Skip to main content
Microbial Drug Resistance logoLink to Microbial Drug Resistance
. 2010 Dec;16(4):279–284. doi: 10.1089/mdr.2010.0021

Macrolide and Tetracycline Resistance and emm Type Distribution of Streptococcus pyogenes Isolates Recovered from Turkish Patients

Devrim Dundar 1,, Murat Sayan 2, Gulden Sonmez Tamer 1
PMCID: PMC3124751  PMID: 20624096

Abstract

The aims of this study were to determine the susceptibilities to macrolide and tetracycline antibiotics and emm type distribution of Streptococcus pyogenes strains isolated in the Kocaeli University Hospital, Turkey. A total of 127 S. pyogenes clinical isolates were tested. Eleven (9%) isolates were resistant to erythromycin, and 23 (18%) isolates were resistant to tetracycline. Ten of the erythromycin-resistant isolates were also resistant to tetracycline. By the triple-disk test, all erythromycin-resistant isolates showed the inducible macrolide-lincosamide-streptogramin-C phenotype and harbored erm(TR) gene. tet(O) was the most common tetracycline resistance gene. Among erythromycin-tetracycline coresistant isolates, seven harbored the tet(O) gene. emm 4, emm 1, emm 2,114, and emm 89 were the most common emm types. These isolates were more susceptible to erythromycin. There was considerable emm type heterogeneity in macrolide or tetracycline resistant isolates. According to our knowledge, this is the first study in which emm type distribution is investigated in Turkey. More comprehensive studies are needed to obtain true information about the epidemiology of macrolide and tetracycline resistance and emm type distribution in Turkey.

Introduction

Streptococcus pyogenes (group A β-haemolytic streptococcus) is a common human pathogen that causes a wide spectrum of diseases, and penicillins remain the drugs of choice for their treatment. Macrolides are also used for patients who are allergic or nontolerant to penicillins. The increasing rates of macrolide resistance in S. pyogenes have been reported from different parts of the world.26

There are two main phenotypes of macrolide resistance in S. pyogenes: the M phenotype (efflux-mediated), mediated by the mef genes, which confers low levels of resistance to 14- and 15-membered macrolides but not to 16-membered macrolides, lincosamides, or streptogramin B; and the macrolide-lincosamide-streptogramin B (MLS) phenotype, mediated by the erm genes, which confers resistance to macrolides, lincosamides, and streptogramin B antibiotics. This latter phenotype can be constitutive (cMLS), which is generally mediated by the erm(B) gene, or inducible (iMLS), which is generally mediated by the erm(A) subclass TR gene.24,36,38 iMLS strains show susceptibility to lincosamides but turn to high-level resistance after induction.18

There are several reports about the association between erythromycin, and tetracycline resistance has been considered to be an important cofactor in the selection of erythromycin resistance.5,28

The M protein is a major virulence factor of S. pyogenes. The emm gene encodes the M protein. emm gene sequencing is presently used for routine typing of S. pyogenes.6

The aims of this study were to determine the susceptibilities to macrolide and tetracycline antibiotics of S. pyogenes isolates and in the case of resistant isolates, to ascertain their patterns and genetic mechanisms of resistance. We also determined the prevalence of emm types among S. pyogenes isolates. According to our knowledge, this is the first study about emm typing of S. pyogenes in Turkey.

Methods

Bacterial isolates

A total of 127 clinical isolates of S. pyogenes isolated between October 2005 and July 2008 in the Clinical Microbiology Laboratory of Kocaeli University Hospital were tested. A total of 103 (81%) isolates were cultured from pharyngeal specimens, and 24 (19%) were cultured from other sources (18 from wound, 3 from sputum, 2 from urine, and 1 from pericardial fluid). Duplicates were excluded.

The isolates were identified as S. pyogenes by colony morphology, β-hemolysis on sheep blood agar, bacitracin disc test (0.04 U), and pyrrolidonyl arylamidase test. The strains were stored at −70°C and then subcultured twice on blood agar before susceptibility testing.

Antimicrobial susceptibility testing and macrolide resistance phenotype

Penicillin, vancomycin, levofloxacin, chloramphenicol, tetracycline, erythromycin, clarithromycin, azithromycin, telithromycin, and clindamycin susceptibilities were investigated by disk diffusion method. Minimum inhibitory concentrations (MICs) were determined using Etest (AB Biodisk) for isolates demonstrating intermediate susceptibility or resistace to erythromycin and/or tetracycline. Interpretation of the results was basically as outlined in the Clinical and Laboratory Standards Institute (CLSI) guidelines.11 Since CLSI telithromycin breakpoints for group A β-haemolytic streptococcus are not available, the results were interpreted according to the breakpoints proposed by the French Society for Microbiology.13 Streptococcus pneumoniae ATCC 49616 was used as the quality control strain.

The erythromycin resistance phenotypes were classified by triple-disk test with erythromycin (15 μg), clindamycin (2 μg), and spiramycin (100 μg) disks, as previously described.18

Detection of erythromycin and tetracycline resistance genes

Erythromycin-resistant and intermediate-susceptible isolates were screened for the erm(B), erm(TR), and mef(A) genes, and tetracycline-resistant and intermediate-susceptible isolates were screened for the tet(K), tet(L), tet(M), and tet(O) genes by real-time polymerase chain reaction (PCR) (iCycler IQ; v3.0a-BioRad Laboratories). Total genomic DNA was isolated from streptococcal strains with QIAamp® DNA Mini Kit (Qiagen). DNA in the reaction mixture (25 μl) was denatured at 93°C for 3 min, and the amplification cycles consisted of elongation at 72°C for 60 sec, denaturation at 93°C for 60 sec, and annealing at 52°C for 60 sec. After 35 amplification cycles, the last elongation step was performed at 72°C for 5 min.36 Primer sets specific for the several genes were used as seen in Table 1.3,16 Two reference Escherichia coli strains carrying erm(A) and erm(B) genes and one S. pyogenes strain positive for mef(A) (kindly provided by Dr. Ziya Cibali Acikgoz) were used as positive PCR controls.

Table 1.

List of Primers Used in Real-Time Polymerase Chain Reaction

Gene Primer target Sequence (5′-3′) Product size (bp)
erm(A) TR-up ATAGAAATTGGGTCAGGAAAAGG 530
  TR-rev TTGATTTTTAGTAAAAAG  
erm(B) ERMB-up GAAAAGGTACTCAACCAAATA 639
  ERMB-rev AGTAACGGTACTTAAATTGTTTAC  
mef(A) mefA-up AGTATCATTAATCACTAGTGC 348
  mefA-rev TTCTTCTGGTACTAAAAGTGG  
tet(M) tetM-up ACAGAAAGCTTATTATATAAC 171
  tetM-rev TGGCGTGTCTATGATGTTCAC  
tet(O) tetO-up ACGGARAGTTTATTGTATACC 171
  tetO-rev TGGCGTATCTATAATGTTGAC  
tet(K) tetK-up TATTTTGGCTTTGTATTCTTTCAT 1,159
  tetK-rev GCTATACCTGTTCCCTCTGATAA  
tet(L) tetL-up ATAAATTGTTTCGGGTCGGTAAT 1,077
  tetL-rev AACCAGCCAACTAATGACAATGAT  

emm typing

A total of 91 S. pyogenes isolates were emm typed. S. pyogenes emm sequence database (National Centers for Disease Control Biotechnology Core Facility Computing Laboratory, Blast 2.0) was used for Streptococci Group A Subtyping. The emm type-specific sequence databases have been downloaded from ftp://ftp.cdc.gov/pub/infectious_diseases/biotech/tsemm/(for DNA). All PCR products were purified using the High Pure PCR Product Purification Kit® (Roche Diagnostics GmbH) and directly sequenced with the ABI PRISM 310 Genetic Analyzer® equipment using the DYEnamic ET Terminator Cycle Sequencing Kit® (Amersham Pharmacia Biotech, Inc.). The electropherogram-obtained sequences were assembled using Vector NTI® v5.1 (InforMax™ Invitrogen™ life science software).

Statistical analysis was performed by chi-square test using Epi Info (TM) 3.5.1 program.

Results

Among 127 isolates tested, 11 (9%) were resistant to erythromycin, 7 (6%) were resistant to clarithromycin, and 23 (18%) were resistant to tetracycline. All of the erythromycin-resistant isolates were also resistant to azithromycin. Among 11 erythromycin-resistant isolates, 10 were also resistant to tetracycline, and 7 were also resistant to clarithromycin. All of the seven clarithromycin-resistant isolates were also resistant to erythromycin, azithromycin, and tetracycline. All 127 isolates were susceptible to other tested antibiotics including telithromycin.

By the triple-disk test, all of the erythromycin-resistant isolates were assigned to the iMLS-C phenotype. None of the isolates had M, cMLS, iMLS-A, or iMLS-B resistance phenotypes.

MIC ranges were between 0.75 and 1 μg/ml in erythromycin-resistant (and intermediate) isolates and 4–32 μg/ml in tetracycline-resistant (and intermediate) isolates.

Genotype analysis of erythromycin resistance revealed that 8 of the 11 erythromycin-resistant isolates carried the erm(TR) gene. In the other three isolates, macrolide resistance genes were not detected. None of the erythromycin-resistant isolates had the erm(B) and mef(A) genes. erm(TR) was strongly correlated to tet(O).

Seven of 23 tetracycline-resistant isolates had the tet(O) gene, 3 isolates had the tet(L) gene, 2 isolates had the tet(K) gene, 1 isolate had the tet(M) gene, 2 isolates had both tet(K) and tet(L) genes, and 1 isolate had both tet(K) and tet(O) genes. Seven isolates did not have any of these tet genes. Among erythromycin-tetracycline coresistant isolates, seven carried the tet(O) gene, one carried both tet(K) and tet(O) genes, and two did not have any of these tet genes (Table 2).

Table 2.

Distribution of Resistance Genes Among 127 Streptococcus pyogenes Isolates

 
 
No. of isolates
 
 
Macrolide susceptibility Susceptible to tetracycline tet(K) tet(L) tet(M) tet(O) tet(K)+tet(L) tet(K)+tet(O) Tetracycline resistant, gene unknown Total
Susceptible to erythromycin 103 2 2 1 0 2 0 6 116
erm(TR) 1 0 1 0 6 0 0 0 8
erm(B) 0 0 0 0 0 0 0 0 0
mef(A) 0 0 0 0 0 0 0 0 0
Macrolide resistant, gene unknown 0 0 0 0 1 0 1 1 3
Total 104 2 3 1 7 2 1 7 127

A total of 37 different emm types were found. The most prevalent emm types were emm4 (n = 10, 11%), emm1 (n = 9, 10%), emm2,114 (n = 8, 9%), and emm89 (n = 7, 6%). There was no predominant emm type among erythromycin-resistant and tetracycline-resistant isolates. However, emm1, emm4, emm89, and emm2,114 were detected more in erythromycin-susceptible isolates (n = 8, n = 10, n = 6, n = 6, respectively) than in erythromycin-resistant isolates (n = 1, n = 0, n = 0, n = 0, respectively) (p < 0.05) (Table 3). Further, emm2,114 was observed more in pharyngeal isolates (n = 7) than in the other isolates (n = 0) (p < 0.05) (data not shown). There were no differences in distribution of emm types among pharyngeal and nonpharyngeal isolates with the exception of emm2,114, which was found to be more frequent among pharyngeal isolates (n = 7 vs. n = 0) (p < 0.05) (data not shown).

Table 3.

emm Type Distribution of 91 Streptococcus pyogenes Isolates

emm type Fully sensitive Erythromycin-resistant Tetracycline-resistant Erythromycin and tetracycline-resistant Total
1 8 1 9
4 10 10
5 3 1 4
6 3 3
8 1 1
9 1 1
11 1 1
12 4 4
14 1 1
17 1 1 2
18 1 1
19 2 1 3
22 1 1
29 2 2
49 1 1
52 2 2
73 1 1
79 1 1 2
81 2 2
82 1 1 2
87 3 3
89 6 6
98 1 1
99 1 1
100 1 1
102 1 2 3
118 1 1
2, 114 6 1 7
17, 41 1 1
22, 78 1 1
33, 41 1 1
41, 75 3 3
44, 65 2 2
65, 69 1 1
77, 102 1 2 3
79, 87 1 1
sts 104 2 2
Total 69 1 11 10 91

Discussion

Macrolide resistance and the distribution of the macrolide resistance genes of S. pyogenes vary widely in different regions of the world. In this study, erythromycin resistance rate (9%) was lower compared with that in many countries (21.3%-45%).8,29,33,39 Low erythromycin resistance rates (0.6%–6.8%) were reported in some countries.14,15,21,23,25,28,30,37 Our erythromycin resistance rate was similar to rates in the United States (9.6%),19 Germany (12.7%),4 and Greece (11.9%).34 The low erythromycin resistance rates (%3–7) were reported from different parts of Turkey.1,2,12 Previously, we found low-level erythromycin resistance in the European section of Turkey.2 Moreover, all resistant isolates had low-level resistance to erythromycin (MIC ranges: 0.75–1 μg/ml) in the present study.

In our study, iMLS phenotype was detected in all erythromycin-resistant isolates. iMLS strains are susceptible to lincosamides but turn to high-level resistance after induction.18 In the previous studies performed in Turkey, the M phenotype was the most common phenotype followed by the iMLS phenotype.1,2 The M phenotype is the predominant phenotype in many countries,7,15,19,34,37 whereas iMLS is the most common phenotype in some countries4,14,25,30. Differences among the countries could be due to different antibiotic using patterns. In our study, 3 of 11 erythromycin-resistant isolates did not have erm(A), erm(B), and mef(A) genes. This may be due to the ribosomal mutations.28

Telithromycin resistance has particularly been reported in erm(B)-positive (cMLS) S. pyogenes isolates, although telithromycin retained activity against strains possessing the other macrolide resistance genotypes, such as erm(A) and mef(A).17,20,30 This explains the full susceptibility to telithromycin in all of the isolates we studied, in which erythromycin resistance was due to erm(TR).

In gram-positive bacteria, tetracycline resistance is mediated mainly by two mechanisms: ribosomal protection (tet M and tet O gene) and efflux (tet K and tet L gene).3,10 In some studies, tetracycline resistance in S. pyogenes was found to be associated with the tetM gene and, less frequently, with the tetO gene.16,29,34 Since tetracycline resistance genes can reside in mobile genetic elements that carry macrolide resistance genes, the cooccurrence of resistance to both classes of drugs is possible.5 Particularly, a linkage between erm(B) and tet(M) is well known.9 In many studies, erm(B) or both erm(B) and mef(A) were found to be associated with the tet(M) gene.5,9,25,28 Further, tet(M) can be found in a silent form in tetracycline-susceptible isolates.9 In the present study, we investigated the resistance genes in only resistant isolates. In this study, tet(O) was the most common tetracycline resistance gene. However, the most of the tet(O) positive isolates were also erm(TR) positive. There are several studies that reported the erm(TR)-tet(O) linkage.25,28 Seven tetracycline-resistant isolates did not have tet(M), tet(O), tet(K), and tet(L) genes. These isolates warrant further investigation on the other resistance genes.

This is the first study where in which mm types were investigated in S. pyogenes isolates from Turkey. emm 4, emm 1, emm 2,114, and emm 89 were the most common emm types, which accounted for 37% of all isolates. In a review that investigated the global emm type distribution, emm1, emm12, emm28, emm3, and emm4 were reported to be the most common emm types. However, significant differences in emm type distribution by region and clinical disease state were also reported.35

In the present study, emm1, emm4, emm89, and emm2,114 typed isolates were more susceptible to erythromycin (p < 0.05). However, we did not detect any significant distribution in macrolide or tetracycline-resistant isolates. The heterogeneity of emm types among macrolide-resistant and tetracycline-resistant isolates in the present study is compatible with some reports37 and contrasts with the others14,19,26,27,30,39. Montes et al. reported an association between emm77 and tet(M). They also reported that the emm22 isolates were the most frequent clone among the inducible resistant isolates in Spain.27 Green et al. reported that emm75 and emm12 accounted for more than half of the macrolide-resistant isolates.19 Fluctuations in the serotype distribution over time were also reported.22,31,32

In conclusion, prevalence of macrolide and tetracycline resistance in S. pyogenes isolates is low in our region and mainly due to erm(TR) and tet(O) genes, respectively. Although the number of the isolates is low in this study, a high frequency of macrolide-tetracycline coresistance is found. Therefore, tetracycline resistance can be considered as a cofactor in selection of macrolide-resistant strains. This is the first study in which emm type distribution is investigated in Turkey. Detected considerable emm type heterogeneity mainly in macrolide and tetracycline resistant isolates is probably due to the limited number of the studied isolates. More comprehensive and multicentre surveillance studies are needed to obtain true information about the epidemiology of macrolide and tetracycline resistance and emm type distribution in Turkey.

Acknowledgment

This study was supported by Research Foundation of Kocaeli University.

Disclosure Statement

No competing financial interests exist.

References

  • 1.Acikgoz Z.C. Gocer S. Tuncer S. Macrolide resistance determinants of group A streptococci in Ankara, Turkey. J. Antimicrob. Chemother. 2003;52:110–112. doi: 10.1093/jac/dkg300. [DOI] [PubMed] [Google Scholar]
  • 2.Akata F. Oztürk D. Tansel O. Tatman-Otkun M. Otkun M. Fitoussi F. Bingen E. Tugrul M. Resistance to macrolides in group A streptococci from the European section of Turkey: genetic and phenotypic characterization. Int. J. Antimicrob. Agents. 2002;20:461–463. doi: 10.1016/s0924-8579(02)00241-8. [DOI] [PubMed] [Google Scholar]
  • 3.Aminov R.I. Garrigues-Jeanjean N. Mackie R.I. Molecular ecology of tetracycline resistance: development and validation of primers for detection of tetracycline resistance genes encoding ribosomal protection proteins. Appl. Environ. Microbiol. 2001;67:22–32. doi: 10.1128/AEM.67.1.22-32.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Arvand M. Hoeck M. Hahn H. Wagner J. Antimicrobial resistance in Streptococcus pyogenes isolates in Berlin. J. Antimicrob. Chemother. 2000;46:621–624. doi: 10.1093/jac/46.4.621. [DOI] [PubMed] [Google Scholar]
  • 5.Ayer V. Tewodros W. Manoharan A. Skariah S. Luo F. Bessen D.E. Tetracycline resistance in group A streptococci: emergence on a global scale and influence on multiple-drug resistance. Antimicrob. Agents Chemother. 2007;51:1865–1868. doi: 10.1128/AAC.01341-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Beall B. Facklam R. Thompson T. Sequencing emm-specific PCR products for routine and accurate typing of group A streptococci. J. Clin. Microbiol. 1996;34:953–958. doi: 10.1128/jcm.34.4.953-958.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Betriu C. Culebras E. Rodríguez-Avial I. Gómez M. Sánchez B.A. Picazo J.J. In vitro activities of tigecycline against erythromycin-resistant Streptococcus pyogenes and Streptococcus agalactiae: mechanisms of macrolide and tetracycline resistance. Antimicrob. Agents Chemother. 2004;48:323–325. doi: 10.1128/AAC.48.1.323-325.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bingen E. Bidet P. Mihaila-Amrouche L. Doit C. Forcet S. Brahimi N. Bouvet A. Cohen R. Emergence of macrolide-resistant Streptococcus pyogenes strains in French children. Antimicrob. Agents Chemother. 2004;48:3559–3562. doi: 10.1128/AAC.48.9.3559-3562.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Brenciani A. Bacciaglia A. Vecchi M. Vitali L.A. Varaldo P.E. Giovanetti E. Genetic elements carrying erm(B) in Streptococcus pyogenes and association with tet(M) tetracycline resistance gene. Antimicrob. Agents Chemother. 2007;51:1209–1216. doi: 10.1128/AAC.01484-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Chopra I. Roberts M. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 2001;65:232–260. doi: 10.1128/MMBR.65.2.232-260.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Clinical, Laboratory Standards Institute. Wayne, IN: 2008. Performance Standards for Antimicrobial Susceptibiliy Testing: 18th Informational Supplement. M100–S18, [Google Scholar]
  • 12.Colakoglu S. Alacam R. Hascelik G. Prevalence and mechanisms of macrolide resistance in Streptococcus pyogenes in Ankara, Turkey. Scand. J. Infect. Dis. 2006;38:456–459. doi: 10.1080/00365540500546290. [DOI] [PubMed] [Google Scholar]
  • 13.Comité de l'Antibiogramme de la Société Française de Microbiologie. Communiqué. Recommendations 2007. 2007. www.sfm.asso.fr/nouv/general.php?.pa=2. [Feb 5;2010 ]. www.sfm.asso.fr/nouv/general.php?.pa=2
  • 14.Detcheva A. Facklam R.R. Beall B. Erythromycin-resistant group A streptococcal isolates recovered in Sofia, Bulgaria, from 1995 to 2001. J. Clin. Microbiol. 2002;40:3831–3834. doi: 10.1128/JCM.40.10.3831-3834.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gattringer R. Sauermann R. Lagler H. Stich K. Buxbaum A. Graninger W. Georgopoulos A. Antimicrobial susceptibility and macrolide resistance genes in Streptococcus pyogenes collected in Austria and Hungary. Int. J. Antimicrob. Agents. 2004;24:92–95. doi: 10.1016/j.ijantimicag.2004.01.009. [DOI] [PubMed] [Google Scholar]
  • 16.Giovanetti E. Brenciani A. Lupidi R. Roberts M.C. Varaldo P.E. Presence of the tet(O) gene in erythromycin- and tetracycline-resistant strains of Streptococcus pyogenes and linkage with either the mef(A) or the erm(A) gene. Antimicrob. Agents Chemother. 2003;47:2844–2849. doi: 10.1128/AAC.47.9.2844-2849.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Giovanetti E. Montanari M.P. Marchetti F. Varaldo P.E. In vitro activity of ketolides telithromycin and HMR 3004 against italian isolates of Streptococcus pyogenes and Streptococcus pneumoniae with different erythromycin susceptibility. J. Antimicrob. Chemother. 2000;46:905–908. doi: 10.1093/jac/46.6.905. [DOI] [PubMed] [Google Scholar]
  • 18.Giovanetti E. Montanari M.P. Mingoia M. Varaldo P.E. Pheotypes and genotypes of erythromyin-resistant Streptococcus pyogenes strains in Italy and heterogeneity of inducibly resistant strains. Antimicrob. Agents Chemother. 1999;43:1935–1940. doi: 10.1128/aac.43.8.1935. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Green M.D. Beall B. Marcon M.J. Allen C.H. Bradley J.S. Dashefsky B. Gilsdorf J.R. Schutze G.E. Smith C. Walter E.B. Martin J.M. Edwards K.M. Barbadora K.A. Wald E.R. Multicentre surveillance of the prevalence and molecular epidemiology of macrolide resistance among pharyngeal isolates of group A streptococci in the USA. J. Antimicrob. Chemother. 2006;57:1240–1243. doi: 10.1093/jac/dkl101. [DOI] [PubMed] [Google Scholar]
  • 20.Grivea I.N. Al-Lahham A. Katopodis G.D. Syrogiannopoulos G.A. Reinert R.R. Resistance to erythromycin and telithromycin in Streptococcus pyogenes isolates obtained between 1999 and 2002 from Greek children with tonsillopharyngitis: phenotypic and genotypic analysis. Antimicrob. Agents Chemother. 2006;50:256–261. doi: 10.1128/AAC.50.1.256-261.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Jasır A. Tanna A. Noorani A. Mirsalehian A. Efstratiou A. Schalen C. High rate of tetracycline resistance in Streptococcus pyogenes in Iran: an epidemiological study. J. Clin. Microbiol. 2000;38:2103–2107. doi: 10.1128/jcm.38.6.2103-2107.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Koh E.H. Kim S. Lee N.Y. Decrease of erythromycin resistance in group A streptococci by change of emm distribution. Jpn. J. Infect. Dis. 2008;61:261–263. [PubMed] [Google Scholar]
  • 23.Koliou M. Ioannou Y. Efstratiou A. Hannidou N. Pieri V. Alexandrou M. Soteriades E.S. Circulating serotypes and antimicrobial sensitivity of Streptococcus pyogenes isolates from children in Cyprus. Clin. Microbiol. Infect. 2007;13:645–647. doi: 10.1111/j.1469-0691.2007.01705.x. [DOI] [PubMed] [Google Scholar]
  • 24.Leclercq R. Courvalin P. Bacterial resistance to macrolide, lincosamide, and streptogramin antibiotics by target modification. Antimicrob. Agents Chemother. 1991;35:1267–1272. doi: 10.1128/aac.35.7.1267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Littauer P. Caugant D.A. Sangvik M. Høiby E.A. Sundsfjord A. Simonsen G.S. The Norwegian Macrolide Study Group. Macrolide-resistant Streptococcus pyogenes in Norway: population structure and resistance determinants. Antimicrob. Agents Chemother. 2006;50:1896–1899. doi: 10.1128/AAC.50.5.1896-1899.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Michos A.G. Bakoula C.G. Braoudaki M. Koutouzi F.I. Roma E.S. Pangalis A. Nikolopoulou G. Kirikou E. Syriopoulou V.P. Macrolide resistance in Streptococcus pyogenes: prevalence, resistance determinants, and emm types. Diagnostic Microbiol. Infect. Dis. 2009;64:295–299. doi: 10.1016/j.diagmicrobio.2009.03.004. [DOI] [PubMed] [Google Scholar]
  • 27.Montes M. Orden B. Tamayoa E. Alos J.I. Pérez-Trallero E. Characterisation of the main clones of Streptococcus pyogenes carrying the ermA (subclass TR) gene in Spain. Int. J. Antimicrob. Agents. 2006;28:408–412. doi: 10.1016/j.ijantimicag.2006.08.013. [DOI] [PubMed] [Google Scholar]
  • 28.Nielsen H.U. Hammerum A.M. Ekelund K. Bang D. Pallesen L.V. Frimodt-Møller N. Tetracycline and macrolide co-resistance in Streptococcus pyogenes: co-selection as a reason for increase in macrolide-resistant S. pyogenes? Microb. Drug Resist. 2004;10:231–238. doi: 10.1089/mdr.2004.10.231. [DOI] [PubMed] [Google Scholar]
  • 29.Pérez-Trallero E. Montes M. Orden B. Tamayo E. García-Arenzana J.M. Marimón JM. Phenotypic and genotypic characterization of Streptococcus pyogenes isolates displaying the MLSB phenotype of macrolide resistance in Spain, 1999 to 2005. Antimicrob. Agents Chemother. 2007;51:1228–1233. doi: 10.1128/AAC.01054-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Richter S.S. Heilmann K.P. Beekmann S.E. Miller N.J. Miller A.L. Rice C.L. Doern C.D. Reid S.D. Doern G.V. Macrolide-resistant Streptococcus pyogenes in the United States, 2002–2003. Clin. Infect. Dis. 2005;41:599–608. doi: 10.1086/432473. [DOI] [PubMed] [Google Scholar]
  • 31.Shulman S.T. Tanz R.R. Kabat W. Kabat K. Cederlund E. Patel D. Li Z. Sakota V. Dale J.B. Beall B. The US Streptococcal Pharyngitis Surveillance Group. Group A streptococcal pharyngitis serotype surveillance in North America, 2000–2002. Clin. Infect. Dis. 2004;39:325–332. doi: 10.1086/421949. [DOI] [PubMed] [Google Scholar]
  • 32.Silva-Costa C. Pinto F.R. Ramirez M. Melo-Cristino J. Portuguese Surveillance Group for the Study of Respiratory Pathogens. Decrease in macrolide resistance and clonal instability among Streptococcus pyogenes in Portugal. Clin. Microbiol. Infect. 2008;14:1152–1159. doi: 10.1111/j.1469-0691.2008.02104.x. [DOI] [PubMed] [Google Scholar]
  • 33.Silva-Costa C. Ramirez M. Melo-Cristino J. Portuguese Surveillance Group for the Study of Respiratory Pathogens. Rapid inversion of the prevalences of macrolide resistance phenotypes paralleled by a diversification of T and emm types among Streptococcus pyogenes in Portugal. Antimicrob. Agents Chemother. 2005;49:2109–2111. doi: 10.1128/AAC.49.5.2109-2111.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Stathi A. Papaparaskevas J. Zachariadou L. Pangalis A. Legakis N.J. Tseleni-Kotsovili A. The Hellenic Strep-EURO Study Group. Tassios PT. Prevalence of emm types 1 and 12 from invasive Streptococcus pyogenes disease in Greece—results of enhanced surveillance. Clin. Microbiol. Infect. 2008;14:808–812. doi: 10.1111/j.1469-0691.2008.02032.x. [DOI] [PubMed] [Google Scholar]
  • 35.Steer A.C. Law I. Matatolu L. Beall B.W. Carapetis J.R. Global emm type distribution of group A streptococci: systematic review and implications for vaccine development. Lancet Infect. Dis. 2009;9:611–616. doi: 10.1016/S1473-3099(09)70178-1. [DOI] [PubMed] [Google Scholar]
  • 36.Sutcliffe J. Tait-Kamradt A. Wondrack I. Streptococcus pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive to clindamycin: a common resistance pattern mediated by an efflux system. Antimicrob. Agents Chemother. 1996;40:1817–1824. doi: 10.1128/aac.40.8.1817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tanz R.R. Shulman S.T. Shortridge V.D. Kabat W. Kabat K. Cederlund E. Rippe J. Beyer J. Doktor S. Beall B.W. The North American Streptococcal Pharyngitis Surveillance Group. Community-based surveillance in the United States of macrolide-resistant pediatric pharyngeal group A streptococci during 3 respiratory disease seasons. Clin. Infect. Dis. 2004;39:1794–1801. doi: 10.1086/426025. [DOI] [PubMed] [Google Scholar]
  • 38.Varaldo P.E. Montanari M.P. Giovanetti E. Genetic elements responsible for erythromycin resistance in streptococci. Antimicrob. Agents Chemother. 2009;53:343–353. doi: 10.1128/AAC.00781-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Yi Y.H. Choi J.H. Lee H.K. Lee K.J. Bae S.M. Yu J.Y. Kim K.S. Characterization of erythromycin resistance of Streptococcus pyogenes isolated from pharyngitis patients in Korea. Jpn. J. Infect. Dis. 2006;59:192–194. [PubMed] [Google Scholar]

Articles from Microbial Drug Resistance are provided here courtesy of SAGE Publications

RESOURCES