, in particular, their high conductance was in agreement with the properties expected for BK channels. We also recorded similar, BK channel-like currents from freshly isolated airway epithelial cells (see Fig. 3 below).

FIGURE 2.

BK channels are functional in NHBE cells cultured at the ALI. A, family of single channel BK currents. The traces were elicited at −70, −50, −30, 0, and +70 mV in trypsinized NHBE cells using the inside-out patch configuration. The Ca²⁺ concentration in both the pipette and bath was 100 μm. The single conductance calculated was ∼290 picosiemens. Note that the open probability increases at more positive voltages. C, closed; O, open. B, functional K⁺ channels in intact (nontrypsinized) NHBE cells cultured at the ALI. Representative macroscopic currents are shown, which were measured in the cell-attached patch configuration. The holding potential was −60 mV (i.e. V_pipette = +60 mV), and the membrane was pulsed to voltages between −60 to +100 mV, in increments of −20 mV following a step to −60 mV. C, voltage-dependent activation curve obtained from macroscopic currents. Each point is an average of three to four patches obtained from the apical side of intact NHBE cells. The curve was fit to a simple Boltzmann equation, with a V½ = 74 mV. D, effect of iberiotoxin (Iber; 500 nm) on currents in response to a step to +40 mV from an outside-out macropatch obtained from the apical surface of an intact, fully differentiated ALI culture of NHBE cells. E, effect of 40 nm paxilline (pax) on currents in response to a step to +40 mV from a cell-attached macropatch obtained from the apical surface of an intact, fully differentiated ALI culture of NHBE cells.

FIGURE 3.

BK channels are functional in freshly isolated airway epithelial cells. A, family of single channel BK currents from a freshly isolated ciliated cell (not redifferentiated). The traces were elicited at −80, −40, 0, +40, and +80 mV using the inside-out patch configuration with a Ca²⁺ concentration in both pipette and bath of 100 μm. At high positive voltage, there are several channels present in the patch. The single conductance calculated at 275 picosiemens. B, family of single channel BK currents from a freshly isolated ciliated cell (not redifferentiated) in the outside out configuration before (left) and after paxilline treatment (50 μm; right) in the presence of a Ca²⁺ concentration in both pipette and bath of 10 μm. Note that paxilline almost completely eliminates channel openings and that the channels are sensitive to Ca²⁺ (at lower Ca²⁺ concentrations here than in A, more voltage is needed to open the channel). C, closed; O, open.

To eliminate potential artifacts derived from trypsinization, we performed patch clamp recordings of macroscopic currents of intact, i.e. not permeabilized, but fully differentiated NHBE cells grown at the ALI. Recordings in the cell-attached configuration show voltage-dependent currents (Fig. 2B) with a V½ consistent with expected values for BK channels (e.g. Refs. 38 and 39) for resting low intracellular Ca²⁺ levels under these conditions (Fig. 2C).

To test whether this current was due to BK channels, the effect of BK blockers was examined. Iberiotoxin (500 nm) reduced the total currents by 50% at 1.4 s (Fig. 2D) when applied in the outside-out patch configuration. Paxilline (40 nm), an indole diterpene, cell-permeable BK blocker (40), applied apically in the cell-attached configuration elicited a current reduction of ∼40% at 1.4 s (Fig. 2E), suggesting apical expression of functional BK channels. BK currents with similar properties were also recorded from freshly isolated ciliated cells with characteristics similar to the cells redifferentiated at the ALI (Fig. 3, A and B).

These experiments constitute the first evidence of BK channel activity in freshly isolated ciliated and fully redifferentiated, polarized human airway epithelia with tight junctions intact. Thus, we explored next whether only apical or also basolateral BK activity can be identified.

ATP Activates Apical BK Channels in NHBE Cells, whereas No BK-dependent Current Can Be Recorded Basolaterally

Apical ATP and UTP are well known to increase [Ca²⁺]_i via P₂Y₂ receptors, an important physiological signal for airway epithelial homeostasis. To show that apical ATP elicits a transient [Ca²⁺]_i increase in these NHBE cells, fura-2 fluorescence was recorded from single cells upon 10 μm ATP exposure. A typical, transient [Ca²⁺]_i increase is shown in Fig. 4A. To test for Ca²⁺-stimulated, apical, and BK channel-dependent K⁺ currents, fully differentiated, basolaterally permeabilized NHBE cells were mounted in Ussing chambers for I_sc measurements (V_c = 0 mV) using a basolateral to apical K⁺ gradient to assess apical K⁺ efflux (Fig. 4, B–E). In basolaterally permeabilized ALI cells, both 10 μm ATP and UTP induced a strong change in I_sc, consistent with apical K⁺ efflux (Fig. 4B). On the other hand, forskolin, a direct activator of transmembrane adenylyl cyclases to increase cyclic AMP, did not change I_sc significantly (Fig. 4B). This differential effect of nucleotides and forskolin on I_sc suggests that the I_sc changes could be linked to the opening of Ca²⁺-dependent K⁺ channels, possibly BK channels, and not channels known to be activated by forskolin such as KCNQ1 (27). Indeed, the ATP-stimulated I_sc increase was blocked by apical application of paxilline in a dose-dependent manner, with 36.5 nm paxilline causing half-maximal inhibition (Fig. 4, C and D). These values compare well with the half maximal inhibition concentration of paxilline found in macroscopic currents during patch clamp experiments (40 nm; Fig. 2E). In fact, 5 μm paxilline completely inhibited the ATP-induced increases in I_sc (Fig. 4C). Apical application of 5 μm paxilline did not affect baseline currents in these basolaterally permeabilized NHBE cells, which is in agreement with patch clamp experiments showing I/I_max close to 0 (due to low basal cytosolic Ca²⁺ concentrations) at 0 mV in intact cultures. In addition, 500 nm iberiotoxin applied apically 30 min before measurements blocked ∼80% of the I_sc response to 10 μm ATP (Fig. 4E).

FIGURE 4.

Nucleotide-stimulated BK channel activity can be recorded apically but not basolaterally in fully differentiated ALI cultures of NHBE cells. A, recording of fura-2 fluorescence from a single cell. As expected, 10 μm ATP transiently increases [Ca²⁺]_i (31). The duration of ATP exposure in this example is 2 min; however, longer exposures result in similar traces (see Fig. 2 in Ref. 31). B–E, Ussing chamber experiments in basolaterally permeabilized cells exposed to a basolateral to apical K⁺ gradient in the presence of 10 μm amiloride (to block Na⁺ current in the apical membrane). All compounds were added apically. B, a representative experiment (main panel) and quantification of the responses (inset) of outward short circuit currents (I_sc) in response to 4 min of 10 μm ATP, 10 μm UTP, or 10 μm forskolin (Forsk). Note that negative I_sc corresponds to outward K⁺ flux in these Ussing chamber experiments. The bars of the insets are reported as mean ± S.E. of the number of cultures from three different lungs indicated in the parentheses below each bar. C, effect of 5 μm paxilline, a BK channel inhibitor (preincubation for 3–5 min) on ATP-induced I_sc changes. D, dose-dependent inhibition of 10 μm ATP-induced I_sc changes by paxilline. Nonlinear regression fit for log inhibitor versus normalized response gave best fit values of log IC₅₀ = 1.557 ± 0.03856 nm and IC₅₀ = 36.5 nm (r² = 0.9650, n = 22). E, effect of iberiotoxin (Ib, 500 nm, 30-min preincubation) on ATP-induced I_sc changes. F, Ussing chamber experiments in apically permeabilized cells exposed to an apical to basolateral K⁺ gradient. All compounds were added basolaterally. Although 10 μm ATP induced a change in I_sc (basolateral K⁺ secretion), this change was not inhibited by the BK channel blocker paxilline, indicating that BK channels are active only at the apical membrane. *, p < 0.05; **, p < 0.01; and ***, p < 0.001.

To test for basolateral, BK channel-dependent K⁺ currents, fully differentiated, apically permeabilized NHBE cells were mounted in Ussing chambers for I_sc measurements (at V_c = 0 mV) using an apical to basolateral K⁺ gradient to assess basolateral K⁺ efflux (Fig. 4F). The outward (basolateral) current elicited by 10 μm ATP at the basolateral membrane was not significantly influenced by 5 μm paxilline, indicating that BK channels are solely active in the apical membrane in these conditions.

Simulations Support Hypothesis That Apical K⁺ Currents Increase Apical Cl⁻ Efflux

It is known that basolateral K⁺ efflux accompanies apical Cl⁻ secretion, resulting in a transepithelial electrical potential that in turns drives paracellular Na⁺ transport, which finally generates the osmotic gradient that drives water secretion (41). However, apical K⁺ currents of the intensity revealed in our experiments could contribute to the osmotic gradient by themselves by moving K⁺ out from the apical membrane, partially substituting for the paracellular movement of Na⁺. Cook and Young (30) proposed that apical K⁺ secretion can favor Cl⁻ secretion, thereby bypassing some of the paracellular Na⁺ movement. We therefore tested a model (Fig. 5A) similar to that of Cook and Young they derived from measured values in dog trachea (30). The equivalent circuit of the model epithelium is shown in Fig. 5B. With this model, we show that apical Cl⁻ secretion increases by 50–300% when apical BK channels are activated (Fig. 5C). Even for very large apical K⁺ conductances, the luminal [K⁺] does not increase to >20–35 mm (Fig. 5D), which is in the range found for secreting epithelia, especially airways (27).

FIGURE 5.

Activation of apical K⁺ channels increase Cl⁻ secretion in an epithelial cell simulation. A, model from Cook and Young (30) for cation and Cl⁻ secretion, containing secondary active Na/K/Cl transporters, Na/K ATPases, basolateral K⁺ channels, apical K⁺, Na⁺, and Cl⁻ channels, and a paracellular cation conductance, modified to also account for amiloride-sensitive epithelial sodium channel at the apical membrane. B, equivalent circuit for the model. E_j^K = RT/F log([K]_i/[K]_l), E_j^Na = RT/F log([Na]_i/[Na]_l), E_a^K = RT/F log([K]_c/[K]_l), E_a^Na = RT/F log([Na]_c/[Na]_l), E_a^Cl = −RT/F log([Cl]_c/[Cl]_l), and E_bl^K = RT/F log([K]_c/[K]_i). Current of the Na⁺, K⁺-ATPase is indicated by I_p in the drawing. C and D, simulations using the parameters in Table 3: Cl⁻ secretion (C) and luminal K⁺ concentrations (D) using the model in A with increasing apical K⁺ conductance. Dashed lines, no amiloride-sensitive epithelial sodium channel activity; solid lines, with amiloride-sensitive epithelial sodium channel activity at 35% of the Cl⁻ conductance. Two different paracellular cation resistances were used in the simulations, 600 Ωcm² (black) and 300 Ωcm² (red), to show the effect of the paracellular conductance on Cl⁻ secretion and luminal K⁺ concentration.

Effect of KCNMA1 Knockdown on Apical, ATP-induced K⁺ Flux

An shRNA approach was used to decrease KCNMA1 (mRNA) expression. Fully differentiated cells infected with shRNA producing lentiviruses (as indicated in Table 2) revealed a significant reduction in relative KCNMA1 (mRNA) expression in comparison with noninfected and cells infected with nontargeting virus (Fig. 6A). The same was true for BK α subunit protein expression quantified on Western blots in the linear range (Fig. 6B). Furthermore, apical K⁺ currents in response to 10 μm ATP in basolaterally permeabilized cells decreased significantly in cells with less KCNMA1 (mRNA) expression (Fig. 6C). These data confirmed that functional expression of BK in the apical membrane contributed the majority of the measured, Ca²⁺-dependent K⁺ current.

FIGURE 6.

KCNMA1 knockdown decreases ATP-induced apical K⁺ movement and causes airway surface liquid volume loss. A–C, shRNA knockdown of KCNMA1 was accomplished by infection of nondifferentiated NHBE cells with lentiviruses collected after HEK293T transfection with pLKO.1 puromycin resistance encoding plasmids expressing a sequence targeting KCNMA1 (mRNA) (NM_001014797 and NM_002247, TRC clone TRCN0000000212) (knockdown, KD) or a sequence that is nontargeting (NT; SHC002). Infected NHBE cells were selected with puromycin and grown until differentiation (∼20 days). Noninfected (NI) cells were grown in parallel. A, expression of KCNMA1 (mRNA) relative to GAPDH (mRNA) measured by qPCR, normalized to the average mRNA level in uninfected cells. The bars are reported as mean ± S.E. of n experiments, indicated in parentheses. B, Western blot (left panel) and quantification (right panel) of BK α (relative to β-actin) in fully differentiated NHBE cells (two lungs in triplicates). C, representative experiment (left panel) and quantification of the responses (right panel) of the effect of KCNMA1 knockdown on apical K⁺ efflux using basolaterally permeabilized cells in Ussing chamber exposed to a basolateral to apical K⁺ gradient (I_sc measurements). D–F, sustained paxilline treatment and KCNMA1 knockdown reduces ASL volume as assessed by CBF as a surrogate marker. Adequate ASL volume maintains an appropriate periciliary fluid height that allows normal ciliary activity. Thus, conditions that are associated with a CBF reduction that is fully rescued upon apical fluid addition indicate ASL volume depletion. D, summary of the protocol. Fully differentiated NHBE cells cultured at the ALI were apically not disturbed (no washes) for 3.5 days. Then, CBF was measured without disturbing the apical compartment (treated cells, T), upon which the cultures were apically supplemented with Dulbecco's PBS (recovered, R). E, effect of basolateral treatment of fully differentiated NHBE cells for 3.5 days with 5 μm paxilline or equivalent volume of vehicle (control) on CBF (all n ≥ 5 cultures from three different lungs for each group). CBF decreased significantly in the paxilline-treated cells (T), but CBF fully recovered immediately after ASL volume repletion (R). F, effect of KCNMA1 knockdown in comparison with nontargeting of fully differentiated NHBE cells on CBF after 3.5 days of leaving the apical compartment undisturbed. CBF in knockdown cells actually stopped (ciliostasis) but recovered fully immediately after ASL volume repletion (all n ≥ 4 for each group). An asterisk indicates significant difference by Tukey-Kramer comparison of all treatments after one-way analysis of variance (p < 0.001).

ASL Volume Changes (as Assessed by Measuring CBF before and after ASL Volume Repletion) upon Chronic Inhibition of BK Activity

Given the above data, the support of the computational model that apical K⁺ channels facilitate apical Cl⁻ secretion and our visual observation that during long term experiments with BK channel inhibitors and KCNMA1 knockdown cells, the apical surface of the cells appeared dry and revealed no mucus transport, we wondered about the role of BK channels in ASL volume control. One important role of ion transport is to ensure adequate ASL volume necessary for mucociliary function. Decreased Cl⁻ secretion or increased Na⁺ absorption results in ASL volume depletion (classic example is cystic fibrosis). When ASL is depleted, the periciliary fluid height collapses (42). The periciliary fluid is required to be about as high as the length of cilia (7 μm) to allow proper and effective ciliary beating and mucociliary transport (e.g. Ref. 43). Thus, low CBF that fully recovers after supplementing the apical compartment with fluid indicates ASL volume depletion (because direct effects on cilia would translate into abnormal CBF even after ASL volume repletion). Therefore, CBF was measured either in NHBE cells treated basolaterally with 5 μm paxilline (or vehicle control) for 3.5 days or in KCNMA1 knockdown cells (Fig. 6D). Paxilline was added basolaterally to avoid disturbing the apical compartment. As paxilline is cell membrane permeable, it will reach even the apical membrane in these long term experiments. During the 3.5 days of exposure, no apical washes were performed to avoid adding liquid to the apical surface. The same protocol was applied to nontargeting and KCNMA1 knockdown cells.

In NHBE cells treated basolaterally for 3.5 days with paxilline, a significant decrease in CBF was observed compared with controls and mucus transport ceased. This decrease was immediately and fully reversible upon apical addition of Dulbecco's PBS (recovered cells; Fig. 6E); mucus transport was again apparent. After 3 days without any apical wash, NHBE cells in which KCNMA1 was knocked down showed ciliostasis, making it impossible to measure CBF in these cultures (Fig. 6F). Mucus transport was also not present. However, beating was again completely restored (and mucus transport obvious) with apical Dulbecco's PBS addition (Fig. 6F). Recovery of ciliary beating to normal values by apical fluid addition in both experimental sets suggested that the CBF decrease was the result of ASL volume depletion, i.e. periciliary fluid collapse. Taken together, these results indicate that BK channels are involved in ASL volume control and thus mucociliary transport regulation.

DISCUSSION

Our results strongly support the hypothesis that apical purinergic stimulation activates apical K⁺ secretion via BK channels and that blocking these BK channels causes ASL volume depletion. Apical nucleotide regulation of ASL volume is well recognized (19–21, 44–46); thus, the findings reported here are important for airway homeostasis and homeostasis of other epithelia that are regulated by purinergic receptor actions.

Our data demonstrate that BK channels are functional at the apical membrane of primary NHBE cells, thereby playing a quantitatively important role in apical, ATP-stimulated K⁺ and anion secretion. The concept that apical K⁺ conductance can enhance anion secretion was first developed by Cook and Young (30) in 1989. In 1997, Clarke et al. (47) found an apical K⁺ current in human airway epithelia, suggesting that the simultaneous secretion of both Cl⁻ and K⁺ will result in the transfer of ions and water directly to the airway lumen. Moser et al. (48) demonstrated apical localization and functional activity of several types of KCNQ channels in an airway epithelial cell line (Calu-3). More recently, Namkung et al. (27) measured apical K⁺ secretion in human airway bronchial epithelial cells and demonstrated the participation of apical KCNQ channels in K⁺ currents both at basal rates and during I_sc increases in response to 10 μm forskolin; however, the magnitude of the current response to apical ATP was not examined, even though apical nucleotides are the physiological stimuli. More importantly, BK channel activity was not examined and thus not related to any of these reported apical currents. Finally, there are no reports that link defective apical K⁺ current to airway surface liquid depletion. Here, we show that BK channels are not only functional at the apical membrane but that their contribution to nucleotide-stimulated ion secretion and surface hydration is critical because inhibiting these channels disrupts the normal balance and causes ASL volume depletion and periciliary fluid height collapse.

Nucleotide-induced anion secretion in airway epithelia has been explored extensively (19–21, 44–46). Both ATP and UTP interact with the G_q-coupled P₂Y₂ receptor and induce a fast mobilization of intracellular Ca²⁺ to the cytoplasm, which activates calcium-dependent channels, including BK and TMEM16. This ATP-stimulated pathway seems critical as seen in a recent paper reporting TMEM16A knock-out mice where ASL volume was inadequate (12), similar to our findings with knockdown of a channel upstream of TMEM16A (providing a Cl⁻ driving force). However, a recent paper challenged the notion that TMEM16A was the major calcium-activated chloride channel in human airway cells (49). Apical BK channels open in response to ATP or other stimuli. ATP is secreted by bronchial cells in response to several stimuli, even cell stretch experienced during quiet respiration (50, 51). Thus, ATP stimulation of airway epithelial cells occurs continuously and regulates ASL volume (19, 20, 46). At least part of the ATP exits the cell through apical pannexin 1 channels, which open in response to mechanical or hypo-osmolar stress (52) or in response to increased Ca²⁺ (52). ATP can also be released from mucin granules in goblet cells (53).

In addition to ATP-mediated activation, BK can be modulated by membrane stretch (54, 55), H₂O₂ (56), arachidonic acid (57), phosphorylation (58), and other mechanisms (see Ref. 59 for review). This activation pattern may be important in the airway but remains unexplored here. In the human bronchial epithelial cell line 16HBE14, BK responds to hypotonic stress (60) and to high viscosity through TRPV4/BK interactions (61).

Our study shows that BK channels are functional at the apical membrane in fully differentiated human airway epithelia and that BK channels play a key role for the availability of adequate ASL volume and thereby for mucociliary function. According to our results and previous data, we propose a model where apical BK channels help drive the movement of water to the airway surface, responding to ATP signaling and mechanical stress. Failure of apical BK channel activity causes a loss of apical fluid availability and consequently mucociliary dysfunction. Thus, variations in BK channel expression or activity might be important in multiple airway diseases, including chronic bronchitis.