Extracellular pyrophosphate metabolism and calcification in vascular smooth muscle

Abstract

Extracellular inorganic pyrophosphate (ePP_i) is an important endogenous inhibitor of vascular calcification, but it is not known whether systemic or local vascular PP_i metabolism controls calcification. To determine the role of ePP_i in vascular smooth muscle, we identified the pathways responsible for ePP_i production and hydrolysis in rat and mouse aortas and manipulated them to demonstrate their role in the calcification of isolated aortas in culture. Rat and mouse aortas contained mRNA for ectonucleotide pyrophosphatase/phosphodiesterases (NPP1–3), the putative PP_i transporter ANK, and tissue-nonspecific alkaline phosphatase (TNAP). Synthesis of PP_i from ATP in aortas was blocked by β,γ-methylene-ATP, an inhibitor of NPPs. Aortas from mice lacking NPP1 (Enpp1^−/−) did not synthesize PP_i from ATP and exhibited increased calcification in culture. Although ANK-mediated transport of PP_i could not be demonstrated in aortas, aortas from mutant (ank/ank) mice calcified more in culture than did aortas from normal (ANK/ANK) mice. Hydrolysis of PP_i was reduced 25% by β,γ-methylene-ATP and 50% by inhibition of TNAP. Hydrolysis of PP_i was increased in cells overexpressing TNAP or NPP3 but not NPP1 and was not reduced in Enpp1^−/− aortas. Overexpression of TNAP increased calcification of cultured aortas. The results show that smooth muscle NPP1 and TNAP control vascular calcification through effects on synthesis and hydrolysis of ePP_i, indicating an important inhibitory role of locally produced PP_i. Smooth muscle ANK also affects calcification, but this may not be mediated through transport of PP_i. NPP3 is identified as an additional pyrophosphatase that could influence vascular calcification.

extracellular inorganic pyrophosphate (ePP_i) is a potent suppressor of vascular calcification both in vitro (8) and in vivo (13, 18) through its ability to inhibit hydroxyapatite formation (10). The importance of endogenous ePP_i homeostasis in human cardiovascular function is demonstrated by the severe arterial calcification that occurs in the absence of a synthetic enzyme (17). Cells contain ectoenzymes capable of synthesizing and hydrolyzing ePP_i, and our previous studies in cultured vascular smooth muscle cells have implicated them in the control of ePP_i levels (15). However, it is not clear whether ePP_i levels in vessels in vivo are controlled by local activity of these enzymes rather than by systemic activity via circulating ePP_i levels and whether this affects vascular calcification. Although circulating PP_i levels are inversely proportional to arterial calcification in patients with advanced chronic kidney disease (14), the correlation is weak and the role of PP_i metabolism in the arterial wall has never been investigated.

PP_i is synthesized from extracellular ATP by the ectoenzyme nucleotide pyrophosphatase/phosphodiesterase-1 (NPP1), and absence of this enzyme leads to extensive and fatal arterial calcification in children (17) and aortic calcification in mice (6, 11). The ATP analog α,β-methylene-ATP (α,β-meATP) is a competitive inhibitor of this reaction that reduces ePP_i production in vascular smooth muscle cells (15), suggesting that NPP1 is a major source of PP_i in vascular smooth muscle. However, cultured cells may not be representative of intact tissue and the high inhibitor concentrations raise questions about the specificity, particularly for other members of this enzyme family (NPP2 and NPP3), the role of which in ePP_i metabolism is unknown.

An alternative source of ePP_i may be transport out of cells through the putative transporter transporter ANK. Mice that are homozygous for a mutation in ANK (ank/ank) develop aortic calcification on a high-phosphate diet (11). Expression in oocytes induces PP_i transport (4), and expression in cultured cells decreases intracellular PP_i levels and increases PP_i levels in the medium (5, 15). However, transport of PP_i has never been directly demonstrated in cultured cells or in tissues.

Tissue-nonspecific alkaline phosphatase (TNAP) hydrolyzes PP_i to orthophosphate and is a major determinant of hydroxyapatite formation in bone or ectopically by virtue of eliminating inhibitory PP_i (11). Calcification of rat aortas in culture is induced by adding alkaline phosphatase (8) and prevented by TNAP inhibitors (12), and TNAP is upregulated in aortas from uremic rats, resulting in increased PP_i hydrolysis (9). Whether increased activity of TNAP is sufficient to produce vascular calcification is unknown. The fact that only 50% of ePP_i hydrolysis is prevented by TNAP inhibitors is consistent with the fact that PP_i hydrolysis is reduced only 50% in aortas from mice lacking TNAP (9) and indicates that additional, but as yet unknown, enzymes are responsible in aorta (9). The recent demonstration that NPP1 can also hydrolyze PP_i (1, 20) suggests that its role in ePP_i homeostasis is more complex.

Despite the importance of ePP_i in arterial calcification, its metabolism in intact vessels has never been studied and the relative importance of the different components in the local control of vascular calcification is unknown. This study examined the expression and activity of the different components of ePP_i metabolism in rat and mouse aortas and determined their local role in vascular calcification using an organ culture model.

METHODS

Animals.

Male Sprague-Dawley rats (200–400 g) were obtained form Charles River Laboratories (Wilmington, MA), and ank/ank mice were obtained from Jackson Laboratories (Bar Harbor, ME). The Enpp1^−/− mice have been described previously (6, 11). All protocols were approved by the Institutional Animal Care and Use Committee at Emory University.

Vessel studies.

Aortas were perfused with saline and removed, followed by gentle removal of the adventitia. Endothelium was removed by gentle rubbing with a cotton swab except when the vessels were used for culture. Aortic rings were cultured in serum-free DMEM containing 3.8 mM phosphate, and calcification was measured as ⁴⁵Ca incorporation as previously described (8).

RT-PCR.

Total RNA was isolated from rats or mice aorta using RNAzol RT reagent (Molecular Research Center, Cincinnati, OH). Following DNase treatment, reverse transcription was done by 1 ug of RNA samples using Thermoscript RT-PCR kit (Invitrogen). For each sample, 18S rRNA was used as an internal control. PCR was performed with Platimum PCR SuperMix (Invitrogen) and using the following cycle parameters: 94°C for 2 min and 30 cycles at 94°C for 15 s, 55°C for 30 s, and 72°C for 40 s with final extension at 72°C for 10 min. Products were separated by 1% (wt/vol) agarose gel electrophoresis and visualized by ethidium bromide fluorescence. The primer pairs used for rat have been previously reported (7). Primers for mouse were designed to cross intro-exon boundaries using Clone Manager Suite 7 software (Sci Ed Software, Durham, NC) and are listed in Table 1.

Table 1.

Primer sequences for RT-PCR

Name	Direction	Sequence (5′-3′)	GenBank	Amplicon
NTPD1 mouse	F	CTTTGGCGCTTTGGATCTCG	NM_009848.3	355
	R	TCTGGTGGCACTGTTCGTAG
NTPD2 mouse	F	CTGGAGGCAGTGACACAGAC	NM_009849.2	396
	R	TGGGTGGAGTAGCCCTTTGG
NTPD3 mouse	F	TGCCTACAGACCCACTAGAC	AY714060.1	319
	R	TCAGAAGGAGCAACCCTGAC
ENPP1 mouse	F	CTTTGGCGCTTTGGATCTCG	NM_008813.3	410
	R	CTTTGGCGCTTTGGATCTCG
ENPP2 mouse	F	CTGGAGGCAGTGACACAGAC	NM_001136077.1	401
	R	TGGGTGGAGTAGCCCTTTGG
ENPP3 mouse	F	CTCCTTCCCTACCATCTAC	NM_134005.2	223
	R	GACCCTCCATCAACATTCC
TNAP mouse	F	GCAAGGACATCGCATATCAG	BC065175	387
	R	CTTCCACCAGCAAGAAGAAG
ANK mouse	F	CAGTTTCCTGGTGGGATGTG	AF274752.1	495
	R	TTGATGTGGGCTGAGGTG
18S mouse	F	GAAACGGCTACCACATCCAAGG	X00686.1	482
	R	GTCCCTCTTAATCATGGCCTCAG

NTPD1-3, nucleotide triphosphate diphosphohydrolase-1–3; ENPP1–3, ectonucleotide pyrophosphatase/phosphodiesterase-1–3; TNAP, tissue-nonspecific alkaline phosphatase; F, forward; R, reverse.

Transfections.

Aortas were infected with an adenovirus (Ad-TNAP) containing full-length human TNAP cDNA with enhanced GFP cDNA. The cDNA coding human TNAP (AB011406) was generated by PCR using primers 1) 5′-Aaa AAGCTT GCC ACC atg ATT TCA CCA TTC-3′; 2) 5′-aaa GGTACC tca GAA CAG GAC GCT CAG GG-3′ from plasmid pDNA3.TNAP, and cloned into the adenovirus vector pAd.track-CMV at the Hind III and Kpn 1 restriction sites. Purified vector was linearized using Pme I and cotransformed with 100 ng pAdEasy-1 supercoiled vector (100 ng/μl) into BJ5183 cells by electroporation. Clones containing the pAd-easy-TNAP were selected using kanamycin and verified by Pac I digestion. The virus was then amplified in HEK293H cells (Invitrogen) and purified by adeno-X virus purification kit (Clontech, Mountain View, CA). Virus titer was determined by serial dilution and calculated as transduction units (TU/ml) as follows: (infected cells/field) × (field/well)/volume virus (ml) × dilution factor. Rat aortas with endothelium removed were cultured as above with 10⁹ TU/ml Ad-TNAP virus.

Transfections of HEK cells for enzyme studies were performed by cloning cDNAs into the pcDNA3 plasmid and transfection with Effectene transfection reagent (Qiagen, Valencia, CA) following the manufacturer's instruction. The eNPP3 plasmid was obtained from Applied Biosystems (Carlsbad, CA).

PP_i assay.

PP_i was measured enzymatically as previously described using either uridine-diphosphoglucose (UDP-glucose) pyrophosphorylase and UDP[¹⁴C]glucose (14) or ATP-sulfurylase and adenosine phosphosulfate to generate ATP, which was measured by a coupled luciferin/luciferase reaction (15).

PP_i metabolism.

Aortas or cells were incubated with [γ³²P]ATP or ³²PP_i in a physiologic salt solution (142 mM Na⁺, 121 Cl⁻, 5.4 mM K⁺, 1.8 mM Ca²⁺, 0.8 mM Mg²⁺, 5 mM glucose, and 24 mM HEPES pH 7.4). Orthophosphate was separated from ATP or PP_i in the medium by the acid-molybdate method as previously described (9). PP_i production was measured by chromatography on PEI-cellulose plates developed with 650 mM KH₂PO₄ pH 3. After autoradiography, spots were scraped and counted by liquid scintillation. Uptake of PP_i was measured was measured after the aortas were washed six times in cold salt solution without ³²PP_i. After assays, the rings were dried and weighed, or the protein content of cultured cells was measured.

Inhibitors.

β,γ-methylene-ATP (β,γ-meATP) and α,β-meATP were obtained from Sigma-Aldrich (St. Louis, MO) and used at 300-μM final concentration. Probenecid was from the same source and used at 2.5 mM. Compound MLS38949 (PubChem CID 2931234) or 2,5-dimethoxy-N-(quinolin-3-yl)benzenesulfonamide is a potent TNAP inhibitor with excellent selectivity over other alkaline phosphatases recently identified through high-throughput screening (3, 19). MLS38949 was used at a final concentration of 30 μM.

Statistics.

Results are expressed as means ± SE. Significance was determined by Student's t-test or by ANOVA. A P value of ≤ 0.05 was considered to be significant.

RESULTS

Expression of mRNA.

Normal rat aortas were probed for the presence of mRNA for proteins involved in extracellular ATP and PP_i metabolism. The relevant ectonucleotidases include the NPPs, which generate PP_i from ATP, the nucleotide triphosphate diphosphohydrolases (NTPDs), which cleave ATP to generate P_i, and TNAP, which hydrolyzes ATP and PP_i to P_i. In addition, the ANK protein may mediate PP_i efflux from cells. As shown in Fig. 1, there was significant expression of NPP1, NPP3, NTPD3, and ANK, and lower levels of NTPD1 and TNAP. There was no significant expression of NPP2 or NTPD2.

Fig. 1.

RT-PCR of RNA from aortas. RNA was prepared from freshly isolated aortas as described in the methods. Reaction volumes contained dilutions of reverse transcription products (1:10 to 1:10,000) synthesized from 5 μg of total RNA. ENPP1–3, ectonucleotide pyrophosphatase/phosphodiesterase-1–3; NTPD, nucleotide triphosphate diphosphohydrolase; TNAP, tissue-nonspecific alkaline phosphatase.

PP_i synthesis.

Despite numerous attempts with sensitive assays, we were unable to detect release of PP_i from rat aortas into incubation medium under basal conditions. Synthesis of PP_i could only be detected when exogenous ATP was added and only as ³²PP_i synthesized from [γ³²P]ATP. ATP hydrolysis was rapid, with 50% hydrolyzed after 20 min and 100% hydrolyzed after 1 h, corresponding to initial rates of 17.4 ± 0.41 and 2.08 ± 0.05 pmol·mg⁻¹·min⁻¹ from 1 and 0.1 μM ATP, respectively. Thin-layer chromatography revealed that only a small proportion (7.3 ± 0.9%) of the ATP was converted to PP_i, with the remainder appearing as orthophosphate (Fig. 2). Some of this PP_i is a contaminant of the [γ³²P]ATP preparation, since a small amount was present in medium incubated without aorta. The rate of PP_i production from 1 μM ATP was 1.27 ± 0.03 pmol·mg⁻¹·min⁻¹. Synthesis of PP_i was completely prevented by the addition of 300 μM β,γ-meATP, an inhibitor of NPP1 (7), or by α,β-meATP, an inhibitor of NPPs and NTPDs (7), but was not affected by inhibition of TNAP. The additional spot probably represents α,β-me[γ³²P]ATP derived from the transfer of ³²P from ATP to α,β-meADP via nucleoside diphosphokinases (7). As shown in Fig. 3, A and B, similar findings were obtained in normal mouse aortas, but in aortas from Enpp1^−/− mice, PP_i levels did not increase above baseline and were not affected by β,γ-meATP. Because the meATPs are substrates for NPPs and NTPDs and are rapidly hydrolyzed, they are not suitable for long-term inhibition of NPP1. Therefore, aortas from Enpp1^−/− mice were used to examine the role of NPP1 in vascular calcification. Calcification of these aortas was modestly but significantly greater than of aortas from wild-type littermates (Fig. 3C). The variability in calcification is due to the difficulty in isolating and preparing the mouse aortas without injury, which can induce calcification by itself.

Fig. 2.

Synthesis of pyrophosphate (PP_i) from ATP by rat aorta. A: autoradiogram of a representative thin-layer chromatogram of medium after incubation of aortic rings with [γ³²P]ATP in 1 μM ATP with or without 300 μM α,β-methylene-ATP (α,β-meATP), 300 μM β,γ-meATP, or 30 μM MLS38949. B: quantification of radioactivity. Results are normalized to inorganic pyrophosphate (PP_i) production in the absence of aorta and are the means of 3 experiments. *P < 0.001, **P < 0.01 vs. control.

Fig. 3.

Synthesis of PP_i and calcification in aortas from mice lacking NPP1. A: autoradiogram of a representative thin-layer chromatogram of medium after incubation of aortic rings with [γ³²P]ATP in 1 uM ATP with or without 30 μM MLS38949, 300 μM α,β-meATP, or 300 μM β,γ-meATP. B: quantification of PP_i production. Results are the means of 6 experiments. *P < 0.01 vs. control; **P < 0.01 vs. wild-type (WT). C: calcification of aortas from wild-type mice and mice lacking NPP1 (Enpp1^−/−). Symbols represent individual rings and means ± SE. Results are from 1 representative experiment. Similar results were obtained in 2 additional experiments. *P < 0.05.

PP_i transport.

The inability to load sufficient quantities of PP_i into smooth muscle coupled with intracellular hydrolysis precluded measurement of PP_i efflux. Since influx of PP_i has been reported in oocytes expressing ANK (4), measurement of PP_i influx was attempted in aortas. To distinguish cellular uptake from binding or trapping of PP_i in the extracellular matrix, uptake was also measured in devitalized (frozen and thawed) aortas. As shown in Fig. 4A, there was rapid uptake of ³²PP_i in the first 15 min that was also present in devitalized aortas and remained constant thereafter, consistent with extracellular binding or trapping. However, uptake continued in a linear fashion in normal aortas and presumably represented cellular uptake. As shown in Fig. 4B, uptake was similar in rat and mouse aortas and was not reduced in aortas from ank/ank mice lacking a functional ANK protein. However, calcification was significantly greater in aortas from ank/ank mice compared with ANK/ANK littermates (Fig. 4C).

Fig. 4.

PP transport and calcification in aortas. A: uptake of PP_i in normal and devitalized (frozen and thawed) rat aortas. Results are means ± SE of triplicate measurements; PP_i concentration was 5 μM. B: uptake of PP_i in rat aortas and in aortas from ank/ank mice and wild-type (ANK/ANK) littermates. Results are means ± SE of triplicate measurements for rat aortas and 8 measurements in mouse aortas; time was 180 min.; PP_i concentration was 1 μM. C: calcification of aortas from ank/ank mice and wild-type (ANK/ANK) littermates. Each symbol indicates a separate animal. *P < 0.01.

PP_i hydrolysis.

Hydrolysis of ePP_i was measured by incubating aortas with 1 or 5 uM PP_i containing tracer ³²PP_i, with resulting rates of 0.24 ± 0.01 and 1.27 ± 0.05 pmol·mg⁻¹·min⁻¹. Approximately 50% was inhibited by MLS38949, a potent and highly specific inhibitor of TNAP that inhibits <10% of NPP1 activity (3). Half of the remaining hydrolysis was inhibited by α,β-meATP or β,γ-meATP (Fig. 5A). The effect of the inhibitors was additive. The role of TNAP in calcification was tested in cultured aortas. Since normal aortas do not calcify in culture, even in the presence of high-phosphate concentrations, it was necessary to induce calcification to test the effect of TNAP inhibition. This was accomplished by injuring the aortas through rubbing with a cotton swab as previously described (8). The subsequent calcification was inhibited by the TNAP inhibitor MLS38949 (Fig. 5B). The effect of increased TNAP activity was tested by viral transduction of TNAP into cultured aortas using a GFP-labeled construct, which resulted in extensive cellular labeling (Fig. 5C). This produced an increase in activity compared with transduction of the empty virus (Fig. 5D) that ranged from 2.08-fold to 3.43-fold in three experiments and a significant increase in calcification (Fig. 5E).

Fig. 5.

Hydrolysis of PP_i and calcification in aortas. A: hydrolysis of PP_i (1 μM) by rat aorta with or without 30 μM MLS38949, 300 μM α,β-meATP, or 300 μM β,γ-meATP. Results are the means ± SE of 3–5 experiments. *P < 0.001 vs. control; **P < 0.001 vs. MLS38949, by paired analysis. B: calcification of injured aortas cultured without or with 30 μM MLS38949. Results are the means ± SE of 8 aortic rings. *P < 0.005. C: fluorescence microscopy of rat aorta transduced with GFP-containing adenovirus showing expression of GFP in individual cells. Line indicates 500 μm. D: alkaline phosphatase activity in aortas exposed to Ad-TNAP or empty virus. Concentration of levamisole was 1 mM. Results from a representative experiment are shown. E: calcification of aortic rings cultured with Ad-TNAP or empty virus. Symbols represent individual rings and means ± SE. *P < 0.05.

The inhibition of PP_i hydrolysis by the meATPs suggested involvement of an NPP, and this was investigated by overexpressing these enzymes in HEK cells (Fig. 6A). Hydrolysis of PP_i was significantly increased after transfection of TNAP or NPP3 but not NPP1. To ensure that transfection of NPP1 resulted in increased activity, hydrolysis of [γ³²P]ATP was examined, using treatment of the medium with inorganic pyrophosphatase before extraction to identify PP_i (Fig. 6B). Production of orthophosphate from ATP did not vary with the transfections, but PP_i production was significantly greater in cells transfected with NPP1 or NPP3, confirming successful transfection. PP_i hydrolysis did not differ between aortas from Enpp1^−/− mice and aortas from wild-type littermates and was still inhibited by β,γ-meATP in the Enpp1^−/− aortas (Fig. 6C).

Fig. 6.

Role of NPP1 and NPP3 in PP hydrolysis. A: hydrolysis of PP_i (5 μM) in HEK cells overexpressing ectoenzymes. Results are the means ± SE of 5 experiments, each performed in duplicate or triplicate. *P < 0.02 vs. control, by paired, one-tailed testing. B: hydrolysis of ATP (1 μM) in the same cells. Results are the means ± SE of a single experiment performed in triplicate. Similar results were obtained in an additional experiment. *P < 0.05, by one-tailed t-test. C: hydrolysis of PPi (1 μM) by aortas from Enpp1 mice and wild-type littermates without and with 300 μM β,γ-meATP. Results are the means ± SE of 3–4 different mice, each assayed in duplicate.

DISCUSSION

This is the first examination of ePP_i and ATP metabolism and its role in smooth muscle calcification in intact vessels. The results indicate that ectoenzymes and transporters capable of producing and clearing ePP_i are present in vascular smooth muscle (Fig. 7) and influence vascular calcification in a manner consistent with an important, local inhibitory role of PP_i.

Fig. 7.

Diagram of ePP_i metabolism in vascular smooth muscle. PP_i is synthesized by NPP1 and 3 from ATP released from cells. Another source is transport of PP_i across the cell membrane, possibly mediated by ANK, which may also mediate ATP release. PP_i is hydrolyzed by TNAP and NPP3. NTPDs are very active in vascular smooth muscle and could limit availability of ATP for synthesis of PP_i.

Analysis of mRNA transcripts from aorta indicated expression of NPP1, TNAP, and ANK, all of which have been implicated in ePP_i metabolism. There was also expression of NPP3 but not NPP2. The NPP family consists of seven single-span transmembrane proteins except for NPP2, which is secreted (21), and only NPPs 1–3 have been implicated in the hydrolysis of nucleotides. Expression of NTPD1 and NTPD3 was also detected. Members of the NTP (apyrase) family can hydrolyze nucleoside 5′-triphosphates and diphosphates with varying preferences for the type of nucleotide (16). Of these, NTPDs 1–3 are ectoenzymes. Although they do not directly participate in ePP_i metabolism, they could influence it by reducing the availability of extracellular ATP. The pattern of expression of these ectoenzymes in rat and mouse aorta parallels that in vascular smooth muscle cells in culture (15).

We (15) have previously demonstrated that extracellular ATP is the major source of ePP_i in vascular smooth muscle cells, presumably mediated by NPP1 based on inhibition by β,γ-meATP. This inhibitor also prevented PP_i production from ATP in aortas, and the absence of PP_i synthesis from ATP in Enpp1^−/− aortas definitively demonstrates that NPP1 is the sole source of PP_i from extracellular ATP in vascular smooth muscle. The results also indicate that NPP1 was completely inhibited at the concentration of β,γ-meATP that was used. Since neither [γ³²P]ATP nor β,γ-meATP is likely to enter cells, intracellular NPP1 would not be detected or inhibited. However, this enzyme is not known to function intracellularly and this would not contribute to extracellular PP_i levels. The rate constant of PP_i hydrolysis in aortas was fivefold less than the rate constant of ATP hydrolysis, and, since the concentration of PP_i produced from ATP was far less than the starting ATP concentration, hydrolysis of PP_i should not have interfered with the measurement of PP_i synthesis. This is borne out by the fact that PP_i synthesis was not altered by inhibition of TNAP.

Aortas exhibited a progressive uptake of PP_i that could not be accounted for by binding to the extracellular matrix and presumably represents cellular uptake. This is the first demonstration of PP_i transport in a tissue and the first in vascular cells. However, uptake did not differ between aortas from ANK/ANK and ank/ank mice, indicating that it is not mediated by ANK. Although it is possible that ANK mediates only efflux and not influx of PP_i, its expression in oocytes resulted in measurable influx (4), consistent with bidirectional transport. However, it is possible that ANK is misoriented in oocytes and does not mediate influx under normal conditions. Despite having similar PP_i uptake, aortas from ank/ank mice exhibited significantly greater calcification than wild-type aortas, indicating an important local role for ANK in vascular calcification. In addition to ANK mediating efflux but not influx of PP_i, another possible explanation is that ANK transports another compound involved in ePPi metabolism such as ATP. The latter is supported by recent data showing that overexpression of ANK in chondrocytes leads to an increase in extracellular ATP (2).

Based on inhibition by MLS38949, a potent and specific inhibitor of TNAP (3, 19), this enzyme is responsible for half the PP_i hydrolysis in vascular smooth muscle. This is consistent with our previous results (9) using the less potent and specific inhibitor levamisole and the measurement of PP_i hydrolysis in aortas from mice lacking TNAP. Approximately 25% of PP_i hydrolysis was blocked by α,β-meATP and β,γ-meATP, both in absence and presence of TNAP inhibitor, suggesting involvement of one of the NPPs. The fact that NPP3 but not NPP1 increased PP_i hydrolysis in HEK cells and the fact that PP_i hydrolysis was not altered in aortas from Enpp1^−/− mice suggest that NPP3 rather than NPP1 contributes to PP_i hydrolysis in vascular smooth muscle. Although purified NPP1 has been shown to hydrolyze PP_i at millimolar concentrations in osteoblast-derived matrix vesicles (1) and in proteoliposomes (20), the results in aorta indicate that NPP1 does not hydrolyze PP_i in vascular smooth muscle under physiologic conditions. Expression of NPP3 in HEK cells also increased PP_i production from ATP, indicating that it may also contribute to ePP_i synthesis. These potential roles of NPP3 in ePP_i metabolism have not previously been demonstrated.

Genetic studies have implicated ePP_i metabolism in the development of vascular calcification but whether these findings are due to alterations in local or systemic ePP_i metabolism is unknown. The cultured aorta model provides a means to test this and demonstrated increased calcification in the absence of NPP1 or ANK, or in the presence of excess TNAP, suggesting that these proteins can act locally to affect extracellular PP_i levels in vascular smooth muscle. In particular, the results indicate an important role for TNAP, which is consistent with its critical role in bone mineralization (11) and the upregulation of vascular TNAP in uremia, a condition associated with medial vascular calcification (9).

The results also indicate an important role for extracellular ATP as a source of ePPi in vascular smooth muscle. Nucleotides can be released from cells by vesicular exocytosis or selective transport via ATP channels and nucleotide transporters and can be generated extracellularly by adenylate kinase and nucleoside diphosphokinase. The source in vascular smooth muscle is unknown. In addition to NPPs, ATP can be cleaved by NTPDs. This was the major pathway in rat and mouse aortas comprising ∼90% of the ATP clearance rate. This contrasts with cultured smooth muscle cells, wherein ∼50% of added ATP is cleaved to PP_i (15). This indicates that cultured cells may not accurately reflect extracellular ATP metabolism in arteries and also suggests that changes in the relative abundance of NPP1 and NTPs could alter ePP_i metabolism and vascular calcification.

Unlike cultured cells, there was no measurable release of PP_i from cultured aortas in the absence of added ATP. It is unlikely that this is due to the absence of ATP release or PP_i release, since calcification was increased in aortas from Enpp1^−/− and ank/ank mice. This implies that there is basal production of ePP_i but it is too low to measure. However, some estimates can be made from the data obtained in this study. Based on the reported range of 10⁻⁹-10⁻⁷ M for extracellular ATP (22) and the rate constant determined in this study for PP_i production from ATP (and assuming equilibration of medium ATP with extracellular ATP), PP_i production via NPP1 should be 1.27–127 pmol·mg⁻¹·min⁻¹. Assuming an extracellular PPi concentration of 0.3–0.5 μM, which is the minimum level for inhibition of hydroxyapatite formation (10), and the rate constant measured in this study, the rate of PP_i hydrolysis should be ≥72–120 pmol·g⁻¹·min⁻¹, which exceeds the rate of PP_i synthesis except at the highest extracellular ATP concentration. This is consistent with the lack of PP_i release from aortas and the role of ePP_i hydrolysis as the major determinant of calcification. The fact that vascular smooth muscle may be a net PP_i-consuming tissue suggests that circulating ePP_i could be an important determinant of extracellular PPi levels and calcification in vascular smooth muscle in vivo.

GRANTS

This work was supported by National Institutes of Health Grants DK-069681, GM-36387, and HL-101899 and a Predoctoral Fellowship from the Government of Aragón, Spain (B086/2007 to R. Villa-Bellosta).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).