Summary
Human UDP-glucuronosyltransferase 2B7 (UGT2B7) is one of the major isoforms involved in the glucuronidation of endogenous compounds and xenobiotics. This isoform is the only human UGT shown to glucuronidate retinoids and their oxidized derivatives. In this study, the effects of all-trans retinoic acid (atRA), 9-cis RA, and the RAR agonist TTNPB, on UGT2B7 and UGT2B15 mRNA expression in Caco-2 cells have been examined. Each of these retinoids significantly suppressed UGT2B7 mRNA expression in a concentration-dependent manner with IC50 values of 3.5, 0.3, and 0.2 µM, respectively. However, no inhibition was observed when two other UGTs, UGT2B15 or -1A6, were exposed to atRA, 9-cis RA, or TTNPB, demonstrating that the inhibitory effect of retinoids might be specific for the UGT2B7 isoform. Further, experiments with oxidized atRA derivatives, 4-OH-atRA, 4-oxo-atRA, and 5,6-epoxy-atRA showed that these RA degradation products have no inhibitory effect on UGT2B7 mRNA expression. These data lead us to hypothesize that biologically active forms of RA suppress the expression of UGT2B7 in intestinal cells. This information provides a new pathway by which retinoids may enhance their own toxicity when accumulated in the body at pharmacological concentrations by down-regulating the enzymes involved in their biotransformation into soluble derivatives.
Keywords: UDP-glucuronosyltransferase (UGT), retinoid, suppression, Caco-2 cells
Introduction
Retinoids are potent regulators of a variety of physiological processes including development, cell differentiation and proliferation, apoptosis, homeostasis, and reproduction.1) all-trans retinoic acid (atRA) and 9-cis retinoic acid (9-cis RA) have been recognized as important signaling molecules and physiological ligands for the several nuclear receptors.2) Retinoids exert most of their function via interaction with two types of nuclear retinoid receptors, the retinoic acid receptors (RAR) and the retinoid X receptors (RXR), which act as ligand-activated transcription factors controlling the expression of a number of target genes.3,4) RARs can bind both atRA and 9-cis RA, but RXRs can only bind 9-cis RA.5) RXRs are also known to be a heterodimer partners for a number of nuclear receptors.
Although RARs and RXRs are the major regulators of retinoid-mediated pathways, other pathways have also been found to be activated by retinoids. atRA has been found to down-regulate the transcriptional activities of AP–1 transcription complex.6) Furthermore, retinoids have been shown to alter the activity of MAP kinase pathways.7) However, attention needs to be paid to the cells and genes involved, since all these signaling pathway have been shown to be cell-type dependent and target gene selective.
Interactions between retinoids and drug metabolizing enzymes have been demonstrated previously.8) This is especially true in relation to cytochrome P450s (CYPs), which are regulated by retinoids and also actively metabolize them into their oxidized derivatives. The total number of CYPs that are regulated in vivo by retinoids is not known; however, it has been suggested that CYP1A1, CYP3A and, most importantly, CYP26 and its variants are induced by and in turn metabolize these compounds.9–11) These enzymes are differentially expressed in various tissues, with the liver, intestine, and brain being the sites of highest expression.12) The role of the intestine in the metabolism of retinoids is clearly recognized.13) Dietary retinol can be oxidized in enterocytes to form atRA, which can be further metabolized by CYP26 to form various oxidized derivatives.14) It has also been shown that intestinal cells are the site of both CYP gene regulation and the metabolism of atRA.10,11,14)
UDP-Glucuronosyltransferases (UGTs) are quantitatively the most abundant Phase II drug metabolizing enzymes and are involved in the biotransformation of the greatest number of endogenous and exogenous compounds of any drug metabolizing enzyme. However, studies of UGTs as enzymes responsible for the biotransformation of retinoids are very limited. Our laboratory has carried out studies with recombinant human human UGTs that demonstrated that UGT2B7 is the only isoform able to glucuronidate atRA, 4-hydroxy (OH) atRA, 4-oxo atRA, and 5,6-epoxy atRA with activities similar to those found in human liver microsomes.15) We proposed that UGT2B7 might be involved in controlling intracellular levels of retinoids and their biological fate. Our later publication confirmed the role of UGT2B7 in retinoid metabolism and further showed that both liver and all segments of intestine actively glucuronidate atRA, although the rate of atRA glucuronidation in liver was comparatively higher than that of intestine.16) It was calculated that, under normal physiological conditions, glucuronidation of retinoids in humans occurs at a concentration of 5–17 nM.17)
In this report, a continuation of our previous retinoid-related metabolic studies,15,16) we have begun investigating of the role of retinoids in the regulation of UGT2B7 expression. In order to examine the effect of retinoids on this isoform, Caco-2 and HepG2 cells were exposed to increasing concentrations of biologically active retinoids, including atRA, 9-cis RA, and 13-cis RA. These experiments showed dramatic suppression of UGT2B7 mRNA expression in the presence of these retinoids in Caco-2 but not HepG2 cells. However, similar experiments using the oxidized derivatives of atRA showed no suppressive effects of these catabolic products. To clarify whether this down-regulation is isoform specific, we carried out similar experiments testing the effects of the active retinoids on the expression of two other human UGT isoforms, UGT1A6 and -2B15. These compounds had no suppressive effect on the expression of either isoform; however, the levels of UGT2B15 were slightly up-regulated.
Based on these data, we hypothesize that exposure to pharmacological concentrations of biologically active retinoids induces a rapid down-regulation of UGT2B7 expression in intestinal but not hepatic cells. The different pattern of regulation between these two tissues may be an indication of tissue-specific mechanisms of regulation of UGT2B7 expression and is shown to be specific to this retinoid glucuronidating enzyme. The possible mechanism for this suppression is discussed here.
Methods
Materials
all-trans retinoic acid, 9-cis RA, 4-OH atRA, 4-oxo atRA, 5,6-epoxy atRA, and (E)-4-[2-(5,6,7,8-tetrahydro-5,5,8,8-tetra-methyl-2-naphthylenyl)-1-propenyl] benzoic acid (TTNPB) (chemical structures are shown in Fig. 1) were all purchased from Sigma-Aldrich (St. Louis, Mo, USA). All procedures using retinoids were performed under yellow light to minimize photoisomerization.
Fig. 1.
Chemical structures of retinoids used.
Cell culture
Caco-2 (ATCC HTB-37) and HepG2 (ATCC HB-8065) cells were obtained from the American Type Culture Collection (Manassas, VA, USA) and kept in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, CA, USA) at 37°C in a humidified atmosphere of 5% CO2-air. Chemicals were dissolved in DMSO (Sigma-Aldrich) and cells we treat at indicated concentrations.
Cell viability assay
Cell viability was determined by Trypan Blue exclusion. Caco-2 cells were plated in 6-well plates at a density of 5 × 105 cells per well and cultured for 24 hr. atRA, 9-cis RA and TTNPB at concentrations corresponding to those used in UGT mRNA expression level studies were then added. After an additional 48 hr incubation, the cells were released from the plates with trypsin/EDTA (Invitrogen), incubated with 0.4% Trypan Blue (Mediatech, Herndon, VA, USA) for 5 min, and counted using a hemocytometer. Since the monolayers were not washed prior to trypsin-EDTA treatment or scraping of adherent cells, cells that detached during incubation with treated chemicals are detected.
RNA preparation
Total RNA was isolated from cell cultures using a phenol and guanidine isothiocyanate RNA extraction method (Trizol; Invitrogen), following the instructions of the supplier. To avoid any contamination of the RNA by genomic DNA, DNase treatment was performed using RQ1 RNase-Free DNase (Promega, Madison, WI, USA). cDNA was synthesized by mixing 1 µg of total RNA from each sample with 100 pmol random hexamer primers in 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, containing 100 U M-MLV reverse transcriptase, 20 U RNase inhibitor, and 1 mM each dNTP (Promega) in a total volume of 20 µl. The samples were incubated at 37°C for 60min and then heated at 95°C for 5 min to inactivate the reverse transcriptase. The reaction mixture was diluted to 100 µl with sterile diethylpyrocarbonate-treated H2O.
RT-PCR analysis
Primers for UGT2B7, UGT2B15, UGT1A6 and GAPDH are described in Table 1. PCR reactions were performed as follows: a 10 µl aliquot of cDNA was added to a reaction mixture containing 10 mM Tris-HCl buffer (pH 8), 20 mM KCl, 0.1% Triton X-100; 1.5 mM MgCl2, 0.2 mM of each dNTP, 50 pmol of each primer and 2 units of Taq DNA polymerase (Promega), in a total volume of 50 µl. Amplification of the ubiquitously expressed GAPDH cDNA was performed under the same conditions in separate experiments. The specificity of all primer pairs was confirmed through sequencing of the PCR products. For each primer pair, we performed PCR with different cycle numbers and plotted these data to form a standard curve. We chose the cycle that was found to be within the nonsaturable range of amplification for use in further experiments. All other conditions were kept consistent unless significant changes in mRNA level were observed. The PCR products were resolved by 2% agarose gel electrophoresis and detected with ethidium bromide. The bands were visualized under UV light and photographed by a computed-assisted camera. Quantification of each band was performed by densitometric analysis by using NIH Image software (NIH, Bethesda, MD).
Table 1.
PCR primers and conditions for semi-quantitative analysis of UGT isoforms
| Target Transcript |
F: Forward primer 5′–3′ R: Reverse primer 5′–3′ |
Annealing Temp (°C) |
Amplicon Size (bp) |
No. of cycles on Caco-2 cDNA |
|---|---|---|---|---|
| UGT2B7 | F: ttgcaccaggatgtctgtgaa | 56 | 643 | 32 |
| R: taccctctccatgaaagtcatttga | ||||
| UGT2B15 | F: gactgtgttgacatcttcggcttct | 54.7 | 326 | 32 |
| R: ccagtagctcaccacagggattaag | ||||
| UGT1A6 | F: gaagaaccgttaccaatcat | 55.4 | 670 | 35 |
| R: gaccattgatcccaaaga | ||||
| GAPDH | F: acccactcctccacctttg | 64 | 178 | 25 |
| R: ctcttgtgctcttgctggg | ||||
Nucleotide sequences are reported for primer pairs used in RT-PCR analysis of UGTs expressions in Caco-2 cells.
Statistical methods
GraphPad Prism 4 (GraphPad Software, Inc., San Diego, CA, USA) was used for data analysis. The results were analyzed by one-way ANOVA followed by Dunnett’s multiple comparison test. Measurements that vary significantly from the control are indicated *, p < 0.05; **, p < 0.01).
Results
Effect of atRA, 9-cis RA, and TTNPB on UGT2B7 mRNA expression
To determine whether atRA, a substrate for UGT2B7, can affect UGT2B7 gene expression in cultured cell systems, Caco-2 and HepG2 cells were treated for 48 hr with various concentrations of atRA, and 9-cis RA, as indicated in Figure 2. Caco-2 cells were also treated with low concentrations of the RAR agonist, TTNPB, under the same conditions. After treatment, total RNA was isolated from the cells and UGT2B7 mRNA levels were analyzed by semi-quantitative RT-PCR. atRA treatment of Caco-2 cells resulted in a significant dose-dependent decrease in UGT2B7 mRNA levels as compared with vehicle-treated (0.1% DMSO) cells (Fig. 2), with an IC50 about 3.5 µM. Incubation of Caco-2 cells with 9-cis RA had a similar effect on UGT2B7 mRNA levels but the decrease began at a much lower concentration, resulting in an IC50 of is 0.2 µM, significantly lower than that of atRA. The synthetic atRA analog, TTNPB, had a similar effect on UGT2B7 mRNA levels, with a low IC50 of 0.3 µM. These data showed that the RAR agonist TTNPB is the most potent suppressor of UGT2B7 mRNA expression in Caco-2 cells. On the other hand, in parallel experiments carried out in HepG2 cells under identical conditions, UGT2B7 mRNA expression was not affected by either retinoid or TTNPB (data not shown).
Fig. 2. Effect of retinoids on UGT2B7 mRNA expression in Caco-2 cells.
Caco-2 cells were treated with atRA, 9-cis RA and TTNPB at the indicated concentrations for 48 hours. Total RNA was isolated and RT-PCR analysis was performed to evaluate the expression level of UGT2B7 mRNA. The bar graphs show the relative expression of UGT2B7 mRNA (normalized to GAPDH expression). The IC50 values for retinoid inhibition of UGT2B7 mRNA expression were calculated. The results were analyzed by one-way ANOVA followed by Dunnett’s multiple comparison test. Measurements that vary significantly from the control are indicated (*, p < 0.05; **, p < 0.01).
Effect of oxidized derivatives of retinoic acid on UGT2B7 mRNA expression
atRA is metabolized in vivo by CYP26 and others to form 4-OH atRA, 4-oxo atRA, 5,6-epoxy atRA, all of which are generally accepted as inactive metabolites.14,18) To test the response of UGT2B7 gene expression to these oxidized retinoids, Caco-2 cells were treated with 4-OH atRA, 4-oxo atRA, and 5,6-epoxy atRA at the same concentrations used for atRA. UGT2B7 mRNA levels were evaluated using semi-quantitative RT-PCR and normalized to GAPDH mRNA expression. As the data in Figure 3 show, neither 4-OH atRA, 4-oxo atRA, nor 5,6-epoxy atRA induced or suppressed UGT2B7 mRNA levels, whereas atRA consistently suppressed UGT2B7 mRNA expression. These data further demonstrate that UGT2B7 mRNA suppression is specific for atRA and 9-cis RA, which are biologically active, while the three oxidized metabolites, the inactive intermediates of the retinoid detoxification pathway, have no visible effects.
Fig. 3. Effect of atRA and its oxidized derivatives on UGT2B7 mRNA expression in Caco-2 cells.
Caco-2 cells were treated with each retinoid at the concentrations shown in the figure (0.1–50 µM) for 48 hours. Total RNA was isolated and RT-PCR analysis was performed to evaluate mRNA expression level of UGT2B7. The results are shown as the relative mRNA expression (normalized to GAPDH expression). The results were analyzed by one-way ANOVA followed by Dunnett’s multiple comparison test. Measurements that vary significantly from the control are indicated (*, p < 0.05; **, p < 0.01).
Effect of retinoids on UGT1A6 and UGT2B15 mRNA expression
To answer the question of whether retinoid mediated suppression of UGT2B7 is an observation related specifically to this isoform, the mRNA expression of UGT2B15 and UGT1A6 mRNA was examined under conditions identical to those used for UGT2B7 (Fig. 4). Treatment with atRA, 9-cis RA, and TTNPB had no effect on UGT1A6 mRNA expression except at the highest concentrations used, which corresponds with the decreases in cell viability seen in Figure 5. On the other hand, treatment with atRA and TTNPB significantly increased the mRNA expression of UGT2B15 up to concentrations of 0.1 µM and 10 µM, respectively. No effect of 9-cis RA on UGT2B15 mRNA expression was observed under the current experimental conditions.
Fig. 4. Effect of atRA on UGT2B15 and UGT1A6 mRNA expression.
Caco-2 cells were treated with atRA at the indicated concentration for 48 hours. Total RNA was isolated and RT-PCR analysis was performed to evaluate UGT2B15 and UGT1A6 mRNA expression levels. The results are shown as relative mRNA expression (normalized to GAPDH expression). The results were analyzed by one-way ANOVA followed by Dunnett’s multiple comparison test. Measurements that vary significantly from the control are indicated (*, p < 0.05; **, p < 0.01).
Fig. 5. Effect of retinoids on Caco-2 cell viability.
Caco-2 cells were plated in 6-well plates at a density of 5 × 105 cells per well and cultured for 24 hr. atRA, 9-cis RA, and TTNPB at were then added the indicated concentrations and cells were incubated for an additional 48 hr. The percentage viability was determined by Trypan Blue exclusion. The results were analyzed by one-way ANOVA followed by Dunnett’s multiple comparison test. Measurements that vary significantly from the control are indicated (*, p < 0.05; **, p < 0.01).
Effect of retinoids on Caco-2 cell viability
Retinoids are also known to be toxic to cells at pharmacological concentrations. To exclude the possibility that these retinoids might disrupt the Caco-2 cell membrane, cell viability was assayed using a Trypan Blue exclusion assay. As shown in Figure 5, only the highest concentrations of retinoids, which were far above pharmacological conditions, decreased Caco-2 cell viability. All other concentrations of retinoids, including those that significantly suppressed UGT2B7 mRNA expression or induced UGT2B15 mRNA expression, were well-tolerated by the cell.
Discussion
In these studies, we report that human UGT2B7 mRNA expression is negatively regulated by the biologically active retinoids, atRA and 9-cis RA, and their synthetic derivative, TTNPB, in Caco-2 cells. This dose-dependant decrease in UGT2B7 mRNA levels seems to be specific to this UGT isoform, since it is not observed with the two other UGT isoforms tested, UGT1A6 and-2B15.
The different effects of atRA, 9-cis RA and TTNPB on UGT2B7 mRNA expression could be due to their different functions in the cell. 9-cis RA is a unique ligand for the retinoid X receptor (RXR) and 9-cis RA and atRA are both ligands for RAR. As for TTNPB, it is a strong agonist for RAR. These biologically actively compounds are involved in different signaling pathways. The receptors activated by these ligands could effect the regulation of totally different sets of genes, and therefore, the net effect of this pathway on UGT2B7 expression could be different. Although similar, it is unlikely that their effects on 2B7 gene regulation would be identical.
Three P450-oxidized catabolic products of atRA, 4-OH-, 4-oxo-, and 5,6-epoxy-RA, showed no effect on the mRNA expression of this isoform, One concern that needs to be taken into consideration is whether the oxidized compounds can cross the cell membranes in Caco-2 cells. However, there is evidence that these oxidized RAs can cross the membranes of Cos-7 cells19) and that oxidized metabolites of linoleic acids can cross in both colon cell lines, Caco-2 and HCT-116.20) Therefore, it is reasonable to make the assumption that oxidized retinoids can also cross in Caco-2 cells, but are not able to cause the suppressive effects, which are more likely specific to the biologically active retinoids. The lack of suppression seen with these compounds provides important proof that the suppressive effects are specific to biologically active retinoids and are not simply artifacts of the system.
Additionally, no suppressive response to retinoids was observed in HepG2 cells, indicating that the regulation of this isoform is tissue-specific with the major site of this action being the intestine: the first organ exposed to dietary retinoids and orally administered retinoid-based drugs. It is recognized that UGTs are expressed in a tissue-specific manner. Therefore, we can speculate that there are additional factors involved, such as the existence and/or regulation of different nuclear receptors or signaling pathways. These could vary in the liver and colon and differentially mediate the UGT regulation, including the observed suppression of UGT2B7. It is also possible that other factors that we have not recognized, can be involved (i.e., the presence of the retinoid acid binding protein (RABP), etc).
A majority of atRA enters the body in the form of vitamin A, or other dietary products13) and enters the organism via the intestinal tract. Our previous studies have provided information that retinoids are actively metabolized by UGT2B7 in the human intestinal tract.16) The product of this biotransformation, retinoyl-β-glucuronide, is found in the liver, kidney, intestinal mucosa, and several other tissues. However, of all these tissues, the intestinal mucosa seems to be the most active in synthesizing and retaining retinoyl-β-glucuronide in vivo21).
It is recognized that, in addition to a large number of beneficial processes initiated by retinoids, this class of compounds can also be responsible for many deleterious effects on the body, when they either exceed physiological levels or are present in inadequate amounts.22) Because of this, one can easily speculate on the consequences of the dramatic decrease of UGT2B7 expression seen in Caco-2 cells in response to retinoids. Most obviously, since UGT2B7 is involved in the elimination of excess retinoids and/or the termination of their biologicall activity, the suppression of this enzyme could result in the accumulation of excess retinoids, leading to toxicity in the cell and organism and an increase in teratogenesis and hypervitaminosis A syndrome.23,24) UGT2B7 is also an indispensable component of the overall detoxification network. In addition to its function in modulating the activity of biologically active compounds, it also plays an essential role in controlling steady-state concentrations of compounds such as fatty acids, bile acids, prostaglandins, steroid hormones, and retinoids,25) which are ligands for nuclear receptors, such as RXR and RAR, and other signaling pathways. A lack of UGT2B7 would allow for prolonged interactions of active retinoids with nuclear receptors and signaling pathways, potentially resulting in non-specific activation of a variety of genes. Therefore, impairment of this isoform’s activity could have far reaching effects on the homeostasis of many nuclear receptor-dependant systems throughout the organism.
In addition, a decrease in UGT2B7 could result in insufficient biosynthesis of retinoyl-β-glucuronide, which may itself possess biologically activity. In fact, it has been shown that retinoyl-β-glucuronide is more active than atRA or retinol in modulating differentiation in certain cell types and inducing differentiation of human promyelocytitic leukemia cells (HL–60) without being hydrolyzed to retinoic acid.26) In cell differentiation, retinoyl-β-glucuronide might act as a carrier to transfer the retinoyl moiety to appropriate protein, as a transport agent from the cytosol to the nucleus, or as a slow-release precursor of retinoic acid.21) On the other hand, retinoyl-β-glucuronide might serve a protective role against the teratogenic events induced by retinoic acid. Retinoyl-β-glucuronide is much less teratogenic than atRA and crosses the placenta to the fetus at a much slower rate.27) Therefore, suppression of the formation of this compound could result in a decrease in the bioavailability of this important regulator.
From these results, we can only speculate on the putative mechanism of the observed UBT2B7 mRNA suppression in response to biologically active retinoids. Since all the major physiological effects of retinoids are mediated by nuclear receptors, one has to acknowledge the possible role of the nuclear receptors in this process. Several recent studies have demonstrated that in some cases ligand-activated hormone and orphan receptors, such as the glucocorticoid receptor (GR), thyroid receptor (TR), and farnesoid X receptor (FXR), can suppress gene transcription, producing deleterious effects,28–31) and mechanisms accounting for this negative regulation have been proposed. A picture emerges of negative transcriptional regulation by nuclear receptors involving two basic mechanisms. One major form of this regulation occurs as a result of interaction between nuclear receptors and other transcriptional factors, including AP-1 and Oct-1.32) Ligand-activated GR and retinoic acid receptor were shown to interact with AP-1 in a DNA-independent manner and repress the induction of gene expression by AP-1.33,34) Another form based on the binding of ligand activated nuclear receptors to specialized negative response elements has been observed for GR,31) TR,28) the Vitamin D receptor,35) and most recently FXR.29,30) Growing evidence has been collected that ligand-activated FXR is involved in the negative regulation of a number of target genes encoding drug transporters, and drug metabolizing enzymes.29,30) The most significant examples are P450 7A136) and cholesterol 12α-hydroxylase.37) Evidence has also been presented showing suppression of apolipoprotein A-I by activated FXR binding to negative FXR response elements.29)
The phenomenon of nuclear receptor mediated negative transcriptional regulation has also been observed for UGTs.30) These studies from our laboratory revealed that lithocholic acid (LCA) dramatically decreased UGT2B7 mRNA expression in Caco-2 cells.30) We demonstrated that the mechanism of this negative regulation is mediated by the interaction of LCA-activated FXR with a specific negative FXR response element in the UGT2B7 gene promoter. We cannot currently conclude that UGT2B7 gene suppression by retinoids and, consequently, the metabolism of these compounds in intestinal cells, is regulated through a retinoid-specific receptor, such as RAR or RXR, but the fact that the RAR agonist, TTNPB, shows the highest potency of UGT2B7 gene suppression does suggest that this regulation might be at the transcriptional level. Experiments are in progress to identify the exact mechanism involved.
In summary, the present studies provide another novel example of the suppression of UGT2B7 in response to pharmacological concentrations of its substrate, in this case biologically active retinoids. It is important to emphasize that the inhibition of the constitutively expressed human UGT2B7, an isoform that is recognized as one of the most effective detoxification enzyme widely expressed in the body, may significantly contribute to the frequently observed toxicity of retinoids.
Acknowledgement
We would like to thank Joanna Little for suggestions and careful reading of the manuscript.
This work was supported by Tobacco Settlement funds from UAMS and a grant from the National Institutes of Health (DK60109) to A.R-P.
Abbreviations
- 4-OH RA
4-hydroxy
- AP-1
activator protein-1
- atRA
all trans retinoic acid
- CYP
cytochrome P450
- FXR
farnesoid X receptor
- GR
glucocorticoid receptor
- LCA
lithocholic acid
- Oct-1
octamer binding protein-1
- RAR
retinoic acid receptor
- RXR
retinoid X receptor
- TR
thyroid receptor
- TTNPB
(E)-4-[2-(5,6,7,8-tetrahydro-5,5,8,8-tetra-methyl-2-naphthylenyl)-1-propenyl]benzoic acid
- UGT
UDP-glucuronosyltransferase
References
- 1.Ross SA, McCaffery PJ, Drager UC, De Luca LM. Retinoids in embryonal development. Physiol Rev. 2000;80:1021–1054. doi: 10.1152/physrev.2000.80.3.1021. [DOI] [PubMed] [Google Scholar]
- 2.Nagpal S, Chandraratna RA. Vitamin A and regulation of gene expression. Curr. Opin. Clin. Nutr. Metab. Care. 1998;1:341–346. doi: 10.1097/00075197-199807000-00005. [DOI] [PubMed] [Google Scholar]
- 3.Bastien J, Rochette-Egly C. Nuclear retinoid receptors and the transcription of retinoid-target genes. Gene. 2004;328:1–16. doi: 10.1016/j.gene.2003.12.005. [DOI] [PubMed] [Google Scholar]
- 4.Robertson KA, Emami B, Mueller L, Collins SJ. Multiple members of the retinoic acid receptor family are capable of mediating the granulocytic differentiation of HL-60 cells. Mol. Cell. Biol. 1992;12:3743–3749. doi: 10.1128/mcb.12.9.3743-3749.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Heyman RA, Mangelsdorf DJ, Dyck JA, Stein RB, Eichele G, Evans RM, Thaller C. 9-cis retinoic acid is a high affinity ligand for the retinoid X receptor. Cell. 1992;68:397–406. doi: 10.1016/0092-8674(92)90479-v. [DOI] [PubMed] [Google Scholar]
- 6.Schule R, Rangarajan P, Yang N, Kliewer S, Ransone LJ, Bolado J, Verma IM, Evans RM. Retinoic Acid is a Negative Regulator of AP-1-Responsive Genes. Proc. Natl. Acad. Sci. USA. 1991;88:6092–6096. doi: 10.1073/pnas.88.14.6092. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Fisher GJ, Voorhees JJ. Molecular mechanisms of photoaging and its prevention by retinoic acid: ultraviolet irradiation induces MAP kinase signal transduction cascades that induce Ap-1-regulated matrix metalloproteinases that degrade human skin in vivo. J. Investig. Dermatol. 1998;3:61–68. [PubMed] [Google Scholar]
- 8.Lampen A, Meyer S, Nau H. Effects of Receptor-Selective Retinoids on CYP26 Gene Expression and Metabolism of All-trans-Retinoic Acid in Intestinal Cells. Drug. Metab. Dispos. 2001;29:742–747. [PubMed] [Google Scholar]
- 9.McSorley LC, Daly AK. Identification of human cytochrome P450 isoforms that contribute to all-trans-retinoic acid 4-hydroxylation. Biochemical Pharmacology. 2000;60:517. doi: 10.1016/s0006-2952(00)00356-7. [DOI] [PubMed] [Google Scholar]
- 10.Taimi M, Helvig C, Wisniewski J, Ramshaw H, White J, Amad MA, Korczak B, Petkovich M. A Novel Human Cytochrome P450, CYP26C1, Involved in Metabolism of 9-cis and All-trans Isomers of Retinoic Acid. J. Biol. Chem. 2004;279:77–85. doi: 10.1074/jbc.M308337200. [DOI] [PubMed] [Google Scholar]
- 11.Zhang Q-Y, Dunbar D, Kaminsky L. Human Cytochrome P-450 Metabolism of Retinals to Retinoic Acids. Drug Metab. Dispos. 2000;28:292–297. [PubMed] [Google Scholar]
- 12.Nishimura M, Yaguti H, Yoshitsugu H, Naito S, Satoh T. Tissue distribution of mRNA expression of human cytochrome P450 isoforms assessed by high-sensitivity real-time reverse transcription PCR. Yakugaku Zasshi. 2003;123:369–375. doi: 10.1248/yakushi.123.369. [DOI] [PubMed] [Google Scholar]
- 13.Harrison EH. Mechanisms of digestion and absorption of dietary vitamin A. Annu. Rev. Nutr. 2005;25:87–103. doi: 10.1146/annurev.nutr.25.050304.092614. [DOI] [PubMed] [Google Scholar]
- 14.Lampen A, Meyer S, Arnhold T, Nau H. Metabolism of Vitamin A and Its Active Metabolite All-trans-retinoic Acid in Small Intestinal Enterocytes. J. Pharmacol. Exp. Ther. 2000;295:979–985. [PubMed] [Google Scholar]
- 15.Samokyszyn VM, Gall WE, Zawada G, Freyaldenhoven MA, Chen G, Mackenzie PI, Tephly TR, Radominska-Pandya A. 4-hydroxyretinoic acid, a novel substrate for human liver microsomal UDP-glucuronosyltransferase(s) and recombinant UGT2B7. J. Biol. Chem. 2000;275:6908–6914. doi: 10.1074/jbc.275.10.6908. [DOI] [PubMed] [Google Scholar]
- 16.Czernik PJ, Little JM, Barone GW, Raufman JP, Radominska-Pandya A. Glucuronidation of estrogens and retinoic acid and expression of UDP-glucuronosyltransferase 2B7 in human intestinal mucosa. Drug Metab. Dispos. 2000;28:1210–1216. [PubMed] [Google Scholar]
- 17.Barua AB, Olson JA. Retinoyl beta-glucuronide: an endogenous compound of human blood. Am. J. Clin. Nutr. 1986;43:481–495. doi: 10.1093/ajcn/43.4.481. [DOI] [PubMed] [Google Scholar]
- 18.Napoli JL. Biochemical pathways of retinoid transport, metabolism, and signal transduction. Clinical Immunology & Immunopathology. 1996;80:S52–S62. doi: 10.1006/clin.1996.0142. [DOI] [PubMed] [Google Scholar]
- 19.Idres N, Marill J, Flexor MA, Chabot GG. Activation of retinoic acid receptor-dependent transcription by all-trans-retinoic acid metabolites and isomers. J. Biol. Chem. 2002;277:31491–31498. doi: 10.1074/jbc.M205016200. [DOI] [PubMed] [Google Scholar]
- 20.Bull AW, Steffensen KR, Leers J, Rafter JJ. Activation of PPAR gamma in colon tumor cell lines by oxidized metabolites of linoleic acid, endogenous ligands for PPAR gamma. Carcinogenesis. 2003;24:1717–1722. doi: 10.1093/carcin/bgg131. [DOI] [PubMed] [Google Scholar]
- 21.Genchi G, Wang W, Barua A, Bidlack WR, Olson JA. Formation of beta-glucuronides and of beta-galacturonides of various retinoids catalyzed by induced and noninduced microsomal UDP-glucuronosyltransferases of rat liver. Biochim. Biophys. Acta. 1996;1289:284–290. doi: 10.1016/0304-4165(95)00168-9. [DOI] [PubMed] [Google Scholar]
- 22.Russell RM. The vitamin A spectrum: from deficiency to toxicity. Am. J. Clin. Nutr. 2000;71:878–884. doi: 10.1093/ajcn/71.4.878. [DOI] [PubMed] [Google Scholar]
- 23.Collins MD, Mao GE. Teratology of retinoids. Annu. Rev. Pharmacol. Toxicol. 1999;39:399–430. doi: 10.1146/annurev.pharmtox.39.1.399. [DOI] [PubMed] [Google Scholar]
- 24.Silverman AK, Ellis CN, Voorhees JJ. Hypervitaminosis A syndrome: a paradigm of retinoid side effects. J. Am. Acad. Dermatol. 1987;16:1027–1039. doi: 10.1016/s0190-9622(87)70133-9. [DOI] [PubMed] [Google Scholar]
- 25.Radominska-Pandya A, Little JM, Czernik PJ. Human UDP-glucuronosyltransferase 2B7. Curr. Drug. Metab. 2001;2:283–298. doi: 10.2174/1389200013338379. [DOI] [PubMed] [Google Scholar]
- 26.Zile MH, Cullum ME, Simpson RU, Barua AB, Swartz DA. Induction of Differentiation of Human Promyelocytic Leukemia Cell Line HL-60 by Retinoyl Glucuronide, a Biologically Active Metabolite of Vitamin A. Proc. Natl. Acad. Sci. USA. 1987;84:2208–2212. doi: 10.1073/pnas.84.8.2208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Gunning DB, Barua AB, Olson JA. Comparative teratogenicity and metabolism of all-trans retinoic acid, all-trans retinoyl beta-glucose, and all-trans retinoyl beta-glucuronide in pregnant Sprague-Dawley rats. Teratology. 1993:29–36. doi: 10.1002/tera.1420470107. [DOI] [PubMed] [Google Scholar]
- 28.Berghagen H, Ragnhildstveit E, Krogsrud K, Thuestad G, Apriletti J, Saatcioglu F. Corepressor SMRT functions as a coactivator for thyroid hormone receptor T3Ralpha from a negative hormone response element. J. Biol. Chem. 2002;277:49517–49522. doi: 10.1074/jbc.M209546200. [DOI] [PubMed] [Google Scholar]
- 29.Claudel T, Sturm E, Duez H, Torra IP, Sirvent A, Kosykh V, Fruchart JC, Dallongeville J, Hum DW, Kuipers F, Staels B. Bile acid-activated nuclear receptor FXR suppresses apolipoprotein A-I transcription via a negative FXR response element. J. Clin. Invest. 2002;109:961–971. doi: 10.1172/JCI14505. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Lu Y, Heydel JM, Li X, Bratton S, Lindblom T, Radominska-Pandya A. Lithocholic acid decreases expression of UGT2B7 in Caco-2 cells: a potential role for a negative farnesoid X receptor response element. Drug Metab. Dispos. 2005;33:937–946. doi: 10.1124/dmd.104.003061. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Ou XM, Storring JM, Kushwaha N, Albert PR. Heterodimerization of mineralocorticoid and glucocorticoid receptors at a novel negative response element of the 5-HT1A receptor gene. J. Biol. Chem. 2001;276:14299–14307. doi: 10.1074/jbc.M005363200. [DOI] [PubMed] [Google Scholar]
- 32.Felli MP, Vacca A, Meco D, Screpanti I, Farina AR, Maroder M, Martinotti S, Petrangeli E, Frati L, Gulino A. Retinoic acid-induced down-regulation of the interleukin-2 promoter via cis-regulatory sequences containing an octamer motif. Mol. Cell. Biol. 1991;11:4771–4778. doi: 10.1128/mcb.11.9.4771-4778.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Karin M, Chang L. AP-1-glucocorticoid receptor crosstalk taken to a higher level. J. Endocrinol. 2001;169:447–451. doi: 10.1677/joe.0.1690447. [DOI] [PubMed] [Google Scholar]
- 34.Mehta K. Retinoids as regulators of gene transcription. J. Biol. Regul. Homeost Agents. 2003;17:1–12. [PubMed] [Google Scholar]
- 35.Okazaki T, Nishimori S, Ogata E, Fujita T. Vitamin D-dependent recruitment of DNA-PK to the chromatinized negative vitamin D response element in the PTHrP gene is required for gene repression by vitamin D. Biochem. Biophys. Res. Commun. 2003;304:632–637. doi: 10.1016/s0006-291x(03)00651-x. [DOI] [PubMed] [Google Scholar]
- 36.Xu G, Li H, Pan LX, Shang Q, Honda A, Ananthanarayanan M, Erickson SK, Shneider BL, Shefer S, Bollineni J, Forman BM, Matsuzaki Y, Suchy FJ, Tint GS, Salen G. FXR-mediated down-regulation of CYP7A1 dominates LXRalpha in long-term cholesterol-fed NZW rabbits. J. Lipid Res. 2003;44:1956–1962. doi: 10.1194/jlr.M300182-JLR200. [DOI] [PubMed] [Google Scholar]
- 37.Fayard E, Schoonjans K, Auwerx J. Xol INXS: role of the liver X and the farnesol X receptors. Curr. Opin. Lipidol. 2001;12:113–120. doi: 10.1097/00041433-200104000-00004. [DOI] [PubMed] [Google Scholar]





