Detection of the G>C SNP and rare mutations in the 28-bp repeat of TYMS using gel-based capillary electrophoresis

Abstract

Aims

Polymorphisms in the 5′ regulatory region of the thymidylate synthase gene (TYMS) have been shown to modulate thymidylate synthase expression and are associated with resistance to fluoropyrimidine-based therapies. These polymorphisms include a two repeat (2R) or three repeat (3R) of a 28-bp sequence and a G>C SNP in the second repeat of the 3R allele (TSER*3 G>C). Genotyping methods for the TYMS 5′-UTR polymorphisms have typically involved visualizing PCR and RFLP products on agarose gels. This article describes the use of a robust capillary electrophoresis assay for TYMS 5′-UTR genotyping.

Materials & methods

As part of pharmacogenetic studies, we performed TYMS genotyping for the 5′-UTR polymorphisms in 314 colorectal cancer patients. A gel-based capillary electrophoresis method, employing a high-resolution gel cartridge on a QIAxcel^® system, was developed to detect PCR products and RFLP fragment sizes.

Results

The high resolution of the capillary electrophoresis technique allowed identification of a 6-bp insertion in the second repeat of the 3R allele in three patients. The frequency of the insertion allele was 0.4% in Caucasians and 1.3% in African–Americans. We also found 3.3% of Caucasian patients were heterozygous for a G>C SNP in the first repeat of the 2R allele, but this allele was not observed in the African–American patients.

Conclusion

We describe a robust RFLP genotyping technique that employs size discrimination by capillary electrophoresis to genotype the TYMS TSER*3 G>C SNP. The technique also allows identification of a 6-bp insertion in the 3R allele, and we report the allelic frequencies for two uncommon TSER alleles.

Thymidylate synthase (TS) is a key enzyme in nucleotide synthesis that catalyzes the methylation of dUMP to dTMP. The TS reaction is the sole de novo source of thymidylate in the cell and is essential for DNA replication. Accordingly, TS has been an important target for a variety of chemotherapeutic agents such as 5-fluorouracil (5-FU) or capecitabine (Xeloda^®), and its over-expression has been linked to resistance to fluoropyrimidine-based chemotherapy in numerous cancers [1-6].

A polymorphism in the TS gene (TYMS) promoter enhancer region (TSER), consisting of tandem repeats of 28 bp, has been implicated in modulating TS mRNA expression [7,8] and translational efficiency [9]. The most common alleles are the double repeat (2R, TSER*2) and triple repeat (3R, TSER*3). In vitro and in vivo studies have shown that increasing the number of repeats (from 2R to 3R) leads to a stepwise increase in TS expression [7,10,11]. In addition, a common G>C substitution at the 12th nucleotide in the second repeat of the 3R allele has been identified (TSER*3 G>C, rs2853542) [12]. This SNP changes a critical residue in the upstream stimulatory factor E-box consensus element (CACTTG>CACTTC). This abolishes one E-box in the 3R allele, which leads to a decrease in TYMS transcription, such that 3RC has lower transcriptional activity than 3RG, but similar activity to 2R [13].

A rare G>C SNP in the TYMS 2R allele, carrying a G>C base change at the 12th nucleotide of the first 28-bp repeat has also been described (2RC) [14,15]. A recent functional study demonstrated that the transcriptional activity of the 2RC allele promoter is lowest among the known alleles, which is consistent with the SNP altering the single E-box of the 2R allele [16]. To date, only two studies have reported the 2RC allele frequency, which was found to be 1.5% in 100 Caucasian colorectal cancer patients in an Italian study [14], and 4.2% in 59 Caucasian colorectal cancer patients in Australia [15].

As part of cancer pharmacogenetic studies, we genotyped 314 5-FU-treated cancer patients for the TYMS tandem repeat polymorphism and the TSER*3 G>C SNP using RFLP combined with fragment size detection by gel-based capillary electrophoresis. In this study, we report the benefit of this new method for detecting small insertion/deletions, and report the frequencies of two rare TYMS alleles in 314 colorectal patients.

Materials & methods

Patients

We studied 314 colorectal patients. The patient cohort included 135 rectal cancer patients receiving first-line neoadjuvant chemoradiation, and 179 patients receiving first-line therapy for metastatic colorectal cancer. The study was approved by the institutional review boards at Washington University School of Medicine (MO, USA) and the University of North Carolina (NC, USA). The total population included 270 Caucasians, 38 African–Americans, two Asians and four individuals belonging to other races (one Hispanic, one Native Hawaiian or Pacific Islander and two unknown). Informed consent was obtained from all participants prior to enrollment.

Genotyping

The 314 samples were genotyped for the TSER*3 G>C SNP. Genomic DNA was extracted from peripheral blood samples and PCR was performed using the primers previously described [17], with the following modifications. The PCR mixture contained HotStarTaq^® Plus Master Mix (1X) (Qiagen, Hilden, Germany), Q solution (1X) (Qiagen), 1 μM of each primer and 1.5 ng of DNA in a 15 μl final volume. The thermocycler conditions were as follows: initial incubation at 95°C for 5 min followed by 40 amplification cycles (30 s at 94°C, 30 s at 60°C and 1 min at 72°C) and a final elongation at 72°C for 10 min. Instead of running the PCR products on a 4% agarose gel to visualize the bands, amplicons were sized using a QIAxcel^® DNA high-resolution gel cartridge (Qiagen) on a QIAxcel system (Qiagen), which enabled high-resolution capillary electrophoresis. A 25–450 bp QX DNA Size Marker (Qiagen) was included on QIAxcel runs and the size of the products was determined using the Biocalculator software (Qiagen). The QX Alignment Marker (Qiagen), which consisted of 15-bp and 500-bp bands, was automatically injected onto the cartridge with each sample by the QIAxcel system and enabled the software to align the lanes. The QIAxcel system produces a digital gel image and an electropherogram for fragment analysis.

The QIAxcel system used a standardized volume (less than 0.1 μl) for each analysis of the 15 μl of PCR product that was placed on the QIAxcel. We used the OH700 method to analyze the PCR products. The expected PCR product sizes were 214 bp (2R), 242 bp (3R) and 270 bp (4R).

For the purpose of comparison, PCR products from samples displaying a representative panel of genotypes were also analyzed with a 4% agarose gel [12].

Afterwards, the PCR products were digested with HaeIII as previously described, with minor modifications [12]. Briefly, 10 μl of PCR product was incubated with the HaeIII restriction enzyme (New England Biolabs, MA, USA) in a 15 μl reaction, containing 3 units of restriction enzyme, 1X NE buffer 2 and water at 37°C for 16 h followed by 20 min at 80°C to inactivate the enzyme. The digested products were diluted (1/10) in the dilution buffer provided by the cartridge kit and the size of the digested products was determined using a QIAxcel DNA high-resolution gel cartridge on a QIAxcel system, as described above, using the OL700 method. The expected fragment sizes were as follows: 2RC: 12, 44, 45 and 113 bp; 2RG: 12, 44, 45, 47 and 66 bp; 3RG: 12, 28, 44, 45, 47 and 66 bp; 3RC: 12, 44, 45, 47 and 94 bp.

Sequencing

For homozygous samples for the TSER polymorphism, the PCR products (2R/2R or 3R/3R) obtained as described above, were purified with the QIAquick^® PCR Purification Kit (Qiagen) according to the manufacturer guidelines, and directly sequenced. For heterozygous samples, the PCR products were first separated in a 4% low-melt agarose gel. Each band (2R or 3R) was cut from the gel and the DNA was extracted using the QIAquick Gel Extraction Kit (Qiagen) and purified with the QIAquick PCR Purification Kit. The two alleles were sequenced separately. The sequencing reaction was performed using the ABI PRISM^™ Big Dye^™ version 1.1 Terminator Cycle Sequencing Ready Reaction Kit with AmpliTaq^® DNA polymerase, FS (Applied Biosystems, Foster City, CA USA) with the PCR reverse primer used as the sequencing primer. DNA was sequenced at the Genome Analysis Facility of University of North Carolina, Chapel Hill on a 3730xl DNA Analyzer (Applied Biosystems).

Results & discussion

All samples were genotyped for the TSER polymorphism using the QIAxcel system, and most of them displayed expected patterns of bands on the gel image, as shown in lanes 1–3 of Figure 1. However, in three samples, a 248-bp band was observed, suggesting a 6-bp insertion (ins) in the 3R allele (see Figure 1A lane 4 for 2R/3R-ins genotype). The interpretation of the gel image was confirmed by the electropherogram, which showed the peak size (see Figure 1B & 1C). The direct sequencing of two out of the three samples was performed and confirmed the presence of a 6-bp insertion (CCCCCG) in the second repeat of the 3R allele (Table 1). The results obtained with the QIAxcel were similar to those observed on a 4% agarose gel, except for two samples carrying the 6-bp insertion in the 3R allele that were not identified with the agarose gel method. Figure 1A & 1D illustrate the benefit of using the QIAxcel system over the 4% agarose gel to distinguish between 3R and 3R-ins alleles. Although the size difference between 3R and 3R-ins is slight, it is visible on the gel image provided by the QIAxcel system (and confirmed by the electropherograms), but is easily overlooked on the agarose gel.

Figure 1. Visualization of PCR products for TSER genotyping.

(A) Gel images (lanes 1–4) and (B & C) electropherograms (displayed for lanes 3 and 4 only) created by the Biocalculator software (QIAxcel) for TSER polymorphism discrimination. Lane 4 shows the pattern of a 2R/3R-ins genotype: the 3R band is slightly larger (248 bp) than the normal 3R band (242 bp) shown in lane 3. The gel image is complemented by the electropherograms (B & C), which provide the sizes of the DNA fragments that are detected in lanes 3 and 4, respectively. (D) Gel image obtained with a 4% agarose gel for the indicated genotypes.

*Alignment markers.

Table 1.

Nucleotide sequences and frequencies of the 3RC-ins and 2RC alleles described in this study.

Allele	Repeat number	Nucleotide sequence	Caucasians carrying the allele (n)	Allele frequency in Caucasians	African–Americans carrying the allele	Allele frequency in African–Americans
3RC-ins	1st repeat	CCGCGCCACTTGGCCTGCCTCCGTCCCG	2/270†	0.0037	1/38†	0.0132
	2nd repeat	CCGCGCCACTTCGCCTGCCTCCGTcccccgCCCG
	3rd repeat	CCGCGCCACTTCGCCTGCCTCCGTCCCCCGCCCG
2RC	1st repeat	CCGCGCCACTTCGCCTGCCTCCGTCCCG	9/270†	0.0167	0/38	0
	2nd repeat	CCGCGCCACTTCGCCTGCCTCCGTCCCCCGCCCG

The differences compared with wild-type sequence are in bold. The lowercase bold nucleotides represent the 6-bp insertion and the uppercase bold nucleotide is a G>C single nucleotide substitution.

^†All individuals were heterozygous for the alleles.

In Figure 2, lanes 1–4 depict some examples of the digestion patterns obtained with the gel-based capillary electrophoresis system. For the three carriers of the 6-bp insertion mentioned above, a 100-bp band was observed instead of a 94-bp band, as shown in lane 4 of Figure 2. Of note, the 6-bp insertion was only found in the 3RC allele (3RC-ins) and generated the 100-bp band after digestion. The electropherograms shown in Figure 2B & 2C confirmed the 6-bp size difference between the 94 and 100-bp peaks. The three patients with the 3RC-ins were heterozygous: one carried genotype 3RG/3RC-ins and two were 2RG/3RC-ins.

Figure 2. Visualization of RFLP products for TSER*3 G>C genotyping.

(A) Gel images (lanes 1–4), and (B & C) electropherograms (displayed for lanes 3 and 4 only) created by the Biocalculator software (QIAxcel) for TSER*3 G>C SNP genotyping after digestion with HaeIII. The corresponding genotypes are indicated on the top of each lane and were deduced from runs obtained before (not shown here) and after digestion of PCR products.

*Alignment markers.

To our knowledge, the 3RC-ins allele has not been previously reported in Caucasians or African–Americans. In 2006, it was identified in Japanese individuals with a frequency of 0.6% [18]. Most of the published pharmacogenetic studies that have genotyped the TSER polymorphism in the past 10 years used 2–4% agarose gels to visualize PCR and digested products. Agarose gels do not provide enough discriminatory power to detect a 6-bp difference in fragment size, which may explain why the 3RC-ins allele has not been reported by most previous studies.

Here, we describe the use of a gel-based capillary electrophoresis technique that sizes DNA amplicons and fragments with high resolution, thereby allowing for the discrimination between TSER 3RC and 3RC-ins alleles, which differ in size by 6 bp. The frequency of the 3RC-ins allele in our study was 0.4% in Caucasians and 1.3% in African–Americans (Table 1). To date, the functional consequences of the 6-bp insertion have not been investigated. However, it is possible that the presence of the 6-bp insertion affects the proposed stem loop structure formed by association of the inverted and direct repeats [8]. Nevertheless, specific confirmatory studies are required. It was also possible to detect the rare 2RC allele using the electrophoresis system, although the 113-bp band generated after digestion for the 2RC allele can also be visualized with an agarose gel [12]. Indeed, the G>C SNP in the first repeat of the 2R allele disrupts the restriction site and leads to a 113-bp band after digestion by HaeIII, which was easily detected by the QIAxcel system (see lane 1, Figure 2A). The frequency of the allele has only been reported twice in Caucasians. Of note, the 2RC allele was not found in the 263 Japanese patients mentioned earlier [18]. In our study, we found nine patients that were heterozygous for the 2RC allele and all of them were Caucasian (3.3%), therefore the allelic frequency was 1.7% in this population (Table 1). Four out of the nine samples identified as 2RC by gel-based electrophoresis were sequenced and the genotypes were confirmed in all cases. All patients carrying a 2RC allele were heterozygous: five were 2RC/2RG, three were 2RC/3RC and one was 2RC/3RG. The frequency of the 2RC allele that we report here is in agreement with that previously described in Caucasians (1.5–4.2%) [14,15] but was determined with a greater number of patients (i.e., 314 patients vs 100 and 59 patients in previous studies). Of note, our population included 38 African–Americans and the 2RC allele was not found in this subgroup of patients. Nevertheless, a larger cohort of African–Americans needs to be studied before drawing conclusions regarding the 2RC allele frequency in this population.

Conclusion

We describe an improvement over the existing method for TSER genotyping and report the frequencies of two uncommon TSER alleles. We sized PCR and RFLP products on the QIAxcel system with a QIAxcel DNA high resolution gel cartridge, which allowed for the identification of a rare TSER allele, which contains a 6-bp insertion (CCCCCG) in the second repeat of the 3RC allele. Indeed, the high-resolution automated electrophoresis system can resolve bands of 3–5 bp size difference (see manufacturer’s instructions [101]). We recommend that future studies investigating the role of TYMS polymorphisms in drug response and/or toxicity use this method of detection so that we can improve our knowledge regarding the 3RC-ins allele frequency and its putative functional consequences.

Executive summary.

TYMS polymorphisms & fluoropyrimidine-based chemotherapy

• ▪TYMS genetic polymorphisms have been shown to have an impact on fluoropyrimidine-based treatment resistance.
• ▪The TSER polymorphisms in the 5′-UTR region of TYMS, which consists of two or more repeats of a 28-bp sequence and a G>C SNP at the 12th nucleotide in the second repeat of the 3R allele, are often investigated by visualizing PCR and RFLP products on agarose gels.

Capillary electrophoresis using the QIAxcel^® system improves small insertion/deletion detection

• ▪This study describes the use of a robust capillary electrophoresis assay using the QIAxcel system for TYMS 5′-UTR genotyping, which also allows identification of a 6-bp insertion in the 3R allele (3RC-ins) that is probably not detectable with the agarose gels usually used for TYMS genotyping.

Frequency report

• ▪The frequency of the 3RC-ins allele was 0.4% in Caucasians and 1.3% in African–Americans.
• ▪We found 3.3% of Caucasian patients were heterozygous for a G>C SNP in the first repeat of the 2R allele (2RC) and this allele was not observed in the African–American patients.

Conclusion

• ▪The functional consequence of the 6-bp insertion in the 3R allele remains to be determined.
• ▪Future pharmacogenetic studies are encouraged to use this high-resolution system for TYMS genotyping to determine whether the 3RC-ins allele influences clinical outcomes in patients treated with fluoropyrimidines.