Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Jul 1.
Published in final edited form as: Mutat Res. 2011 Mar 30;712(1-2):20–27. doi: 10.1016/j.mrfmmm.2011.03.010

The phenotype of FancB-mutant mouse embryonic stem cells

Tae Moon Kim 1, Jun Ho Ko 1, Yong Jun Choi 1, Lingchuan Hu 1, Paul Hasty 1,*
PMCID: PMC3109163  NIHMSID: NIHMS285769  PMID: 21458466

Abstract

Fanconi anemia (FA) is a rare autosomal recessive disease characterized by bone marrow failure, developmental defects and cancer. There are multiple FA genes that enable the repair of interstrand crosslinks (ICLs) in coordination with a variety of other DNA repair pathways in a way that is poorly understood. Here we present the phenotype of mouse embryonic stem (ES) cells mutated for FancB. We found FancB-mutant cells exhibited reduced cellular proliferation, hypersensitivity to the crosslinking agent mitomycin C (MMC), increased spontaneous and MMC-induced chromosomal abnormalities, reduced spontaneous sister chromatid exchanges (SCEs), reduced gene targeting, reduced MMC-induced Rad51 foci and absent MMC-induced FancD2 foci. Since FancB is on the X chromosome and since ES cells are typically XY, FancB is an excellent target for an epistatic analysis to elucidate FA’s role in ICL repair.

Keywords: Fanconi anemia, interstrand crosslink, G2 arrest, Radial, FancD2, Rad51

1. Introduction

There are multiple genes that function in the FA pathway. Their protein products can be categorized into three groups [1]. The first two groups are essential for the initial FA response to DNA damage. Group 1 is composed of 8 FA proteins in the core complex that include FancB along with Fanc(A, C, E–G, L, M). Mutations in genes that code for these proteins are known to cause FA. In addition, there are two proteins in this complex, FAAP24 and FAAP100 that have not been identified with the FA disease. Group 2 is composed of FancI and FancD2; these proteins share sequence homology and interact with each other to form the ID complex [2,3]. This complex is activated after an E3 ubiquitin ligase, FancL monoubiquitinates both proteins in response to DNA damage [4]. The other core complex proteins are also critical for ID monoubiquitination [5]. Group 3 is composed of FancD1 (Brca2), FancN (Palb2, partner and localizer of Brca2)[6,7] and FancJ (Bach1 or Brip1) [8,9]. This group directs downstream repair pathways like homologous recombination (HR), a major DNA double-strand break (DSB) repair pathway. HR repairs DSBs that arise when replication forks collide with ICLs [10]. In addition mutations in two other genes important for homologous recombination, RAD51C [11] and SLX4 [12] cause a phenotype similar to FA. Group 3 proteins provide an important link to breast cancer since homozygous mutations lead to FA while heterozygous mutations in at least some of these genes cause breast cancer after loss of heterozygosity [13,14]. Unlike the first and second groups, genes mutated in the third group do not impact ID monoubiquitination indicating they function downstream of ID or in a different pathway. Proteins from all three groups are highly conserved in vertebrates with only some proteins present in lower species [15].

Many of the FA genes have been mutated in mouse ES cells and in mice including FancC [16,17], FancA [18–20], FancL (a.k.a. Pog) [21], FancG [22,23] and FancD2 [24]. Most of these mutations delete one or more exons causing a frameshift for downstream sequences [16–20,22–24] while one mutation is a duplication of three exons [21]; all mutations are likely null. Mutating these genes caused a common phenotype: hypersensitivity to crosslinking agents and radial chromosomes. Genetic modifiers influenced their phenotypes since deletion of either FancL or FancD2 caused embryonic lethality in some but not all genetic backgrounds [21,24]. In addition, FancD2-mutant mice displayed more symptoms than these core complex mutations including perinatal lethality and elevated cancer suggesting either a difference in genetic background or function independent of the core complex.

Here we present the phenotype of FancB-mutant ES cells. FancB is X-linked, a member of the core complex and is mutated in about 2% of FA patients [25]. It contains a putative C-terminal nuclear localization signal and a coiled coil domain (intertwined alpha-helices for protein-protein interactions) [26] and is conserved in vertebrates [27]. We found FancB-mutant ES cells exhibited reduced cellular proliferation, increased sensitivity to MMC, increased spontaneous and MMC-induced chromosomal abnormalities, reduced spontaneous SCEs, reduced MMC-induced Rad51 foci and absent MMC-induced FancD2 foci. We believe this X-linked gene is an excellent target for an epistatic analysis since it requires deletion of only one copy in XY ES cells.

2. Materials and Methods

2.1 Cell culture conditions

Mouse ES cells were grown in Minimal Essential Media-α (Invitrogen/Gibco, Carlsbad, California) with 15% fetal bovine serum (Invitrogen/Gibco, Carlsbad, California), 2mM glutamine, 30µg penicillin/ml, 50µg streptomycin/ml, 10−4M β-mercaptoethanol and 1 X leukocyte inhibiting factor (Chemicon) and grown on plastic plates coated with gelatin (0.1%) for about one hour or plastic gelatinized plates with a monolayer of murine embryonic fibroblasts (mutant for HPRT and positive for puromycin) exposed to 30 Gy to inactivate mitosis.

2.2. Generation of conditional Fancb targeting vector

The conditional targeting vector was made as previously described [28]. Briefly, AB2.2 genomic DNA was used to amplify the left and right arms of homology and the region of exon 2. After amplifying arms, the left arm was digested with SalI and NotI and cloned into a plasmid backbone (pKO) cut with SalI and NotI. Then, the right arm was cut with BamHI and NotI and cloned into the same backbone adjacent to the left arm digested with BamHI and NotI. The amplified exon 2 was digested with AscI and Rsr2 and then cloned into modified pBluesript. The polymerase was I-proof polymerase (Bio-Rad, Hercules, CA).

  • Left arm Forward: 5’AAACGCGTCGACTTACTATAAACCACCACATAGCGATGAAGTATACTCCTATAG 3’

  • Left arm Reverse: 5’ CACAGCGGCCGCAGGCCACTAAGGCCTTGATCCAGTTCCAACTGC AAATGG 3’

  • Conditions: 1 cycle of 98°C for 5 min; 35 cycles of 98°C for 1 min -> 64.7°C–70.2°C for 1 min -> 72°C for 1 min and 30 s; and 1 cycle of 72°C for 10 min

  • Right arm Forward: 5’ CACAGCGGCCGCAGGCCTGCGTGGCCTCTAGTAGTTCTGTTTGTAATCTTGGG 3’

  • Right arm Reverse: 5’ ACACGGATCCAGAACTTATCCATGAATGTGCAAGC 3’

  • Conditions: 1 cycle of 98°C for 5 min; 35 cycles of 98°C for 1 min -> 64.7°C–70.2°C for 1 min -> 72°C for 1 min; and 1 cycle of 72°C for 10 min

  • Exon 2 For: 5’ ATATGGCGCGCCATCTAAGATCTATTAGCTAGC 3’

  • Exon 2 Rev: 5’ ATATCGGTCCGAGAGTGATATTAAGCCCCGTACC 3’

  • Conditions: 1 cycle of 98°C for 5 min; 35 cycles of 98°C for 1 min -> 64.7°C–70.2°C for 1 min -> 72°C for 30 s; and 1 cycle of 72°C for 10 min

Polymorphisms were introduced into FancB exon 2 in order to reduce the length of contiguous homology thereby reducing the possibility of a crossover occurring within this area that would exclude the 5’ loxP in the final targeted clone. Fancb exon2 was cloned into pBluescriptII and three nucleotide changes were made using the QuickChange® Multi Site-Directed Mutagenesis Kit according to the manufacturer’s instruction (Stratagene). These changes did not alter the amino acid. The following primers were used:

  • SDM1: 5’-GATGAGAACACAAAAATCTTTGACG-3’

  • SDM2: 5’-TACCCAGAAGCTATCAGAATCAGAC-3’

  • SDM3 5’-GTTCAGATTCTTGATGCAGGGAAAAG- 3’

This altered FancB exon 2 was then cloned into the Asc1 and Rsr2 sites adjacent to the positive selection cassette, puΔtk. puΔtk is a positive/negative selection cassette that fuses puromycin N-acetyltransferase (pu) to a truncated version of herpes simplex virus type 1 thymidine kinase (Δtk) generating resistance to puromycin and sensitivity to FIAU [1-(-2-deoxy-2-fluoro-1-β-D-arabino-furanosyl)-5-iodouracil] [29]. This cassette is flanked 5’ by an RE mutant loxP and 3’ by an LE mutant loxP [30]. The Asc1 and Rsr2 sites are in between the RE mutant loxP and puΔtk. The entire cassette (RE mutant loxP + FancB exon 2 + puΔtk + LE mutant loxP) was cloned into the Sfi1 sites that separate the left and right arms as previously described [28].

2.3. Generation and detection of targeted clones

FancB was mutated in two 129 substrains of ES cells. The first strain was AB2.2 and the second strain was IB10. These mouse ES cells (5 × 106 in 800µl DPBS) were electroporated (230V and 500µF, Gene Pulsar apparatus, Bio-Rad) with 5µg of targeting vector previously cut with PacI. Then 250µl was seeded onto a 10cm feeder plate. Next day, a final concentration of 1 X puromycin (3µg/ml) was added and puromycin-resistant colonies were picked onto a 96-well feeder plate and maintained in puromycin selection. Cells were expanded and replica plated. One plate was frozen and the other was used to isolate genomic DNA [31]. PCR was used to detect targeted ES cell clones by amplifying a 2.3kb PCR product as follows:

  • SP1 (in the PGK-reverse orientation) 5’-TCCATTTGTCACGTCCTGCACGACG-3’

  • SP2 (outside the right arm) 5’-TGTGTTCAGCTCATGTGTAGGCAGTCATGC-3’.

  • Conditions: 1 cycle of 98°C for 5 min; 35 cycles of 98°C for 1 min -> 70.5°C for 1 min -> 72°C for 1 min and 30 s; and 1 cycle of 72°C for 10 min.

Targeted clones were then tested for the presence of the 5’ RE mutant loxP using PCR. The RE mutant loxP increased the size of the amplified fragment from 828bp to about 900bp.

  • Forward primer: 5’-TGCTGCTTTGCATATTGCAG-3’

  • Reverse primer: 5’-TGTGTTCTCATCCAATGCATG-3’

  • Conditions: 1 cycle of 98°C for 5 min; 35 cycles of 98°C for 1 min -> 64°C for 1 min -> 72°C for 30 s; and 1 cycle of 72°C for 10 min.

2.4. Cre-mediated deletion of Fancb exon2

Targeted ES cells were expanded in 1 × puromycin media; selection was removed one day before transfection; 5 × 106 cells in 800µl DPBS (Dulbecco’s Phosphate Buffered Saline) were electroporated with 10µg of pPGKcrepA using a Bio-Rad Gene Pulsar at 230V, 500µF. After transfection, 200µl of electroporation was seeded onto a 10 cm feeder plate without selection for 2days to allow time for removal of Fancb exon2-puΔtk. Then 5 × 104 cells were seeded onto a 10cm feeder plate in 200nM FIAU selection media. FIAU-resistant colonies were picked about 8–10 days later. Cells were expanded in 200nM of FIAU selection media and replica plated. One plate was frozen and the other was used to isolate genomic DNA [31]. Cre-mediated deletion was confirmed by PCR using I-proof polymerase (Bio-Rad Laboratories). For genomic PCR, primers to detect removal of Fancb exon2- puΔtk are as follows:

  • CreDF1 (in Fancb intron 1) 5’-TGCTGCTTTGCATATTGCAG-3’

  • CreDR1 (in Fancb intron, 2): 5’-AGACAGCTACAATGTACTCC-3’.

  • Conditions: 1 cycle of 98°C for 5 min; 35 cycles of 98°C for 1 min -> 64°C for 1 min -> 72°C for 30 s; and 1 cycle of 72°C for 10 min. This amplifies a 1.7kb PCR product in control cells and a 600bp PCR product in fancbΔ ex2 cells.

Targeted clones were then expanded and tested for FancB transcript using RT-PCR with primers in FancB exons 1 and 3 or exons 1 and 2.

  • FBRTSF1: 5’-TTTGGTGCAACTGGAACG-3’,

  • FBRTSR1: 5’-AGCAAAGTCATTCACCAG-3’

  • FBRTSR2: 5’-ATATGGATCCTTATGCATCTAGAATCTGAACTG-3’.

  • Conditions: 1 cycle of 98°C for 5 min; 35 cycles of 98°C for 1 min -> 64°C for 1 min -> 72°C for 30 s; and 1 cycle of 72°C for 10 min. The primer pair of FBRTST1 and FBRTSR1 amplifies about 985bp PCR product in control cells while no product is amplified in fancbΔex2 cells. The primer pair of FBRTST1 and FBRTSR2 amplifies a 1.2kb PCR product in control cells while amplifying 250bp PCR product in fancbΔex2 cells.

  • Brca2 exon26–27 transcript was used as an internal control for RT-PCR.

  • PCTFF1: 5’-AAAAGAATTCTCCACACCGAACAAAGACCC-3’

  • 3226R: 5’-AAAAGCGGCCGCCTAGCTCCGTGGCGGCTGAAAA-3’

  • Conditions: 1 cycle of 98°C for 5 min; 35 cycles of 98°C for 1 min -> 70.5°C for 1 min -> 72°C for 15 s; and 1 cycle of 72°C for 10 min. This amplifies a 350bp PCR product.

2.5. Colony forming assay

After deletion of Fancb exon2 by Cre-mediated recombination, 8–16 FIAU-resistant colonies were pooled and seeded onto a gelatinized 3.5cm plate. Three days after seeding, cells were counted, and then 2000 cells were seeded onto a gelatinized 3.5cm plate. After incubation for 10 days, the cells were stained with 0.2% methylene blue in 70% ethanol and the image was captured with EPSON Scanner (EPSONPERFECTION, V200 PHOTO). Alternatively, to obtain cell number the colonies were trypsinized, pooled and then counted with a hemacytometer.

2.6. Dose response to MMC

The MMC dose response was performed as described [32]. Briefly, 2000 cells were seeded onto wells of a 24 well plate (day 0). On day 1 the media was changed with MMC at the doses shown in Fig. 3. Cells were counted on day 6 using a hemacytometer. Two clones of fancbmt2 were compared to the parental ES cells, AB2.2. These experiments were repeated three times.

Fig. 3.

Fig. 3

Open in a new tab

fancbΔex2 cells exhibited increased sensitivity to MMC. (A) Dose response that measures cellular proliferation. This graph shows the average of three experiments. Standard deviation is shown. SF means survival fraction. The AB2.2 substrain was used. (B) G2 arrest and increase cell death (sub-G1 peak) 48hr after exposure to 20nM MMC. The AB2.2 substrain was used. (C) MMC-induced chromosomal abnormalities. Chromatid break (top, arrow) and radial (bottom). A probe was used to detect the major satellite repeats in the pericentromere (red) and the CCCTAA repeats in the telomere (green). DAPI was used to stain the long chromosomal arms blue. The AB2.2 substrain was used. (D) DNA damage response to 20hrs exposure to 1.5µM MMC. Top: control cells (left) and fancbΔex2 cells (right) stained for γ-H2AX either exposed (+) or not exposed (−) to 1.5µM MMC. Bottom: summary of data. The TC1 substrain was used.

2.7. Three-color FISH (Fluorescence in situ hybridization)

Cells (70–80% confluent on gelatinized 10cm plate) were treated with 1µg/ml colcemid for 4 hours. Then the media was collected into 15ml conical tube and cells were washed on 10cm plate with 3ml of PBS. The PBS was collected into the same conical tube. Cells were trypsinized on the 10cm plate and then collected into the same conical tube. Slide preparation: the cells were spun down at 800rpm for 7min, and then washed twice in PBS (all PBS washes are pH 7.4 unless otherwise noted.). The pellet was resuspended in 600µl 75mM KCl, dropwise while flicking the tube. Cells were incubated in a 37°C water bath for 15min. Then 600µl fixative (methanol/acetic acid=2:1) was added for pre-fixation, dropwise, flicking tube, and then cells were spun down at 3000rpm for 1min. Fresh fixative (600µl) was added to cells dropwise while flicking tube and then incubated at room temperature for 10min and then spun down 3000rpm for 1min. Fresh fixative was added to cells and then a drop was added onto a glass slide. Hybridization: the slide was aged in 100% methanol over night and then air dried just before hybridization. The slide was incubated in 70% formamide hybridization solution at 72°C for 5–10min, transferred to 30% formamide hybridization solution (pre-warmed) containing major satellite repeat (CY-3 5’ TGG AAT ATG GCG AGA AAA CTG AAA ATC ATG GAA AAT GAG A 3’) and telomeric [6-FAM 5’ (CCCTAA)7 3’] probes. The slide was then incubated at 37°C for 10–15 min in the dark. Finally, the slide was washed in PBS, 10 dips, and then coverslipped in Vectasheield (DAPI) mounting media (Vector Labs). Fluorescent microscopy was performed with a Zeiss Axioplan2 microscope.

2.8. Cell cycle analysis

For the cell cycle analysis, 1 × 106 ES cells were seeded onto a gelatinized 10 cm plate and allowed to attach overnight. Cells were treated with or without 20nM MMC for 16h and then cultured for 12, 48, or 48h. At each time point, cells were trypsinized and fixed in 70% ethanol for at least 1hr. Fixed cells were kept in 4°C until use. These cells were washed with PBS twice and resuspended in 1ml PI solution containing 1µl of propidium iodide (PI) from a 10mg/ml stock solution, 81µl of RNase A from a 25mg/ml stock solution and 0.1% Triton X-100. Cells were incubated at 37°C for 20min and analyzed for DNA content using BD Facscaliber flow cytometer.

2.9. Sister chromatid exchange (SCE) assay

For the SCE assay, 2 × 106 cells were seeded onto a gelatinized 10 cm plate and allowed to attach overnight. Next day, 10µg/ml BrdU was added to the media. The cells were incubated in BrdU-containing media for 24hrs, released for 12hrs and then treated with 1µg/ml colcemid for 4hrs. These cells were processed in the same way as for FISH analysis on metaphase spreads. Metaphase chromosomes were stained with DAPI (blue), pericentromere probe (red) and fluorescent anti-BrdU antibodies (green).

2.10. FancD2, Rad51 and γ-H2ax foci detection

Immunostaining on mouse ES cell is difficult because they proliferate as multilayer colonies. Some 129 substrains like AB2.2 are extremely difficult while others like TC1 are less difficult. Therefore, we deleted FancB in TC1 cells to perform the immunostaining. Two × 104 cells were seeded onto a plastic chamber slide (Nalge Nuc International Corp. Nalerville, IL). After 48 hrs, cells were treated with 1.5µM MMC for 20 hrs. Following MMC treatment cells were rinsed with PBS and then fixed with 2% formaldehyde (diluted in PBS) by incubating at room temperature for 10min. After three washes with PBS, cells were permeablized with 0.5% Triton in PBS for 10min at room temperature. Following permeablization the cells were washed with PBS three times, and then blocked with blocking buffer (4% non-fat milk in PBS) for 1–2 hrs at room temperature. After wash, FancD2 antibody (Novas Biologicals, 1: 200 dilution) or Rad51 antibody (H92, Santa cruz biotechnology, 1: 200 dilution) or γ-H2ax antibody (Upstate, 1:250 dilution) in 4% non-fat milk in PBS was applied to cells and slides were incubated overnight at 4°C. Upon the completion of antibody incubation, the cells were washed with PBS three times and then incubated with blocking buffer containing a fluorescent-labeled secondary antibody (Alexa Fluor488 ®(AB’)2 fragment of goat anti-rabbit IgG (H+L), Molecular Probe, OR, working dilution-1:1000) for 1 hr at room temperature. After rinsing four to five times with PBS, drops of DAPI-containing mounting medium (VectorShield mounting medium, Vector Laboratory, Inc.) were added to the culture slide, and then a coverslip was placed on top of the mounting medium. Cells were observed under a Zeiss fluorescent microscope (Axioplan2).

3. Results and Discussion

3.1. Generation of a conditional FancB mutation

To mutate FancB, a conditional targeting vector was designed to delete exon 2 (the 1st coding exon) after Cre-mediated recombination. Mutant loxPs surround exon 2 and the selection cassette, puΔtk (Fig. 1A). This cassette is a fusion of puromycin N-acetyltransferase (pu) and a truncated version of herpes simplex virus type 1 thymidine kinase (Δtk) [29]. It is ideal for conditional mutations since it offers positive selection in puromycin and negative selection in FIAU. About 1% of puromycin resistant clones were targeted as detected by PCR (Fig. 1B). Targeted clones are called fancbflex2. FancB exon 2 was deleted in fancbflex2 cells by Cre-mediated recombination (Fig. 1C). Exon 2 deletion was confirmed by PCR (Fig. 1C) and RT-PCR. For RT-PCR, primers located in exons 1 and 3 produced a short transcript (sequencing showed splicing from exon 1 to exon 3) but no transcript with primers in exons 1 and 2 (Fig. 1D). These cells are called fancbΔex2.

Fig. 1.

Fig. 1

Open in a new tab

Targeting FancB. (A) The puΔtk positive/negative selection cassette is a fusion of puromycin N-acetyltransferase (pu) to truncated herpes simplex virus type 1 thymidine kinase (Δtk) [29]. The phosphoglycerate kinase 1 (PGK) promoter [53] and bovine growth hormone polyadenylation sequences (bpA) [54] are used. (B) Targeting FancB using a conditional targeting vector that floxes exon 2 with a RE mutant loxP (blue-green arrow) and a LE mutant loxP [30] to generate fancbflex2 cells. Select in puromycin. Targeted clones were detected by PCR (black half arrows, two targeted clones shown). Lanes 1 and 3 are targeted. These confirmed clones were then tested for the presence of the RE mutant loxP (green half arrows). (C) Cre-mediated deletion of exon 2 and puΔtk to generate fancbΔex2 cells. Selected in FIAU. FIAU-resistant clones were confirmed for exon 2 deletion by PCR (green and blue half arrow. 1. Control, 2–4. FancB exon 2 deletion). (D) Confirm mutation by RT-PCR with red half arrows. Brca2 was used as a loading control (1. Control, 2–4. FancB exon 2 deletion, 5. No DNA).

3.2. Reduced cellular proliferation

Our goal is to determine if FancB exon 2 deletion impairs cellular proliferation/viability by performing a colony forming assay on very early passage cells derived from four fancbflex2 clones. Cre-mediated recombination was used to delete exon 2 and about 2000 FIAU-resistant colonies grew on gelatinized plastic (no feeders) for all four clones. Colonies were picked and seeded onto gelatinized 96-well plates; but cells failed to proliferate suggesting they were nonviable. In order to measure cell number, 8–16 FIAU-resistant colonies were picked, pooled and seeded onto a 3.5cm gelatinized plate (genomic DNA was extracted to verify exon 2 deletion). Cells seeded at this higher density survived and three days later were counted. Then cells (1000, 2000 or 5000) were seeded onto a 10cm gelatinized plate and compared to control AB2.2 cells and their parental fancbflex2 clones before Cre-mediated deletion of exon 2. Colony number was observed 10days later after staining the plates. We found FancB exon 2 deletion reduced colony number from all four parental clones at all seeding densities (Fig. 2A, only the 2000 cell density shown). To ensure FIAU did not influence results, AB2.2 cells were observed with and without FIAU exposure; FIAU did not impair colony number. Cell number was measured 10days after seeding by pooling the colonies in trypsin and counting cells with a hemacytometer. We found FancB exon 2 deletion reduced cell number from all four fancbflex2 clones at all seeding densities (Fig. 2B, only the 2000 cell density shown) as compared to AB2.2 cells with and without FIAU exposure (p=0.0057 and p=0.0025, respectively, student t test with unequal variance) and as compared to their parental fancbflex2 clones (p=0.0142). Thus, FancB exon 2 deletion lowered colony and cell number.

Fig. 2.

Fig. 2

Open in a new tab

fancbΔex2 cells exhibited reduced (A) colony number and (B) cell number. Four fancbΔex2 clones and their fancbflex2 parental clones are shown. The AB2.2 substrain was used.

After the colony-forming assay, the pools of fancbΔex2 cells were expanded on gelatinized plastic. Most of these cells exhibited micronuclei and died. Yet out of these populations, some cells formed colonies showing their ability to adapt. Therefore, FancB exon 2 deletion induced a lethal response, but deletion was not lethal by itself.

The impact FancB exon 2 deletion has on cell proliferation/viability was dependent on tissue culture conditions. Cell density influenced survival since fancbΔex2 cells were expanded from a pool of 8–16 clones but not a single clone. In addition, pooling ~2000 FIAU-resistant colonies (the entire 10cm plate) improved cell survival to a similar level as controls and there was no obvious micronuclei formation or cell death. There was also no appreciable difference for cells cultured on feeder plates even at low density. Based on these observations we used feeder plates to recover exon 2-deleted clones for future experiments. Thus, fancbΔex2 cells are sensitive to tissue culture conditions at very early passage.

3.3. Response to MMC

A hallmark of FA cells is extreme sensitivity to crosslinking agents like MMC [33]. When compared to control cells, fancbΔex2 cells were hypersensitive to MMC as determined by a dose response curve (Fig. 3A). In addition, 48hr after exposure to 20nM MMC, fancbΔex2 cells exhibited a prolonged G2 arrest and increased sub-G1 population (indicating cell death) (Fig. 3B). Furthermore, as analyzed by three-color fluorescence in situ hybridization (FISH), fancbΔex2 cells exhibited increased levels of spontaneous chromosomal abnormalities (Fig. 3C) that included chromatid breaks (Table 1, p<0.001, Yates corrected Chi-Square), chromosomal breaks (Table 1, p<0.001) and radials (Table 1, p<0.001). The numbers of these abnormalities increased after exposure to MMC (Table 1). Thus, our FancB-mutant cells are hypersensitive to MMC as expected.

Table 1.

Summary of the number of chromosomal abnormallities observed in a metaphase spread (MPS)

chromatid breaks chromosomal breaks radials
agent MPS 0 1 2 3 4 5> 0 1 2 3 4 5> 0 1 2 3 4>
1. control - 168 166 2 0 0 0 0 164 4 0 0 0 0 168 0 0 0 0
2. fancbΔex2(#1) - 212 176 25 8 0 3 0 152 48 11 1 0 0 192 19 1 0 0
3. fancbΔex2(#2) - 203 175 25 3 0 0 0 156 43 4 0 0 0 182 21 0 0 0
4. fancbΔex2(#3) - 174 129 36 7 1 0 1 123 43 5 2 1 0 160 12 2 0 0
5. control MMC 166 160 6 0 0 0 0 144 16 4 0 0 0 166 0 0 0 0
6. fancbΔex2(#1) MMC 100 24 26 6 4 1 1 35 40 14 4 4 3 24 38 19 11 8
7. fancbΔex2(#2) MMC 100 29 24 14 4 3 5 32 31 13 16 4 4 29 34 15 14 8
8. fancbΔex2(#3) MMC 100 20 16 16 7 8 6 23 19 25 21 8 5 20 36 27 11 6
Open in a new tab

It is possible that γ-H2AX is needed to recruit FacnD2 to chromatin [34]. Therefore, we tested the formation of γ-H2AX foci after exposure to MMC in fancbΔex2 cells. The fancbΔex2 cells appear to exhibit a normal response to DNA DSBs as measured by the formation of γ-H2AX foci after 20hrs exposure to 1.5µM MMC (Fig. 3D). This observation is in contrast to immortalized human FA-J cells that showed a 3-fold increase in foci after exposure to MMC [35] and to primary FA fibroblasts that showed delayed γ-H2AX formation after exposure to ionizing radiation [36]. Thus, cell type and perhaps experimental conditions likely influence the formation of γ-H2AX foci after exposure to DNA damaging agents in cells defective for the FA pathway.

3.4. Decreased Homologous Recombination

The fancbΔex2 cells were tested for spontaneous sister chromatid exchanges (SCEs); a process by which a single chromatid breaks and then recombines with the intact sister chromatid during replication. During this process, regions of parental strands in the duplicated chromosomes are reciprocally exchanged [37]. HR is responsible for at least some spontaneous SCEs since a defect in HR decreased spontaneous SCEs [38,39] while unregulated crossing over caused by a mutation in the RecQ helicase Blm (Bloom’s syndrome mutated) increased spontaneous SCEs [40]. We found fancbΔex2 cells exhibited a reduction in spontaneous SCEs (Fig. 4, p<0.0001) indicating reduced HR. Previously published data in human cells showed FA did not affect SCEs [41] while in chicken cells FA increased SCEs [42–44]. Therefore, the impact FA has on SCEs appears to be species/cell type specific.

Fig. 4.

Fig. 4

Open in a new tab

fancbΔex2 cells exhibited reduced levels of spontaneous SCEs. Four fancbΔex2 clones are shown. The AB2.2 substrain was used.

FancA deletion reduced gene targeting efficiency [20]; therefore, fancbΔex2 cells were tested for gene targeting efficiency using a targeting vector to Rad51 (to be described elsewhere). Gene targeting efficiency was 16.2% (6/37) for control cells and 0% (0/96) for fancbΔex2 cells (p=0.0007, Fisher’s exact test). Thus, FancB deletion reduced gene targeting suggesting a defect in HR.

Rad51 is required for homology directed repair so fancbΔex2 cells were tested for Rad51 nuclear foci. Rad51 enables ATP-dependent homologous pairing and strand transfer of a single DNA strand at the end of a DSB to the complementary strand provided by the sister chromatid during DNA replication [45]. The Rad51 recombinase polymerizes onto ssDNA to yield a right-handed nucleoprotein filament, called the presynaptic filament that searches for homology and pairs the DNA molecules to form a DNA joint. Rad51 foci often co-localize with FancD2 foci during S phase [46] and in response to DNA damaging agents including MMC [47]. FA primary human fibroblasts exhibited decreased Rad51 foci in response to ionizing radiation in one study [48] while FA lymphoblasts did not show any change in Rad51 foci after exposure to ionizing radiation or MMC [49]. Similar to the lymphoblast study, FancD2-deleted DT40 chicken B-cells exhibited intact Rad51 foci formation after exposure to either MMC or ionizing radiation [50,51]. These discordances indicate Rad51-mediated homology directed repair genetically interacts with the FA pathway in a cell-type specific manner.

We tested mouse ES cells for Rad51 foci formation after exposure to MMC. We found fancbΔex2 cells exhibited lower levels of MMC-induced Rad51 foci as compared to control cells (Fig. 5, p=0.0017, Yates Corrected Chi square). Thus, fancbΔex2 cells are likely defective for homology directed repair of DSBs associated with interstrand crosslinks. This study is similar to one reported for FancA-defective mouse ES cells suggesting this is a common phenotype for disruption of the FA core complex in mouse ES cells [20].

Fig. 5.

Fig. 5

Open in a new tab

fancbΔex2 cells exhibited low levels of MMC-induced Rad51 foci. (A) Control cells, no treatment, NT. (B) Control cells, 20h exposure to 1.5µM MMC. (C) fancbΔex2 cells, no treatment. (D) fancbΔex2 cells, 20h exposure to 1.5µM MMC. (C) Summary. Total number of cells observed and total number of cells observed with < 10 or > 10 Rad51 foci. The TC1 substrain was used.

3.5. Decreased FancD2 foci

In response to crosslinking agents, FancD2 forms nuclear foci that are dependent on the FA core complex while a diffuse nuclear staining was observed independent of the core complex [4]. In a cell-free system, FancD2 was required for replication-coupled ICL repair during S phase [52]. Similarly, fancbΔex2 cells failed to exhibit MMC-induced FancD2 nuclear foci (Fig. 6A–C, p<0.0001). Thus, FancD2 no longer forms foci in response to MMC-induced DNA damage in FancB-mutant cells as expected. This observation demonstrates deleting FancB exon 2 disrupts the FA pathway.

Fig. 6.

Fig. 6

Open in a new tab

fancbΔex2 cells failed to exhibit MMC-induced FancD2 foci. After 20hr exposure to 1.5µM MMC, (A) control cells but not (B) fancbΔex2 cells exhibited FancD2 foci. (C) Summary. Total number of cells observed and total number of cells observed with FancD2 foci. The TC1 substrain was used.

3.6. Conclusions

Here we describe the phenotype for deleting FancB exon 2 in mouse ES cells. We found deleting FancB exon 2 caused reduced proliferation and hypersensitivity to MMC. The MMC defects included reduced survival, increased cell death, G2 arrest and chromosomal abnormalities. With the exception of the cell proliferation/viability defect, these phenotypes are typical for an FA phenotype. It is likely mutations in other FA genes also caused reduced cellular proliferation but this phenotype would not be observed in cancer derived cells or even ES cells cultured under certain conditions (high density and with feeders). In addition to these phenotypes we also observed reduced spontaneous SCEs, gene targeting and MMC-induced Rad51 foci. These phenotypes seem to be influenced by cell type and possibly by experimental conditions. We propose FancB is a good target for an epistatic analysis in mouse ES cells due to its location on chromosome X; thus, being hemizygous in XY cells.

Acknowledgements

We thank Charnae Williams for technical expertise and Dr. Allan Bradley for the gift of the AB2.2 cells and the puΔtk selection cassette. This work was supported by the following NIH grants to PH: 1 RO1 CA123203-01A1 and P01 AG17242.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Conflicts of interests

The authors declare there are no conflicts of interest.

References

  • 1.Wang W. Emergence of a DNA-damage response network consisting of Fanconi anaemia and BRCA proteins. Nat Rev Genet. 2007;8:735–748. doi: 10.1038/nrg2159. [DOI] [PubMed] [Google Scholar]
  • 2.Smogorzewska A, Matsuoka S, Vinciguerra P, McDonald ER, 3rd, Hurov KE, Luo J, Ballif BA, Gygi SP, Hofmann K, D'Andrea AD, Elledge SJ. Identification of the FANCI protein, a monoubiquitinated FANCD2 paralog required for DNA repair. Cell. 2007;129:289–301. doi: 10.1016/j.cell.2007.03.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Sims AE, Spiteri E, Sims RJ, 3rd, Arita AG, Lach FP, Landers T, Wurm M, Freund M, Neveling K, Hanenberg H, Auerbach AD, Huang TT. FANCI is a second monoubiquitinated member of the Fanconi anemia pathway. Nat Struct Mol Biol. 2007;14:564–567. doi: 10.1038/nsmb1252. [DOI] [PubMed] [Google Scholar]
  • 4.Garcia-Higuera I, Taniguchi T, Ganesan S, Meyn MS, Timmers C, Hejna J, Grompe M, D'Andrea AD. Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway. Mol Cell. 2001;7:249–262. doi: 10.1016/s1097-2765(01)00173-3. [DOI] [PubMed] [Google Scholar]
  • 5.Pace P, Johnson M, Tan WM, Mosedale G, Sng C, Hoatlin M, de Winter J, Joenje H, Gergely F, Patel KJ. FANCE: the link between Fanconi anaemia complex assembly and activity. Embo J. 2002;21:3414–3423. doi: 10.1093/emboj/cdf355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Reid S, Schindler D, Hanenberg H, Barker K, Hanks S, Kalb R, Neveling K, Kelly P, Seal S, Freund M, Wurm M, Batish SD, Lach FP, Yetgin S, Neitzel H, Ariffin H, Tischkowitz M, Mathew CG, Auerbach AD, Rahman N. Biallelic mutations in PALB2 cause Fanconi anemia subtype FA-N and predispose to childhood cancer. Nat Genet. 2007;39:162–164. doi: 10.1038/ng1947. [DOI] [PubMed] [Google Scholar]
  • 7.Xia B, Dorsman JC, Ameziane N, de Vries Y, Rooimans MA, Sheng Q, Pals G, Errami A, Gluckman E, Llera J, Wang W, Livingston DM, Joenje H, de Winter JP. Fanconi anemia is associated with a defect in the BRCA2 partner PALB2. Nat Genet. 2007;39:159–161. doi: 10.1038/ng1942. [DOI] [PubMed] [Google Scholar]
  • 8.Litman R, Peng M, Jin Z, Zhang F, Zhang J, Powell S, Andreassen PR, Cantor SB. BACH1 is critical for homologous recombination and appears to be the Fanconi anemia gene product FANCJ. Cancer Cell. 2005;8:255–265. doi: 10.1016/j.ccr.2005.08.004. [DOI] [PubMed] [Google Scholar]
  • 9.Levitus M, Waisfisz Q, Godthelp BC, de Vries Y, Hussain S, Wiegant WW, Elghalbzouri-Maghrani E, Steltenpool J, Rooimans MA, Pals G, Arwert F, Mathew CG, Zdzienicka MZ, Hiom K, De Winter JP, Joenje H. The DNA helicase BRIP1 is defective in Fanconi anemia complementation group J. Nat Genet. 2005;37:934–935. doi: 10.1038/ng1625. [DOI] [PubMed] [Google Scholar]
  • 10.Bessho T. Induction of DNA replication-mediated double strand breaks by psoralen DNA interstrand cross-links. J Biol Chem. 2003;278:5250–5254. doi: 10.1074/jbc.M212323200. [DOI] [PubMed] [Google Scholar]
  • 11.Vaz F, Hanenberg H, Schuster B, Barker K, Wiek C, Erven V, Neveling K, Endt D, Kesterton I, Autore F, Fraternali F, Freund M, Hartmann L, Grimwade D, Roberts RG, Schaal H, Mohammed S, Rahman N, Schindler D, Mathew CG. Mutation of the RAD51C gene in a Fanconi anemia-like disorder. Nat Genet. 2010 doi: 10.1038/ng.570. [DOI] [PubMed] [Google Scholar]
  • 12.Kim Y, Lach FP, Desetty R, Hanenberg H, Auerbach AD, Smogorzewska A. Mutations of the SLX4 gene in Fanconi anemia. Nat Genet. 2011;43:142–146. doi: 10.1038/ng.750. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Campeau PM, Foulkes WD, Tischkowitz MD. Hereditary breast cancer: new genetic developments, new therapeutic avenues. Hum Genet. 2008;124:31–42. doi: 10.1007/s00439-008-0529-1. [DOI] [PubMed] [Google Scholar]
  • 14.Meindl A, Hellebrand H, Wiek C, Erven V, Wappenschmidt B, Niederacher D, Freund M, Lichtner P, Hartmann L, Schaal H, Ramser J, Honisch E, Kubisch C, Wichmann HE, Kast K, Deissler H, Engel C, Muller-Myhsok B, Neveling K, Kiechle M, Mathew CG, Schindler D, Schmutzler RK, Hanenberg H. Germline mutations in breast and ovarian cancer pedigrees establish RAD51C as a human cancer susceptibility gene. Nat Genet. 2010;42:410–414. doi: 10.1038/ng.569. [DOI] [PubMed] [Google Scholar]
  • 15.Youds JL, Barber LJ, Boulton SJ. C. elegans: A model of Fanconi anemia and ICL repair. Mutat Res. 2008 doi: 10.1016/j.mrfmmm.2008.11.007. [DOI] [PubMed] [Google Scholar]
  • 16.Chen M, Tomkins DJ, Auerbach W, McKerlie C, Youssoufian H, Liu L, Gan O, Carreau M, Auerbach A, Groves T, Guidos CJ, Freedman MH, Cross J, Percy DH, Dick JE, Joyner AL, Buchwald M. Inactivation of Fac in mice produces inducible chromosomal instability and reduced fertility reminiscent of Fanconi anaemia. Nat Genet. 1996;12:448–451. doi: 10.1038/ng0496-448. [DOI] [PubMed] [Google Scholar]
  • 17.Whitney MA, Royle G, Low MJ, Kelly MA, Axthelm MK, Reifsteck C, Olson S, Braun RE, Heinrich MC, Rathbun RK, Bagby GC, Grompe M. Germ cell defects and hematopoietic hypersensitivity to gamma-interferon in mice with a targeted disruption of the Fanconi anemia C gene. Blood. 1996;88:49–58. [PubMed] [Google Scholar]
  • 18.Cheng NC, van de Vrugt HJ, van der Valk MA, Oostra AB, Krimpenfort P, de Vries Y, Joenje H, Berns A, Arwert F. Mice with a targeted disruption of the Fanconi anemia homolog Fanca. Hum Mol Genet. 2000;9:1805–1811. doi: 10.1093/hmg/9.12.1805. [DOI] [PubMed] [Google Scholar]
  • 19.Noll M, Battaile KP, Bateman R, Lax TP, Rathbun K, Reifsteck C, Bagby G, Finegold M, Olson S, Grompe M. Fanconi anemia group A and C double-mutant mice: functional evidence for a multi-protein Fanconi anemia complex. Exp Hematol. 2002;30:679–688. doi: 10.1016/s0301-472x(02)00838-x. [DOI] [PubMed] [Google Scholar]
  • 20.Yang YG, Herceg Z, Nakanishi K, Demuth I, Piccoli C, Michelon J, Hildebrand G, Jasin M, Digweed M, Wang ZQ. The Fanconi anemia group A protein modulates homologous repair of DNA double-strand breaks in mammalian cells. Carcinogenesis. 2005;26:1731–1740. doi: 10.1093/carcin/bgi134. [DOI] [PubMed] [Google Scholar]
  • 21.Agoulnik AI, Lu B, Zhu Q, Truong C, Ty MT, Arango N, Chada KK, Bishop CE. A novel gene, Pog, is necessary for primordial germ cell proliferation in the mouse and underlies the germ cell deficient mutation, gcd. Hum Mol Genet. 2002;11:3047–3053. doi: 10.1093/hmg/11.24.3047. [DOI] [PubMed] [Google Scholar]
  • 22.Koomen M, Cheng NC, van de Vrugt HJ, Godthelp BC, van der Valk MA, Oostra AB, Zdzienicka MZ, Joenje H, Arwert F. Reduced fertility and hypersensitivity to mitomycin C characterize Fancg/Xrcc9 null mice. Hum Mol Genet. 2002;11:273–281. doi: 10.1093/hmg/11.3.273. [DOI] [PubMed] [Google Scholar]
  • 23.Yang Y, Kuang Y, Montes De Oca R, Hays T, Moreau L, Lu N, Seed B, D'Andrea AD. Targeted disruption of the murine Fanconi anemia gene, Fancg/Xrcc9. Blood. 2001;98:3435–3440. doi: 10.1182/blood.v98.12.3435. [DOI] [PubMed] [Google Scholar]
  • 24.Houghtaling S, Timmers C, Noll M, Finegold MJ, Jones SN, Meyn MS, Grompe M. Epithelial cancer in Fanconi anemia complementation group D2 (Fancd2) knockout mice. Genes Dev. 2003;17:2021–2035. doi: 10.1101/gad.1103403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Meetei AR, Levitus M, Xue Y, Medhurst AL, Zwaan M, Ling C, Rooimans MA, Bier P, Hoatlin M, Pals G, de Winter JP, Wang W, Joenje H. X-linked inheritance of Fanconi anemia complementation group B. Nat Genet. 2004;36:1219–1224. doi: 10.1038/ng1458. [DOI] [PubMed] [Google Scholar]
  • 26.Strauss HM, Keller S. Pharmacological interference with protein-protein interactions mediated by coiled-coil motifs. Handb Exp Pharmacol. 2008:461–482. doi: 10.1007/978-3-540-72843-6_19. [DOI] [PubMed] [Google Scholar]
  • 27.Fei P, Yin J, Wang W. New advances in the DNA damage response network of Fanconi anemia and BRCA proteins. FAAP95 replaces BRCA2 as the true FANCB protein. Cell Cycle. 2005;4:80–86. doi: 10.4161/cc.4.1.1358. [DOI] [PubMed] [Google Scholar]
  • 28.Holcomb VB, Kim TM, Dumitrache LC, Ma SM, Chen MJ, Hasty P. HPRT minigene generates chimeric transcripts as a by-product of gene targeting. Genesis. 2007;45:275–281. doi: 10.1002/dvg.20300. [DOI] [PubMed] [Google Scholar]
  • 29.Chen YT, Bradley A. A new positive/negative selectable marker, puDeltatk, for use in embryonic stem cells. Genesis. 2000;28:31–35. doi: 10.1002/1526-968x(200009)28:1<31::aid-gene40>3.0.co;2-k. [DOI] [PubMed] [Google Scholar]
  • 30.Araki K, Araki M, Yamamura K. Targeted integration of DNA using mutant lox sites in embryonic stem cells. Nucleic Acids Res. 1997;25:868–872. doi: 10.1093/nar/25.4.868. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Ramirez-Solis R, Rivera-Perez J, Wallace JD, Wims M, Zheng H, Bradley A. Genomic DNA microextraction: a method to screen numerous samples. Anal Biochem. 1992;201:331–335. doi: 10.1016/0003-2697(92)90347-a. [DOI] [PubMed] [Google Scholar]
  • 32.Marple T, Li H, Hasty P. A genotoxic screen: rapid analysis of cellular dose-response to a wide range of agents that either damage DNA or alter genome maintenance pathways. Mutat Res. 2004;554:253–266. doi: 10.1016/j.mrfmmm.2004.05.004. [DOI] [PubMed] [Google Scholar]
  • 33.Thompson LH, Hinz JM. Cellular and molecular consequences of defective Fanconi anemia proteins in replication-coupled DNA repair: mechanistic insights. Mutat Res. 2009;668:54–72. doi: 10.1016/j.mrfmmm.2009.02.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Bogliolo M, Lyakhovich A, Callen E, Castella M, Cappelli E, Ramirez MJ, Creus A, Marcos R, Kalb R, Neveling K, Schindler D, Surralles J. Histone H2AX and Fanconi anemia FANCD2 function in the same pathway to maintain chromosome stability. Embo J. 2007;26:1340–1351. doi: 10.1038/sj.emboj.7601574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wu Y, Sommers JA, Suhasini AN, Leonard T, Deakyne JS, Mazin AV, Shin-Ya K, Kitao H, Brosh RM., Jr Fanconi anemia group J mutation abolishes its DNA repair function by uncoupling DNA translocation from helicase activity or disruption of protein-DNA complexes. Blood. 2010;116:3780–3791. doi: 10.1182/blood-2009-11-256016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Leskovac A, Vujic D, Guc-Scekic M, Petrovic S, Joksic I, Slijepcevic P, Joksic G. Fanconi anemia is characterized by delayed repair kinetics of DNA double-strand breaks. Tohoku J Exp Med. 2010;221:69–76. doi: 10.1620/tjem.221.69. [DOI] [PubMed] [Google Scholar]
  • 37.Wilson DM, 3rd, Thompson LH. Molecular mechanisms of sister-chromatid exchange. Mutat Res. 2007;616:11–23. doi: 10.1016/j.mrfmmm.2006.11.017. [DOI] [PubMed] [Google Scholar]
  • 38.Stark JM, Hu P, Pierce AJ, Moynahan ME, Ellis N, Jasin M. ATP hydrolysis by mammalian RAD51 has a key role during homology-directed DNA repair. J Biol Chem. 2002;277:20185–20194. doi: 10.1074/jbc.M112132200. [DOI] [PubMed] [Google Scholar]
  • 39.Tutt A, Bertwistle D, Valentine J, Gabriel A, Swift S, Ross G, Griffin C, Thacker J, Ashworth A. Mutation in Brca2 stimulates error-prone homology-directed repair of DNA double-strand breaks occurring between repeated sequences. Embo J. 2001;20:4704–4716. doi: 10.1093/emboj/20.17.4704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Luo G, Santoro IM, McDaniel LD, Nishijima I, Mills M, Youssoufian H, Vogel H, Schultz RA, Bradley A. Cancer predisposition caused by elevated mitotic recombination in Bloom mice. Nat Genet. 2000;26:424–429. doi: 10.1038/82548. [DOI] [PubMed] [Google Scholar]
  • 41.Godthelp BC, van Buul PP, Jaspers NG, Elghalbzouri-Maghrani E, van Duijn-Goedhart A, Arwert F, Joenje H, Zdzienicka MZ. Cellular characterization of cells from the Fanconi anemia complementation group, FA-D1/BRCA2. Mutat Res. 2006;601:191–201. doi: 10.1016/j.mrfmmm.2006.07.003. [DOI] [PubMed] [Google Scholar]
  • 42.Mosedale G, Niedzwiedz W, Alpi A, Perrina F, Pereira-Leal JB, Johnson M, Langevin F, Pace P, Patel KJ. The vertebrate Hef ortholog is a component of the Fanconi anemia tumor-suppressor pathway. Nat Struct Mol Biol. 2005;12:763–771. doi: 10.1038/nsmb981. [DOI] [PubMed] [Google Scholar]
  • 43.Takata M, Kitao H, Ishiai M. Fanconi anemia: genetic analysis of a human disease using chicken system. Cytogenet Genome Res. 2007;117:346–351. doi: 10.1159/000103197. [DOI] [PubMed] [Google Scholar]
  • 44.Rosado IV, Niedzwiedz W, Alpi AF, Patel KJ. The Walker B motif in avian FANCM is required to limit sister chromatid exchanges but is dispensable for DNA crosslink repair. Nucleic Acids Res. 2009;37:4360–4370. doi: 10.1093/nar/gkp365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.San Filippo J, Sung P, Klein H. Mechanism of eukaryotic homologous recombination. Annu Rev Biochem. 2008;77:229–257. doi: 10.1146/annurev.biochem.77.061306.125255. [DOI] [PubMed] [Google Scholar]
  • 46.Taniguchi T, Garcia-Higuera I, Andreassen PR, Gregory RC, Grompe M, D'Andrea AD. S-phase-specific interaction of the Fanconi anemia protein, FANCD2, with BRCA1 and RAD51. Blood. 2002;100:2414–2420. doi: 10.1182/blood-2002-01-0278. [DOI] [PubMed] [Google Scholar]
  • 47.Hussain S, Wilson JB, Medhurst AL, Hejna J, Witt E, Ananth S, Davies A, Masson JY, Moses R, West SC, de Winter JP, Ashworth A, Jones NJ, Mathew CG. Direct interaction of FANCD2 with BRCA2 in DNA damage response pathways. Hum Mol Genet. 2004;13:1241–1248. doi: 10.1093/hmg/ddh135. [DOI] [PubMed] [Google Scholar]
  • 48.Digweed M, Rothe S, Demuth I, Scholz R, Schindler D, Stumm M, Grompe M, Jordan A, Sperling K. Attenuation of the formation of DNA-repair foci containing RAD51 in Fanconi anaemia. Carcinogenesis. 2002;23:1121–1126. doi: 10.1093/carcin/23.7.1121. [DOI] [PubMed] [Google Scholar]
  • 49.Godthelp BC, Wiegant WW, Waisfisz Q, Medhurst AL, Arwert F, Joenje H, Zdzienicka MZ. Inducibility of nuclear Rad51 foci after DNA damage distinguishes all Fanconi anemia complementation groups from D1/BRCA2. Mutat Res. 2006;594:39–48. doi: 10.1016/j.mrfmmm.2005.07.008. [DOI] [PubMed] [Google Scholar]
  • 50.Yamamoto K, Hirano S, Ishiai M, Morishima K, Kitao H, Namikoshi K, Kimura M, Matsushita N, Arakawa H, Buerstedde JM, Komatsu K, Thompson LH, Takata M. Fanconi anemia protein FANCD2 promotes immunoglobulin gene conversion and DNA repair through a mechanism related to homologous recombination. Mol Cell Biol. 2005;25:34–43. doi: 10.1128/MCB.25.1.34-43.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Kitao H, Yamamoto K, Matsushita N, Ohzeki M, Ishiai M, Takata M. Functional interplay between BRCA2/FancD1 and FancC in DNA repair. J Biol Chem. 2006;281:21312–21320. doi: 10.1074/jbc.M603290200. [DOI] [PubMed] [Google Scholar]
  • 52.Knipscheer P, Raschle M, Smogorzewska A, Enoiu M, Ho TV, Scharer OD, Elledge SJ, Walter JC. The Fanconi anemia pathway promotes replication-dependent DNA interstrand cross-link repair. Science. 2009;326:1698–1701. doi: 10.1126/science.1182372. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Adra CN, Boer PH, McBurney MW. Cloning and expression of the mouse pgk-1 gene and the nucleotide sequence of its promoter. Gene. 1987;60:65–74. doi: 10.1016/0378-1119(87)90214-9. [DOI] [PubMed] [Google Scholar]
  • 54.Pfarr DS, Rieser LA, Woychik RP, Rottman FM, Rosenberg M, Reff ME. Differential effects of polyadenylation regions on gene expression in mammalian cells. DNA. 1986;5:115–122. doi: 10.1089/dna.1986.5.115. [DOI] [PubMed] [Google Scholar]

RESOURCES