Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2011 Jun 7.
Published in final edited form as: Mol Microbiol. 1999 Jan;31(2):691–701. doi: 10.1046/j.1365-2958.1999.01210.x

Disruption of the Toxoplasma gondii bradyzoite-specific gene BAG1 decreases in vivo cyst formation

Yi Wei Zhang 1,3, Kami Kim 2,3, Yan Fen Ma 1, Murray Wittner 1,2, Herbert B Tanowitz 1,2, Louis M Weiss 1,2,*
PMCID: PMC3109652  NIHMSID: NIHMS287931  PMID: 10027984

Summary

The bradyzoite stage of the Apicomplexan protozoan parasite Toxoplasma gondii plays a critical role in maintenance of latent infection. We reported previously the cloning of a bradyzoite-specific gene BAG1/hsp30 (previously referred to as BAG5) encoding a cytoplasmic antigen related to small heat shock proteins. We have now disrupted BAG1 in the T. gondii PLK strain by homologous recombination. H7, a cloned null mutant, and Y8, a control positive for both cat and BAG1, were chosen for further characterization. Immunofluorescence and Western blot analysis of bradyzoites with BAG1 antisera demonstrated expression of BAG1 in the Y8 and the PLK strain but no expression in H7. All three strains expressed a 116 kDa bradyzoite cyst wall antigen, a 29 kDa matrix antigen and the 65 kDa matrix reactive antigen MAG1. Mice inoculated with H7 parasites formed significantly fewer cysts than those inoculated with the Y8 and the PLK strains. H7 parasites were complemented with BAG1 using phleomycin selection. Cyst formation in vivo for the BAG1-complemented H7 parasites was similar to wild-type parasites. We therefore conclude that BAG1 is not essential for cyst formation, but facilitates formation of cysts in vivo.

Introduction

The ubiquitous intracellular Apicomplexan parasite Toxoplasma gondii invades a wide variety of host species and cell types. Toxoplasma gondii is capable of invasion and unlimited asexual growth as a haploid form in almost any warm-blooded host cell. In humans, T. gondii infection can result in several syndromes including both congenital malformations in children exposed in utero and encephalitis in immunocompromised hosts. This parasite is a common opportunistic pathogen in patients with the acquired immunodeficiency syndrome (AIDS) (Luft and Remington, 1992). In addition to its clinical significance, T. gondii is an important model organism for the study of intracellular protozoan parasites, owing to its genetic accessibility and ease of culture (Roos et al., 1994; Boothroyd et al., 1995).

Toxoplasma gondii has three distinct life stages. Oocysts develop in feline intestines and are excreted into the environment where they represent a source of infection through contamination of food or water. Tachyzoites are a rapidly replicating form of this organism present during acute infection, which disseminate and are rapidly contained by the immune system. Tachyzoites then convert to bradyzoites that are present in tissue cysts. Bradyzoites are the source of food-borne transmission through the ingestion of meat from latently infected domestic animals. In addition, bradyzoites are the major cause of encephalitis in AIDS patients because of the conversion of encysted bradyzoites back to the cytolytic active tachyzoites. The mechanism of the intraconversion (i.e. differentiation) of the tachyzoite and bradyzoite stage of this parasite is an important avenue of investigation.

Previous studies have proven that both tachyzoites and bradyzoites express stage-specific antigens (Kasper, 1989; Tomavo et al., 1991; Weiss et al., 1992; Bohne et al., 1993; Zhang and Smith, 1995). Stage conversion has been studied in vitro using monoclonal antibodies (mAb) recognizing specific tachyzoite or bradyzoite antigens, and such studies have confirmed that such stage conversion is inducible (Soete et al., 1993; 1994; Bohne et al., 1994; Weiss et al., 1995). Analysis of stage conversion at the molecular level is important for understanding the mechanism of stage differentiation between tachyzoite and bradyzoite. Such an understanding may lead to the development of strategies for preventing reactivation of a chronic infection and cyst formation after an acute infection with T. gondii.

Recent reports suggest that the transition to bradyzoites is a stress-induced response (Weiss et al., 1995; Weiss et al., 1998). Bradyzoite induction is associated with increased hsp70 levels (Weiss et al., 1998) and induction of BAG1 expression (Bohne et al., 1995; Parmley et al., 1995). BAG1 is a 28/30 kDa bradyzoite cytoplasmic antigen that is similar to small heat shock proteins (HSPs) in plants (Bohne et al., 1995; Parmley et al., 1995). BAG1 gene expression seems to be regulated at the level of transcription during development (Bohne et al., 1995; Parmley et al., 1995). In the current study, we isolated BAG1 genomic clones and used these to disrupt T. gondii BAG1. Mice inoculated with the ‘knockout’ made cysts, however their cyst burden was significantly reduced (4- to 20-fold). Complementation of BAG1 restored cyst burden to that similar to wild-type parasites. These data suggest that BAG1 may function as part of a pathway to facilitate the transition from tachyzoite to bradyzoite forms.

Results

Disruption of T. gondii BAG1

The B5D/CAT plasmid was constructed by replacing exons 2, 3 and 4 with a cat expression cassette (Fig. 1). Approximately 15 kb of DNA from the BAG1 locus was included in the construct to increase the efficiency of gene targeting by homologous recombination. An efficient constitutive promoter region is provided in this construct by the 500 bp 5′ flanking sequences of the TUB1 gene (Fig. 1B), and CAT expression in tachyzoites during transient transfections was not suppressed by the presence of the BAG1 flanking sequences (data not shown).

Fig. 1.

Fig. 1

Open in a new tab

BAG1. The wild-type BAG1 gene has four exons and three introns. A genomic λDash BAG1 clone was NotI digested (sites from the vector) and subcloned into plasmid Bluescript SK+. This clone is referred to as Bg2 (A). Combined digestion with BstEII (labelled Bs in A) and AccIII (labelled A in A) deleted a 1.7 kb fragment containing exon 2, 3, 4 of BAG1, and recreated a new BstEII site after recirculation. The TUB1/CAT/SAG1 cassette was then inserted into BstEII site after Klenow treatment of both insert and vector. The resulting plasmid, B5D/CAT (B), was used for transformation of PLK tachyzoites. PCR primers 1 and 2 are in exons 1 and 2 and can only amplify the wild-type gene (A). Primers 3 and 4 span the CAT gene to downstream of exon 4 and can only amplify the deletion construct (B). Restriction map (C) of the Bg2 genomic clone shows the relative positions of BamHI (labelled B) and EcoRI (labelled E) sites as well as the NotI (N) and EcoRI (E) sites in the polylinker (p).

Genotype identification of bag1 knockout mutants and BAG1-complemented parasites

After transfection with B5D/CAT and chloramphenicol selection, 44 parasite clones were screened by PCR to discriminate the clones containing gene replacements (i.e. ‘knockouts’) from those that integrated without replacement of BAG1. Seven of the 44 transformants amplified only with primers 3 and 4 (B5D/CAT specific; Fig. 1B), but not with primers 1 and 2 (BAG1 specific; Fig. 1A), indicating that they were bag1 knockouts (H7, Fig. 2 and data not shown). Clones H7, a null mutant, and Y8, a control positive for cat and BAG1, were selected for additional studies.

Fig. 2.

Fig. 2

Open in a new tab

PCR analysis of ble transformants. H7 parasites were cloned after co-transfection with Bg2 and ROP1/ble and three rounds of phleomycin selection. Genomic DNA from clones E5 and A12 was PCR amplified with BAG1-specific primer pair P1/P2 (A; labelled BAG1), with ble forward and reverse primers (B; labelled Ble) and with B5D/CAT deletion construct-specific primer pair P3/P4 (C; labelled CAT). DNA from wild-type PLK strain parasites (labelled P) and plasmids ROP1/ble (labelled Ble), Bg2 and B5D/CAT were used as controls. S indicate the 1 kb DNA standards (Gibco/BRL; A and C) or 100 bp DNA standards (Gibco/BRL; B).

H7 parasites were complemented with BAG1 by co-transfection of Bg2, the BAG1 genomic clone (Fig. 1A), with a ROP1/ble expression plasmid (Soldati et al., 1995). PCR analysis revealed that 12 of 27 H7 clones surviving phleomycin selection were complemented with BAG1 (A12, Fig. 2 and data not shown). Clone A12, which was positive in PCR for BAG1, ble and the B5D/CAT construct, was chosen for phenotype analysis. Clone E5, positive for cat and ble but negative for BAG1, was used as a control.

To confirm deletion of BAG1, DNA from H7 was digested with EcoRI and examined by Southern analysis using BAG1 exon 4 and cat probes. The DNA from the PLK strain, the BAG1 genomic plasmid Bg2 and the B5D/CAT plasmid were digested and analysed in the same experiment for comparison. The results shown in Fig. 4 demonstrate that the PLK strain has a single 11 kb EcoRI fragment encompassing the BAG1 coding region (Fig. 3A) but has no CAT gene hybridization (Fig. 3B). EcoRI restriction of the mutant clone H7 yield a 2.5 kb fragment containing the CAT gene (Fig. 3B; a second 300 bp hybridizing band has run off the gel), but no BAG1 band (Fig. 3A).

Fig. 4.

Fig. 4

Open in a new tab

Western blot analysis of in vitro cultures of T. gondii clones H7 (bag1 knockout), A12 (BAG1-complemented H7) and wild-type strain ME49. Parasites were grown in pH8.1 media to induce bradyzoite antigen expression as indicated in experimental procedures. Parasite lysates were electrophoresed on 12% SDS–PAGE gels and transferred onto nitrocellulose. Blots were reacted with antibodies against BAG1 antigen (anti-rBAG1 or mAb 74.1.8; A), cyst wall antigen P116 (mAb 73.18; l B) and cyst matrix antigen P65 (polyclonal anti rMAG1; C).

Fig. 3.

Fig. 3

Open in a new tab

Southern blot analysis. Genomic DNA from chloramphenicol-resistant bag1 knockout clone H7 and wild-type PLK strain (labelled P) of T. gondii were digested with EcoRI and separated on a 0.8% agarose gel and transferred to a nylon membrane. BAG1 plasmid Bg2 and BAG1 deletion plasmid B5D/CAT were used as controls. The membrane was hybridized with cat probe (B), then stripped, and rehybridized with BAG1 exon 4 probe (A). Lambda HindIII-digested molecular weight markers are labelled S. Genomic DNA from PLK, H7 (bag1 knockout), A12 (H7 complemented with BAG1), E5 (H7 ble positive, but not complemented with BAG1) and Y8 (cat and BAG1 positive) was digested with BamHI and hybridized with the BAG1 exon 3/4 probe (C). The membrane was stripped and rehybridized with TPK3 probe (D). Lambda HindIII-digested molecular weight markers are labelled S.

DNA from clones H7, Y8, A12 and E5 were compared with PLK in BamHI digests probed with a BAG1 exon 3/4 probe (Fig. 3C). The BAG1 fragment in Y8 was larger than that in PLK (because of loss of a BamHI site), indicating that B5D/CAT integrated into the BAG1 locus without replacement of BAG1. The BAG1 fragment from A12, the BAG1-complemented strain, was similar to PLK in size, as expected (Fig. 3C; see map Fig. 1C). E5 DNA did not hybridize to the exon 3/4 BAG1 probe (Fig. 3C). Comparison of hybridization intensity of BAG1 (Fig. 3C) with that of the single-copy gene TPK3 (Fig. 3D; Qin et al., 1998) indicated that a single copy of BAG1 had integrated into the A12 genome. (This was confirmed by densitometric analysis of the hybridization bands.) A12 was cat positive by PCR (Fig. 2) and Southern analysis (data not shown), indicating that complementation had occurred without replacement of cat.

In vitro expression of bradyzoite antigens by the bag1 knockout

H7 was further characterized by testing the expression of bradyzoite antigens in vitro. To confirm that upon deletion of BAG1 the BAG1 protein is no longer present, Western blot analysis of induced in vitro cultures was performed. Lysates from H7 and ME49 parasites (PLK is a clone of ME49) were probed with rabbit anti-rBAG1 antibody (McAllister et al., 1996) and anti-BAG1 mAb 74.1.8 (Weiss et al., 1992) (Fig. 4A). The BAG1 band (28 kDa) was absent from H7 parasites. As expected, ME49 and A12 expressed BAG1 (Fig. 4A).

H7 still expressed other bradyzoite/cyst specific antigens such as P116, a cyst wall antigen, (mAb 73.18; Weiss et al., 1992; Fig. 4B) and MAG1, a matrix antigen, (rabbit antirecombinant MAG1; Parmley et al., 1994; Fig. 4C) at levels similar to wild-type ME49. Similar results were obtained when sodium nitroprusside, a nitric oxide donor, was used to induce bradyzoite antigen expression (data not shown).

In vivo cyst formation by the bag1 knockout and BAG1-complemented strain

To determine whether in vivo cyst formation could occur in the strain lacking BAG1, H7 tachyzoites were injected intraperitoneally into mice. Y8, A12, E5 and PLK were inoculated in parallel. Eight to 9 weeks after infection, cysts were isolated from the brains. All strains made cysts. H7 cysts were morphologically indistinguishable from wild-type cysts (Fig. 5A). Cysts from H7 and PLK were compared in immunofluorescent assay (IFA). H7 cysts were not stained with BAG1 mAb 74.1.8 (Fig. 5B), confirming that H7 does not express the BAG1 antigen. H7 cysts expressed bradyzoite cyst specific antigens P116 and P29 (Fig. 5C and D respectively) as well as MAG1 (data not shown). Expression of these other bradyzoite antigens was similar to that seen in PLK/ME49 (Parmley et al., 1994; Zhang and Smith, 1995; Halonen et al., 1998). A12 BAG1 staining (Fig. 5F and G) was similar to that of PLK (Fig. 5E). IFA performed on in vitro cysts agreed with in vivo IFA (data not shown).

Fig. 5.

Fig. 5

Open in a new tab

In vivo cyst expression of bradyzoite antigens. Tissue cysts were found in bag1 knockout H7-infected mouse brain (A). H7 cysts were labelled with anti-BAG1 mAb 74.1.8 sera (B), anticyst wall antigen P116 mAb 73.1.8 (C), and anticyst matrix antigen P29 mAb E7B2 (D). PLK cysts (E) and A12 cysts (F and G) were also labelled with anti-BAG1 mAb 74.1.8. G illustrates cytoplasmic localization of BAG1 in A12 bradyzoites that have ruptured out of a cyst.

Parasites released from H7 brain cysts were able to infect HFF cells, and in vitro cultures appeared morphologically indistinguishable from PLK. H7 brain cysts were also able to infect mice and produce cysts in these mice. PCR analysis demonstrated parasites from H7 brain cyst cultures and from the original H7 parasites inoculated into the mice had the same knockout construct (data not shown).

Efficiency of in vivo cyst formation

Although H7 still forms tissue cysts, the number of cysts from H7-infected mice was significantly reduced compared with the PLK or Y8 strains. Data from three independent experiments were pooled and are presented in Table 1. The knockout produced significantly fewer cysts in mice. When infected with 1 × 105 to 2 × 105 parasites per mouse, the mean number of cysts per brain from H7-infected mice was 23 ± 4.3, compared with 132 ± 27 with wild-type PLK-infected mice and 107 ± 1.6 for Y8-infected mice. In the infection with 6 × 105 parasites per mouse, H7 produced less than 20 cysts per mouse brain, whereas Y8 produced over 200 cysts per mouse brain. The difference in cyst number between Y8 and PLK was not statistically significant. The difference in cyst number between H7 and Y8 or PLK was statistically significant (P < 0.005).

Table 1.

In vivo cyst development of bag1 knockout strain.

Parasites
per mouse		 PLK Y8 H7
1–2 × 105 132 ± 27 (7) 107 ± 1.6a (11) 23 ± 4.3b (15)
6 × 105 ND 264 ± 26.7 (9) 18 ± 1.9c (13)
Open in a new tab

Average number of cysts per animal ± standard error of the mean. Numbers in parentheses indicate number of animals; group size varies due to deaths in some of the groups.

a

P-value versus PLK not significant.

b

P-value versus PLK < 0.0001; P-value versus Y8 < 0.005.

c

P-value versus Y8 < 0.0001.

ND, not done.

H7 parasites recovered from cysts, grown in tissue culture, and injected into mice continued to generate low numbers of cysts. Owing to the low numbers of cysts made by H7, experiments to determine the cyst burden of animals infected with H7 cysts rather than H7 tachyzoites were not performed.

The difference in cyst formation did not appear to be due to a difference in growth. The growth rate of H7, PLK and Y8 parasites in HFF was compared in vitro using [3H]-uracil incorporation (Pfefferkorn and Pfefferkorn, 1977a). H7 grew at a rate similar to PLK (Fig. 6A). Y8 grew more slowly than both H7 and PLK, despite behaving similarly to PLK in vivo. When parasites were grown in sodium nitroprusside, a nitric oxide donor that induces bradyzoite formation (Bohne et al., 1994), all three strains grew at a similar rate (Fig. 6B).

Fig. 6.

Fig. 6

Open in a new tab

Growth of H7, Y8 and PLK strains. Parasites were grown and labelled with [3H]-uracil as indicated in Experimental procedures. Parasites were harvested every 24 h. Total uracil incorporation is indicated on the y-axis after subtraction of counts obtained from uninfected HFF. The error bars indicate standard error of the mean.

A. Uracil incorporation (counts are a multiple of 103) of PLK (■), H7 (●) and Y8 (▲).

B. Uracil incorporation (counts are a multiple of 102) of PLK (■), H7 (●) and Y8 (▲) with 50 µM sodium nitroprusside (SNP) added 16 h after inoculation of plates.

In vivo virulence of the H7 mutant, as assayed by mortality in infected mice, was reduced compared with the PLK and Y8 strains. The LD100 for PLK and Y8 was ≈ 2 × 106 parasites compared with 5 × 107 parasites for H7 (LD100 experiments were performed with a minimum of 10 animals per dose tested). Time to death was not significantly different for PLK (8.0 ± 0.8 days) and Y8 (7.2 ± 0.4 days) but was prolonged for H7 (17.2 ± 1.2 days, P < 0.05).

Cyst formation by BAG1-complemented H7 parasites

We tested whether BAG1 rescue of H7 would restore wild-type cyst formation. bag1 knockout H7, BAG1-complemented strain A12 and control clone E5 (H7 with cat and ble) were inoculated into mice by peritoneal injection. Groups of mice were injected with 2 × 105 or 6 × 105 parasites. At 5 weeks after infection, tissue cysts were purified from mouse brain.

In two independent experiments, the number of cysts found in A12-infected mouse brain was significantly greater than that found in H7-infected mouse brain. Data from a representative experiment are presented in Table 2. As expected, E5, an uncomplemented clone obtained from the same transfection as A12, behaved similarly to H7. The difference in cyst number between H7 or E5 and A12 was statistically significant (P < 0.001). LD100 for A12, as for H7, was 5 × 107 parasites. Although the time to death of H7 (17.2 ± 1.2 days) was not significantly different from that of A12 (15.5 ± 0.3 days) the trend was towards an earlier time to death in A12, such as that seen with PLK (8.0 ± 0.8 days). At sublethal inocula, mice inoculated with A12 became clinically ill (ruffled fur, decreased activity), but survived, whereas H7 and E5 mice showed no evidence of clinical infection.

Table 2.

In vivo cyst development of BAG1-complemented knockout strain.

Parasites
per mouse		 H7 A12 E5
2 × 105   4.8 ± 1.0 (5)   99.2 ± 8.2a (5)   4.0 ± 4.0 (4)
6 × 105 25.3 ± 3.8 (5) 140.8 ± 12.0b (5) 16.0 ± 2.4 (4)
Open in a new tab

Average number of cysts per animal ± standard error of the mean. Numbers in parentheses indicate number of animals.

a

P-value versus H7 < 0.001; P-value versus E5 < 0.001.

b

P-value versus H7 < 0.001; P-value versus E5 < 0.001.

Discussion

The tachyzoite stage of T. gondii, which causes acute infection, is normally controlled by the onset of the specific immune response in the immunocompetent host. The parasite is able to persist in infected hosts by differentiation to bradyzoite forms that are presumably protected by formation of the cyst wall. There is no effective antibradyzoite drug, and therefore one is not able to cure patients with chronic or asymptomatic infection. The bradyzoite/cyst stage represents a lifetime risk for reactivation in immunocompromised individuals. Therefore, further molecular understanding of the process of bradyzoite differentiation is of paramount importance.

In this study, we successfully disrupted BAG1, proving that this bradyzoite-specific gene is not essential. Because parasites lacking BAG1 can still express cyst-specific proteins and form tissue cysts in vivo, our studies indicate that the BAG1 gene is not required for cyst formation.

Although BAG1 is not essential, lack of BAG1 significantly reduced the efficiency of cyst formation in mice. That BAG1 knockout cannot block cyst formation in mouse brain implies that the BAG1 is not a trigger for bradyzoite differentiation. This does not mean BAG1 has no role in stage differentiation. The capacity to convert from tachyzoite to bradyzoite is key for T. gondii persistence in the host, and thus it is likely that multiple genes with redundant functions are involved in this process. It is of interest that BAG1 homologues that do not appear to be bradyzoite specific were identified in the EST sequencing project (http://daphne.humgen.upenn.edu:1024/toxodb/ver_2/toxodb.html). It is possible that these homologues might be able to partially compensate for lack of BAG1.

Despite differences in cyst burden between H7 and PLK, these parasites did not exhibit differences in growth rate in tissue culture. Y8 grew more slowly in tissue culture, but behaved similarly to PLK in animals, illustrating an imperfect correlation between in vitro growth rate and in vivo dissemination and virulence. H7 was less virulent in mice than Y8 or PLK, however this difference was not complemented by restoration of BAG1. Therefore, it seems unlikely that the difference in cyst burden reflects only differences in the severity of acute disease.

Because the reduction in cyst burden observed with disruption of BAG1 was reversed by restoration of BAG1 expression, it appears that BAG1 influences the efficiency of cyst formation in vivo. This is consistent with data from other systems where small HSPs are known to be associated with response to stress and regulation of differentiation events (Morimoto et al., 1994). In plants, seed formation is associated with the induction of small HSPs (Arrigo and Landry, 1994). Similarly in Drosophila, hsp27, hsp26 and hsp22 are expressed in a tissue-specific manner during differentiation (Arrigo and Landry, 1994).

Experiments by Bohne et al. (1998) corroborate our finding that BAG1 is not essential for cyst formation. A difference in cyst number was not noted by these investigators between parasites lacking BAG1 and the parent line. There are several differences between our experiments and those of Bohne et al. that might explain why our bag1 knockout exhibited decreased cyst formation. We elected to look at natural survivors of infection because it was not clear what effect sulphadiazine treatment (which allows animals to survive a lethal inoculum of T. gondii) would have upon the course of infection or cyst burden. Several antibiotics, including sulphadiazine (Gross and Pohl, 1996), pyrimethamine (Bohne et al., 1994) and atovaquone (Tomavo and Boothroyd, 1995), have been reported to induce bradyzoite antigen expression. It is possible that the use of sulphadiazine in the cyst induction protocol of Bohne et al. (1998) influenced the efficiency of cyst formation.

The cyst burden generated by T. gondii is influenced by multiple factors including the genetic background of both the host (Hunter et al., 1996; McLeod et al., 1996) and the parasite (Darde, 1996; Sibley and Howe, 1996). The genetic background of parasites used for disruption of BAG1 was different. Our experiments were performed with an ME49 clone PLK, whereas Bohne et al. used the hypoxanthine xanthine guanine phosphoribosyl transferase (HXGPRT)-deficient PLK derivative. Although there are no apparent differences between HXGPRT-deficient PLK and PLK (Bohne et al., 1998), it is possible that there are uncharacterized differences in bradyzoite differentiation between HXGPRT-deficient PLK and PLK in vivo. For example, the uracil phosphoribosyl transferase (UPRT)-deficient RH strain, unexpectedly, is highly susceptible to bradyzoite differentiation under conditions of CO2 starvation (Bohne et al., 1997).

Although derivatives of the same clonal line, the parent parasites used in our experiments and by Bohne et al. behaved quite differently in vivo. The LD100 of our PLK clone and the HXGPRT-deficient PLK strain were significantly different (2 × 106 versus < 104; Bohne et al., 1998) Our experiments used CD1 mice, an outbred mouse strain, whereas Bohne et al. used C57BL/6, an inbred strain that is highly susceptible to both death from acute infection and generation of high numbers of cysts (McLeod et al., 1989). In mice, susceptibility to acute infection and generation of cysts are independently inherited and linked to at least five separate genes (McLeod et al., 1996; McLeod et al., 1989). Outbred strains are, in general, more resistant to acute infection with T. gondii and generation of large cyst burdens. Non-human primates (Kasper and Boothroyd, 1993), and probably humans, appear to have a degree of innate resistance to both acute and chronic infection with T. gondii and behave more similarly to outbred mice (McLeod et al., 1984).

Anecdotal data from T. gondii suggest that both the acute virulence and the efficiency of cyst formation are influenced also by the number and frequency of passages in tissue culture or in animals (Dubey et al., 1998). Sibley and Howe (1996) have noted that the LD50 of ME49/PLK decreases from > 105 to 102 with continued tissue culture passage after isolation from chronic infection. We have noted that with prolonged passage in tissue culture, the efficiency of spontaneous cyst production in vivo and in vitro declines but is restored after passage through mice (Weiss laboratory, unpublished). To control our experiments and ensure that our results were not an artefact of difference in propagation conditions, all lines were passaged in parallel throughout the course of these experiments. We passaged PLK through mice before the onset of these experiments to ensure that it was capable of efficient cyst formation before the generation of recombinant parasites. The genotype of T. gondii strains is stable over many years of tissue culture and animal passage (Sibley and Boothroyd, 1992; Howe and Sibley, 1995). Therefore epigenetic factors are likely to affect parasite gene expression and phenotype and may influence experimental results.

Although a number of heat shock proteins are associated with differentiation in a variety of species, their exact function remains to be determined. Some small HSPs are thought to function as molecular chaperones (Arrigo and Landry, 1994). Because BAG1 is a bradyzoite-specific homologue of small HSPs, one can postulate that BAG1 may facilitate some aspect of cystogenesis by acting in analogous pathways. In a similar fashion, hsp70 family members are induced during bradyzoite differentiation (Weiss et al., 1998). Our bag1 knockout should be useful in the identification of additional genes that regulate the stage conversion by facilitating additional bradyzoite-specific gene knockouts in this ‘new’ genetic background. In addition, further studies on this knockout may help to elucidate the function of BAG1.

Experimental procedures

Parasite and tissue culture

Toxoplasma gondii PLK strain, a clonal derivative of the primary sheep isolate ME49 (Kasper and Ware, 1985), was used as the strain throughout this project. PLK was inoculated intraperitoneally into three CD1 mice and tissue cysts purified by isopycnic centrifugation as previously described from these mice 6 weeks after infection (Cornelissen et al., 1981; Weiss et al., 1992). These tissue cysts (10 cysts per mouse) were treated with 0.1% trypsin for 1min and inoculated into human foreskin fibroblast (HFF) cells (ATCC CCD-27SK).

Parasites were maintained by serial passage in confluent monolayers of HFF cells grown in Dulbecco’s modified eagle medium (DMEM, Gibco) supplemented with 10% foetal bovine serum (Gibco) and 1% penicillin–streptomycin. Transfected and untransfected parasites were maintained in serial passage, so that passage number was identical for control and transfected parasites. Toxoplasma gondii were released by lysis followed by passage through 23- and 26-gauge needles. Tachyzoites were purified from the host cell material by passage through a 3.0-µm-pore Nucleopore filter.

Isolation of a BAG1 genomic DNA clone

A PLK strain T. gondii genomic DNA library in λDASH phage vector was obtained from the NIH Reagent Depository (catalogue no. 2863). A bradyzoite-specific cDNA clone of the BAG5 antigen was isolated previously (Parmley et al., 1995) and found to be identical to the BAG1/hsp30 antigen identified by Bohne et al. (1995). An EcoRI fragment of the BAG1 cDNA pGEX-3X clone (Parmley et al., 1995) was labelled by random priming with digoxigenin-11-dUTP. Genomic clones were isolated from the λDASH library using an optimized digoxigenin hybridization protocol. (Engler-Blum et al., 1993). DNA from plaque-purified clones was analysed by Southern blotting and NotI-digested fragments from three genomic clones (sites from the vector) were subcloned into Bluescript KS+. After restriction endonuclease mapping, clone Bg2 was chosen for further experiments.

BAG1 deletion plasmid construction

The 16 kb genomic clone Bg2 was digested by restriction enzymes Bst EII and Acc III to remove a 1.7 kb fragment containing exons 2, 3, 4 of BAG1. The Bst EII site was recreated after gel purification and ligation (recircularization) of the vector fragment (plasmid Bg2D234). The pT230/CAT plasmid containing a TUB1 promoter upstream of the AUG start codon of cat and the SAG1 3′ sequence downstream of the stop codon (Soldati and Boothroyd, 1993) was digested with Hin dIII and BamHI and treated with Klenow to create blunt ends. The resultant 1.4 kb SAG1/CAT/TUB1 fragment was inserted into Bg2D234, which had been digested with Bst EII and treated with Klenow. This resulted the B5D/CAT plasmid (see Fig. 1). PCR analysis revealed that in B5D/CAT cat was in the same orientation as BAG1.

Creation of the BAG1 knockout

Stable transformants were created as previously described (Kim et al., 1993). Extracellular PLK strain parasites (1 × 107) were transfected with 60 µg of Not I-digested B5D/CAT plasmid by electroporation using a BTX Electro Cell Manipulator 600, charging voltage 2.0 kV and a resistance of 48 ohm (Soldati and Boothroyd, 1993). After transfection parasites were inoculated onto confluent monolayers of HFF. One day after transfection, chloramphenicol was added to the culture at a final concentration of 40 µM. Previous titration experiments had determined that 40 µM chloramphenicol allowed no detectable growth of wild-type parasites. CAT activity was monitored by TLC assay using the Fast CAT Chloramphenicol Acetyltransferase Assay Kit (Molecular Probes) to confirm the transfection and selection. After 3 weeks, the chloramphenicol-resistant mutant parasites were cloned by limiting dilution in 96-well microtitre plates containing HFF cells. Approximately 7 days after infection, parasite plaques were visible by light microscopy, and wells containing single plaques were transferred into T25 flasks containing HFF cells.

Complementation of T. gondii bag1 knockout mutant using phleomycin selection

Complementation of H7 parasites with BAG1 was performed by co-transfecting the Bg2 genomic clone with Ble expression plasmid ROP1/ble. This plasmid contains a 375 bp Shble NsiI/PacI cassette (Soldati et al., 1995), 1.2 kb of ROP1 upstream sequence including the promoter region and 300 bp of SAG1 downstream sequence (Soldati and Boothroyd, 1993). Restriction enzyme-mediated integration was used in co-transfection to increase the efficiency of transfection (Black et al., 1995). The T. gondii H7 parasites were harvested from culture upon lysis of the HFF cells and co-transfected with 10 µg of ROP1/ble and 100 µg of Bg2. One hundred units (10 µl) of restriction enzyme NotI was added into the electroporation cuvette containing the parasites and DNAs immediately before electroporation. The parasites were transferred back to HFF cells after electroporation.

Upon lysis of the host cells, the culture was forced through 23G, 26G and 27G needles sequentially, and then filtered through a 3.0 µm Nucleopore membrane to ensure that all the parasites were extracellular. The suspension of parasites was adjusted to 10 µg ml−1 phleomycin (Sigma, USA) and incubated at 37°C for 10–12 h. These parasites were transferred to HFF cultures containing 10 µg ml−1 phleomycin. After three rounds of selection, the phleomycin-resistant parasites were subcloned by limited dilution in a 96-well microtitre plate containing HFF cells.

A total of 27 single parasite clones were isolated and transferred to 24-well plates containing HFF cells. DNA was prepared from parasites for analysis by PCR.

Genotype analysis by PCR

Genomic DNA was extracted from parasites purified from flasks. The parasites were harvested upon lysis of the host cells, passed through 23-, 26- and 27-gauge needles sequentially and purified from host cell material by further passage through a 3.0 µm Nucleopore filter. After washing in phosphate-buffered saline (PBS), parasites were resuspended in 100 µl of PBS, freeze–thawed for four cycles and then incubated in 5 vols of DNA lysis solution (120mM NaCl, 10mM EDTA, 25mM Tris-HCl pH 7.5 or 8.0, 1% Sarkosyl, 0.1mg ml−1 RNAse) for 30 min at 37°C followed by the addition of proteinase K (1 mg ml−1) and incubation at 55°C for at least 2 h or overnight. The solution was then extracted sequentially with phenol, phenol–chloroform–isoamylacohol (25: 24:1) and chloroform followed by precipitation by adding an equal volume of isopropanol and centrifugation at 16 000 × g for 15 min. The isolated DNA was resuspended in TE buffer (10mM Tris-HCl, pH 7.8, 1mM EDTA).

PCR was used to genotype potential knockout clones obtained by limiting dilution. Primers were designed to distinguish those clones containing gene replacements (knockouts) from those containing BAG1. Primers 1 (GGCCTCACTCACATTTCTCAT) and 2 (AGGGTAGTACGCCAGAGCA) amplify a 762 bp fragment between exon1 and exon 2 of the BAG1. Primers 3 (GTATGGCAATGAAAGACG) and 4 (CATACCTTTCTCGTGGAA) amplify a 962 bp fragment from the cat to the end of BAG1 downstream of exon 4. The PCR was performed using the Perkin-Elmer kit of GeneAmp PCR Core Reagents with 5 pmol of each primer and 2.5mM MgCl2 in each 100 µl reaction. Reactions were heated to 94°C for 10 min followed by the addition of Taq DNA polymerase and 35 cycles at 94°C for 1 min; 68M (for primers 1 and 2) or 62°C (for primers 3 and 4) for 1 min and 72°C for 1 min followed by a final incubation at 72°C for 10 min Plasmids B5D/CAT, Bg2 and PLK DNA were used as controls.

DNA from clones surviving phleomycin selection was analysed by PCR using the primer pairs above and primers ble forward (CGGATGCATAAGTTGACCAGTGCCGTTC) and reverse (CGGTTAATTAATCCTGCTCCTCGGCCAC) (Soldati et al., 1995) to amplify the 375 bp ble cassette.

Southern blot analysis

For Southern blotting, 10 µg of total genomic DNA from Toxoplasma PLK or chosen recombinant parasite clones were digested with EcoRI or BamHI, separated on 0.8% agarose gel and transferred onto a positively charged nylon membrane by capillary transfer.

The 1.7 kb exon 2 to exon 4 region of BAG1 was obtained by digestion of the Bg2 plasmid with AccIII and BstEII followed by gel purification. This fragment was further digested with AflIII to obtain a 448 bp exon 4 BAG1 probe. In some experiments, the 1.7 kb AccIII/BstEII fragment was digested with AvaI and AvaII to obtain a 956 bp exon 3/4 fragment of BAG1. The 600 bp cat fragment was prepared by NsiI and PacI digestion of the pT230/CAT plasmid followed by gel purification. Probes were randomly labelled with digoxigenin-dUTP (DIG) using the DIG High Prime Labeling Kit (Boehringer Mannheim). The 2.4 kb TPK3 probe was prepared by PCR from a cDNA clone (Qin et al., 1998).

Southern hybridization was carried out at 42°C for at least 6 h using heat-denatured DIG exon 3/4 or exon 4 probe using the DIG-Easy Hybe reagent (Boehringer Mannheim). Washes were performed at 68°C with washing buffer (20mM Na2HPO4, pH 7.2, 1 mM EDTA, 1% SDS) three times for 20 min each. Anti-DIG alkaline phosphate conjugate and its chemiluminescent substrate CSPD or colour substrate NBT/BCIP were used for signal detection using the DNA Genius system (Boehringer Mannheim). Membranes were stripped after detection and reprobed with the cat probe or the TPK3 probe.

In vivo bradyzoite/cyst formation

Groups of five 6- to 8-week-old CD1 outbred female mice (Jackson Laboratories) were inoculated with stains PLK, H7 (bag1 knockout), Y8 (cat and BAG1 positive), A12 (H7 complemented with BAG1) or E5 (ble positive non-complemented H7) by intraperitoneal injection. Mouse brains were harvested at 6–8 weeks after infection. Cysts were purified by isopycnic centrifugation as previously described (Cornelissen et al., 1981; Weiss et al., 1992). After resuspension of cysts in PBS in a final volume of 1 ml, 10 50 µl aliquots were counted under inverted phase microscopy.

LD100 experiments were conducted with a minimum of 10 mice per inoculum tested.

Statistical analysis was performed using sigmastat v 1.03 (Jandel Scientific) using either parametric (i.e. Student’s t-test) or non-parametric (Mann–Whitney rank sum) tests based upon the normality of the data sets.

Western blot

Toxoplasma gondii wild-type PLK (or ME49), H7, Y8 and A12 parasites grown in pH 8.1 media to induce bradyzoite expression (Weiss et al., 1995) were purified from tissue culture as described above and then freeze–thawed for four cycles. Samples were then placed in gel sample buffer under denaturing conditions with 1% β-mercaptoethanol and heated to 100°C for 3 min. The parasite lysates were separated on a 12% SDS–polyacrylamide gel and then transferred onto nitrocellulose membrane. Rabbit anti-rBAG1 (called rBAG5 in McAllister et al., 1996) and monoclonal 74.1.8 against BAG1 (Weiss et al., 1992) were used in blot detection. Antibodies against other bradyzoite or cyst antigens such as P116 (mAb 73.18; Weiss et al., 1992) and MAG1 (rabbit anti-rMAG1 or P65; Parmley et al., 1994) were also used. Primary antibodies were diluted 1:500 or 1:1000. The Western Light Kit (Tropix) was used for detection using an alkaline phosphatase secondary antibody (diluted 1:10 000) and CSPD chemiluminescence reagent to visualize the antibody.

Immunofluorescence

For the IFAs, the purified cysts were air dried onto glass slides, fixed with 2% formaldehyde in PBS for 30 min, and blocked in 1% bovine serum albumin (BSA). Cells were permeabilized with 0.2% Triton X-100 or Saponin 0.05%. Slides were then incubated with primary antibodies: rabbit anti-rBAG1 or mouse mAb 74.1.8 (anti-BAG1), mAb 73.18 (anticyst wall antigen P116) and mAb E7B2 (anticyst matrix antigen P29; Zhang and Smith, 1995). Antibodies (monoclonals diluted 1:25 to 1:50; polyclonal diluted 1:100) were incubated for 60 min at 37°C, washed in PBS, and incubated with anti-mouse or anti-rabbit IgG secondary antibody Texas red at 37°C for 60 min (diluted 1:50 to 1:100; Organon Technica). For double labelling, anti-rabbit IgG fluoroscein and anti-mouse IgG Texas red were used. The slides were mounted with 2.5% DABCO (1,4-diazabicyclo[2.2.2] octane) in Mounting Solution [Mcllvaine’s buffer–glycerol (1:1), Sigma], and examined by fluorescence microscopy.

Measurement of growth rate in culture

Because uracil is specifically incorporated into the nucleic acids of T. gondii rather than host cells, [3H]-uracil incorporation reflects parasite growth (Pfefferkorn and Pfefferkorn, 1977b). Twelve-well tissue culture plates with confluent HFF were used for each time point with each assay performed in triplicate. Lysed cultures of PLK, H7 and Y8 parasites were passed through 23- and 26-gauge needles, counted and inoculated at 103–104 parasites per well. Plates were then incubated at 37°C. When used, sodium nitroprusside (SNP) was added to a final concentration of 50 µM 16 h after inoculation of plates.

The first time point was harvested 24 h after inoculation (6 h after SNP). Plates were harvested every 24 h for 4 days. For each time point, plates were washed in prewarmed PBS. One millilitre of medium containing 2 µCi ml−1 of [3H]-uracil was added per well followed by incubation at 37°C for 6 h. The medium was then removed, the plates placed on ice and cells lysed in 1% (w/v) sodium dodecylsulphate (SDS) containing 100 µg ml−1 unlabeled uracil in PBS. Nucleic acids were precipitated with 10% trichloroacetic acid (TCA) on ice for 2 h. The contents of each well were transferred to glass fibre filters on a suction apparatus, washed with 5% TCA, with ethanol and dried. Filters were placed in scintillation fluid and 3H counts measured.

Acknowledgements

We thank Wolfgang Bohne and David Roos for discussion and exchange of data before publication, Arturo Casadevall for review of the manuscript, and members of the Kim and Weiss laboratories for helpful suggestions. This study was supported by NIH Grants AI39454 (LMW) and AI07501 (YWZ). K.K. is a Burroughs Wellcome New Investigator in Parasitology.

References

  1. Arrigo A, Landry J. Expression and function of the low-molecular-weight heat shock proteins. In: Morimoto R, Tissieres A, Georgopoulos C, editors. The Biology of Heat Shock Proteins and Molecular Chaperones. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1994. pp. 335–373. [Google Scholar]
  2. Black M, Seeber F, Soldati D, Kim K, Boothroyd JC. Restriction enzyme-mediated integration elevates transformation frequency and enables co-transfection of Toxoplasma gondii. Mol Biochem Parasitol. 1995;74:55–63. doi: 10.1016/0166-6851(95)02483-2. [DOI] [PubMed] [Google Scholar]
  3. Bohne W, Gross U, Ferguson DJ, Heesemann J. Cloning and characterisation of a bradyzoite-specifically expressed gene (hsp30/bag1) of Toxoplasma gondii, related to genes encoding small heat-shock proteins of plants. Mol Microbiol. 1995;16:1221–1230. doi: 10.1111/j.1365-2958.1995.tb02344.x. [DOI] [PubMed] [Google Scholar]
  4. Bohne W, Heesemann J, Gross U. Induction of bradyzoite-specific Toxoplasma gondii antigens in gamma interferon-treated mouse macrophages. Infect Immun. 1993;61:1141–1145. doi: 10.1128/iai.61.3.1141-1145.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bohne W, Heesemann J, Gross U. Reduced replication of Toxoplasma gondii is necessary for induction of bradyzoite-specific antigens: a possible role for nitric oxide in triggering stage conversion. Infect Immun. 1994;62:1761–1767. doi: 10.1128/iai.62.5.1761-1767.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bohne W, Wirsing A, Gross U. Bradyzoite-specific gene expression in Toxoplasma gondii requires minimal genomic elements. Mol Biochem Parasitol. 1997;85:89–98. doi: 10.1016/s0166-6851(96)02814-9. [DOI] [PubMed] [Google Scholar]
  7. Bohne W, Hunter CA, White MW, Ferguson DJP, Gross U, Roos DS. Targeted disruption of the bradyzoite-specific gene BAG1 does not prevent tissue cyst formation in Toxoplasma gondii. Mol Biochem Parasitol. 1998;92:291–301. doi: 10.1016/s0166-6851(97)00236-3. [DOI] [PubMed] [Google Scholar]
  8. Boothroyd J, Black M, Kim K, Pfefferkorn E, Seeber F, Sibley L, Soldati D. Forward and reverse genetics in the study of the obligate intracellular parasite Toxoplasma gondii. In: Adolph K, editor. Methods in Molecular Genetics. Vol 6B. New York: Academic Press; 1995. [Google Scholar]
  9. Cornelissen A, Overdulve J, Hoenderboom J. Separation of Isospora (Toxoplasma) gondii cysts and cystozoites from mouse brain by continuous density-gradient centrifugation. J Parasitol. 1981;83:103–108. doi: 10.1017/s0031182000050071. [DOI] [PubMed] [Google Scholar]
  10. Darde M. Biodiversity in Toxoplasma gondii. Curr Top Microbiol Immunol. 1996;219:27–41. doi: 10.1007/978-3-642-51014-4_3. [DOI] [PubMed] [Google Scholar]
  11. Dubey J, Lindsay D, Speer C. Structures of Toxoplasma gondii tachyzoites, bradyzoites and sporozoites and biology and development of tissue cysts. Clin Microbiol Rev. 1998;11:267–299. doi: 10.1128/cmr.11.2.267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Engler-Blum G, Meier M, Frank J, Muller G. Reduction of background problems in nonradioactive Northern and Southern blot analysis enables higher sensitivity than 32P-based hybridisation. Anal Biochem. 1993;210:235–244. doi: 10.1006/abio.1993.1189. [DOI] [PubMed] [Google Scholar]
  13. Gross U, Pohl F. Influence of antimicrobial agents on replication and stage conversion of Toxoplasma gondii. Curr Top Microbiol Immunol. 1996;219:235–245. doi: 10.1007/978-3-642-51014-4_21. [DOI] [PubMed] [Google Scholar]
  14. Halonen SK, Weiss LM, Chiu FC. Association of host cell intermediate filaments with Toxoplasma gondii cysts in murine astrocytes in vitro. Int J Parasitol. 1998;28:815–823. doi: 10.1016/s0020-7519(98)00035-6. [DOI] [PubMed] [Google Scholar]
  15. Howe DK, Sibley LD. Toxoplasma gondii comprises three clonal lineages: correlation of parasite genotype with human disease. J Infect Dis. 1995;172:1561–1566. doi: 10.1093/infdis/172.6.1561. [DOI] [PubMed] [Google Scholar]
  16. Hunter C, Suzuki Y, Subauste C, Remington J. Cells and cytokines in resistance to Toxoplasma gondii. Curr Top Microbiol Immunol. 1996:113–125. doi: 10.1007/978-3-642-51014-4_11. [DOI] [PubMed] [Google Scholar]
  17. Kasper LH. Identification of stage-specific antigens of Toxoplasma gondii. Infect Immun. 1989;57:668–672. doi: 10.1128/iai.57.3.668-672.1989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Kasper L, Boothroyd J. Toxoplasma gondii and toxoplasmosis. In: Warren K, editor. Immunology and Molecular Biology of Parasitic Infections. Boston, MA: Blackwell Scientific Publications; 1993. pp. 269–301. [Google Scholar]
  19. Kasper L, Ware P. Recognition and characterisation of stage-specific oocyst/sporozoite antigens of Toxoplasma gondii by human antisera. J Clin Invest. 1985;75:1570–1577. doi: 10.1172/JCI111862. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kim K, Soldati D, Boothroyd JC. Gene replacement in Toxoplasma gondii with chloramphenicol acetyltransferase as selectable marker. Science. 1993;262:911–914. doi: 10.1126/science.8235614. [DOI] [PubMed] [Google Scholar]
  21. Luft B, Remington J. Toxoplasmic encephalitis in AIDS. Clin Infect Dis. 1992;15:211–222. doi: 10.1093/clinids/15.2.211. [DOI] [PubMed] [Google Scholar]
  22. McAllister MM, Parmley SF, Weiss LM, Welch VJ, McGuire AM. An immunohistochemical method for detecting bradyzoite antigen (BAG5) in Toxoplasma gondii-infected tissues cross-reacts with a Neospora caninum bradyzoite antigen. J Parasitol. 1996;82:354–355. [PubMed] [Google Scholar]
  23. McLeod R, Estes RG, Mack DG, Cohen H. Immune response of mice to ingested Toxoplasma gondii: a model of toxoplasma infection acquired by ingestion. J Infect Dis. 1984;149:234–244. doi: 10.1093/infdis/149.2.234. [DOI] [PubMed] [Google Scholar]
  24. McLeod R, Johnson J, Estes R, Mack D. Immunogenetics in pathogenesis of and protection against toxoplasmosis. Curr Top Microbiol Immunol. 1996;219:95–112. doi: 10.1007/978-3-642-51014-4_10. [DOI] [PubMed] [Google Scholar]
  25. McLeod R, Skamene E, Brown CR, Eisenhauer PB, Mack DG. Genetic regulation of early survival and cyst number after peroral Toxoplasma gondii infection of A × B/B × A recombinant inbred and B10 congenic mice. J Immunol. 1989;143:3031–3034. [PubMed] [Google Scholar]
  26. Morimoto R, Tissieres A, Georgeophoulos C. The Biology of Heat Shock Proteins and Molecular Chaperones. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1994. [Google Scholar]
  27. Parmley SF, Yang S, Harth G, Sibley LD, Sucharczuk A, Remington JS. Molecular characterisation of a 65-kilodalton Toxoplasma gondii antigen expressed abundantly in the matrix of tissue cysts. Mol Biochem Parasitol. 1994;66:283–296. doi: 10.1016/0166-6851(94)90155-4. [DOI] [PubMed] [Google Scholar]
  28. Parmley SF, Weiss LM, Yang S. Cloning of a bradyzoite-specific gene of Toxoplasma gondii encoding a cytoplasmic antigen. Mol Biochem Parasitol. 1995;73:253–257. doi: 10.1016/0166-6851(95)00100-f. [DOI] [PubMed] [Google Scholar]
  29. Pfefferkorn ER, Pfefferkorn LC. Specific labelling of intracellular Toxoplasma gondii with uracil. J Protozool. 1977a;24:449–453. doi: 10.1111/j.1550-7408.1977.tb04774.x. [DOI] [PubMed] [Google Scholar]
  30. Pfefferkorn ER, Pfefferkorn LC. Toxoplasma gondii: specific labelling of nucleic acids of intracellular parasites in Lesch-Nyhan cells. Exp Parasitol. 1977b;41:95–104. doi: 10.1016/0014-4894(77)90134-5. [DOI] [PubMed] [Google Scholar]
  31. Qin C-l, Tang J, Kim K. Cloning and in vitro expression of TPK3, a Toxoplasma gondii homologue of shaggy/glycogen synthase kinase-3 kinases. Mol Biochem Parasitol. 1998;93:273–283. doi: 10.1016/s0166-6851(98)00042-5. [DOI] [PubMed] [Google Scholar]
  32. Roos DS, Donald RG, Morrissette NS, Moulton AL. Molecular tools for genetic dissection of the protozoan parasite Toxoplasma gondii. Methods Cell Biol. 1994;45:27–63. doi: 10.1016/s0091-679x(08)61845-2. [DOI] [PubMed] [Google Scholar]
  33. Sibley LD, Boothroyd JC. Virulent strains of Toxoplasma gondii comprise a single clonal lineage. Nature. 1992;359:82–85. doi: 10.1038/359082a0. [DOI] [PubMed] [Google Scholar]
  34. Sibley LD, Howe DK. Genetic basis of pathogenicity in toxoplasmosis. Curr Top Microbiol Immunol. 1996;219:3–15. doi: 10.1007/978-3-642-51014-4_1. [DOI] [PubMed] [Google Scholar]
  35. Soete M, Fortier B, Camus D, Dubremetz JF. Toxoplasma gondii: kinetics of bradyzoite-tachyzoite inter-conversion in vitro. Exp Parasitol. 1993;76:259–264. doi: 10.1006/expr.1993.1031. [DOI] [PubMed] [Google Scholar]
  36. Soete M, Camus D, Dubremetz JF. Experimental induction of bradyzoite-specific antigen expression and cyst formation by the RH strain of Toxoplasma gondii in vitro. Exp Parasitol. 1994;78:361–370. doi: 10.1006/expr.1994.1039. [DOI] [PubMed] [Google Scholar]
  37. Soldati D, Boothroyd JC. Transient transfection and expression in the obligate intracellular parasite Toxoplasma gondii. Science. 1993;260:349–352. doi: 10.1126/science.8469986. [DOI] [PubMed] [Google Scholar]
  38. Soldati D, Kim K, Kampmeier J, Dubremetz JF, Boothroyd JC. Complementation of a Toxoplasma gondii ROP1 knock-out mutant using phleomycin selection. Mol Biochem Parasitol. 1995;74:87–97. doi: 10.1016/0166-6851(95)02487-5. [DOI] [PubMed] [Google Scholar]
  39. Tomavo S, Boothroyd JC. Interconnection between organellar functions, development and drug resistance in the protozoan parasite, Toxoplasma gondii. Int J Parasitol. 1995;25:1293–1299. doi: 10.1016/0020-7519(95)00066-b. [DOI] [PubMed] [Google Scholar]
  40. Tomavo S, Fortier B, Soete M, Ansel C, Camus D, Dubremetz JF. Characterisation of bradyzoite-specific antigens of Toxoplasma gondii. Infect Immun. 1991;59:3750–3753. doi: 10.1128/iai.59.10.3750-3753.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Weiss LM, LaPlace D, Tanowitz HB, Wittner M. Identification of Toxoplasma gondii bradyzoite-specific monoclonal antibodies (letter) J Infect Dis. 1992;166:213–215. doi: 10.1093/infdis/166.1.213. [DOI] [PubMed] [Google Scholar]
  42. Weiss LM, Laplace D, Takvorian PM, Tanowitz HB, Cali A, Wittner M. A cell culture system for study of the development of Toxoplasma gondii bradyzoites. J Eukaryot Microbiol. 1995;42:150–157. doi: 10.1111/j.1550-7408.1995.tb01556.x. [DOI] [PubMed] [Google Scholar]
  43. Weiss LM, Ma YF, Takvorian PM, Tanowitz HB, Wittner M. Bradyzoite development in Toxoplasma gondii and the hsp70 stress response. Infect Immun. 1998;66:3295–3302. doi: 10.1128/iai.66.7.3295-3302.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Zhang YW, Smith JE. Toxoplasma gondii: identification and characterisation of a cyst molecule. Exp Parasitol. 1995;80:228–233. doi: 10.1006/expr.1995.1028. [DOI] [PubMed] [Google Scholar]

RESOURCES