Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Jul 1.
Published in final edited form as: Clin Cancer Res. 2011 May 10;17(13):4484–4493. doi: 10.1158/1078-0432.CCR-11-0575

Distinguishing inflammation from tumor and peritumoral edema by myeloperoxidase magnetic resonance imaging

Molecular MRI of intracerebral inflammation

Anne Kleijn 1,4,*, John W Chen 2,*, Jason S Buhrman 1, Gregory R Wojtkiewicz 2, Yoshiko Iwamoto 2, Martine L Lamfers 4, Anat O Stemmer-Rachamimov 3, Samuel D Rabkin 1, Ralph Weissleder 2, Robert L Martuza 1, Giulia Fulci 1
PMCID: PMC3131449  NIHMSID: NIHMS295480  PMID: 21558403

Abstract

Purpose

Inflammation occurs routinely when managing gliomas and is not easily distinguishable from tumor re-growth with current magnetic resonance imaging (MRI) methods. The lack of non-invasive technologies that monitor inflammation prevents us to understand whether it is beneficial or detrimental for the patient, and current therapies do not take this host response in consideration. We aim to establish whether a gadolinium (Gd)-based agent targeting the inflammatory enzyme myeloperoxidase (MPO) can selectively detect intra- and peri-tumoral inflammation as well as glioma response to treatment by MRI.

Methods

We performed serial MPO-Gd-MRI before and after treating rodent gliomas with different doses of oncolytic virus (OV) and analyzed animal survival. The imaging results were compared to histo-pathological and molecular analyses of the tumors for macrophage/microglia infiltration, virus persistence and MPO levels.

Results

Elevated MPO activity was observed by MRI inside the tumor and in the peritumoral cerebrum at day 1 post-OV, which corresponded with activation/infiltration of myeloid cells inhibiting OV intratumoral persistence. MPO activity decreased as the virus and the immune cells were cleared (days 1–7 post-OV), while tumor size increased. A ten-fold increase of viral dose temporally decreased tumor size, but augmented MPO activity, thus preventing extension of viral intratumoral persistence.

Conclusions

MPO-Gd-MRI can distinguish enhancement patterns that reflect treatment-induced spatio-temporal changes of intratumoral and intracerebral inflammation from those indicating tumor and peritumoral edema. This technology improves the post-treatment diagnosis of gliomas and will increase our understanding of the role of inflammation in cancer therapy.

Introduction

Management of brain tumors induces inflammatory responses that interfere with tumor imaging and monitoring the treatment course. Inflammation may also influence the outcome of the therapy in two opposite ways. It can lead to tumor control, by killing cancer cells and establishing an anti-cancer immunity (1–8), or to tumor promotion, by participating in glioma reoccurrence and progression (9–17). It is thus important to establish a non-invasive imaging technique that monitors intracerebral inflammation and distinguishes it from tumor in order to understand the clinical and physiological consequences of this host response, and to efficiently diagnose the outcome of cancer treatments that enhance or inhibit local inflammation.

Oncolytic viruses (OV) present a great potential for the treatment of malignant gliomas, due to their capacity to replicate in situ and reach peripheral invasive cancer cells. However, OV are very immunogenic and, despite their replication capacity, are rapidly cleared from the tumor by inflammatory cells that engulf virus-infected cancer cells (18–23). Because OV-induced inflammation is rapid and precisely localized, it is an optimal model to establish techniques for in vivo imaging of intra-cerebral inflammation during glioma treatment.

Myeloperoxidase (MPO) is an inflammatory enzyme present in myeloid cells (neutrophils, microglia, and macrophages). It is secreted during inflammation by activated, pro-inflammatory subsets of these cells (24). MPO utilizes hydrogen peroxide to catalyze the formation of reactive oxygen species that: kill pathogens, covalently modify lipids, cause local damage, and further activate the inflammatory cascade (24, 25). Gd-bis-5-HT-DTPA (MPO-Gd) is a molecular magnetic resonance imaging (MRI) agent that reports MPO activity with high specificity and sensitivity (26–31). This agent has been validated in vivo to evaluate MPO activity and inflammation in atherosclerosis (32), experimental autoimmune encephalomyelitis (33), stroke (26), and myocardial ischemia (28). Imaging of MPO activity is possible because of a prolonged gadolinium (Gd) enhancement caused by MPO-mediated oxidation of the Gd-chelating agent which induces its polymerization and trapping in the tumor mesh (26, 27, 30, 34). Therefore, immediately after MPO-Gd administration the MRI highlights areas of vessel leakage in the tumor and allows measurement of tumor size, whereas prolonged enhancement observed 1–2 hours after injection of the agent reflects MPO activity.

We have investigated the possibility of using MPO-Gd-MRI to analyze intratumoral and intracerebral inflammation during glioma treatment with OV and tested whether such inflammation was associated with improved therapeutic response. To do this, we have examined the patterns of MPO-Gd-MRI contrast enhancement in two different rodent glioma models (the rat D74-HveC and the mouse CT-2A gliomas) treated with different doses of the oncolytic herpes simplex virus hrR3 (35), and compared the imaging results with the extent of intratumoral/intracerebral infiltration/activation of inflammatory cells, viral load, MPO levels, and animal survival.

Our results indicate that MPO-Gd MRI reports the in vivo spatiotemporal evolution of the OV-induced inflammatory response and provides a powerful tool to understand the role of inflammation during glioma OV-treatment.

Materials and Methods

Cells, tumor implantation and treatment

D74/HveC rat glioma cells (36) were grown in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal calf serum (FCS) and 7.5 µg/mL blasticidin S (Calbiochem®, EMD Biosciences Inc., La Jolla, CA, USA); CT-2A mouse glioma cells [provided by Dr. Thomas Seyfried, Boston College (37)] were grown in DMEM with 10% FCS.

Male Fischer 344 rats (Taconic Farms Inc., Germantown, NY, USA) and C57BL/6J mice (NCI, Frederick, MD) were kept according to the guidelines of the Subcommittee on Research Animal Care of MGH. Tumors were implanted using stereotaxy as described (36). Seven days after implantation, 105 or 106 plaque forming units (pfu) of hrR3 or equivalent volume of phosphate buffer (PBS) were injected in the tumor using the same procedure and stereotactic coordinates as for the cancer cells.

LacZ and MPO gene expression analysis

Total RNA from the anterior quarter of the tumor-bearing cerebrum was extracted with the RNeasy Lipid Tissue kit (Qiagen, Valencia, CA, USA), from animals treated with virus (106 or 105 pfu) or PBS (5 µl) for 1, 3, or 6 days. Three animals for each treatment-group/virus-dose/time-point were used. cDNA was synthesized using the Omniscript™ Reverse Transcriptase Kit (Qiagen, 205113) and random primers (Invitrogen, Carlsbad, CA). TaqMan PCR was performed with the ABI Prism® 7000 HT Sequence detection system and TaqMan PCR Master Mix (Applied Biosystems, Foster City, CA, USA). PCR reaction mix included a 25 µL aqueous solution containing each primer at 0.9 µM, the probe at 200 nM, and 2 µL of diluted cDNA. The PCR program included 1 cycle of 2 minutes at 50°C, 1 cycle of 10 minutes at 95°C, and 40 cycles comprising 15 seconds at 95°C followed by 1 minute at 60°C. 18S rRNA was used as internal control. Relative quantification of gene expression was calculated as 2ΔCt lacZ or MPO/2ΔCt r18S, ΔCt = difference between the numbers of cycles needed to reach saturation for the same gene in two different treatment groups. Primers: LacZ forward–tgttgccactcgctttaatgat, reverse–actcgccgcacatctgaact, probe-6FAM-cgctgtactggaggc-TAMRA; 18S rRNA forward-gggcccgaagcgtttact, reverse-ttccctagctgcggtatcca, probe-6FAM-caaagcaggcccgagccgc-TAMRA; MPO forward-tggctggagtgcgatcttc, reverse-cgtgcatctgccagtttgag, probe-6FAM-tgaggccgatactgtc-TAMRA.

Immunohistochemistry (IHC)

Rodent brains from animals treated with 105 pfu of virus or 5 µl PBS for 1, 3 or 9 days (3 animals/treatment-group/time-point) were frozen in an isopentane dry-ice bath and sectioned through the entire tumor volume. Every fifth section was collected for analysis. Tissue slides were fixed in ice-cold acetone, and stained as follows. After blocking endogenous proteins and peroxidases with serum-free protein block (X0909) and peroxidase-blocking reagent (002428) (DAKO-Cytomation, Glostrup, Denmark), sections were incubated 1 hour at room temperature with the following primary antibodies (all antibodies from Serotec, Kidlington, Oxford, UK, except for MPO antibody from Neomarkers, Fremont, CA): mouse anti-rat CD68 (MCA 341R) and CD163 (MCA 342R), rat anti-mouse F4/80 (MCA497RT), and rabbit anti-human Myeloperoxidase (Ab-1). For bright-field staining the slides were then incubated with a horseradish peroxidase-conjugated (HRP) secondary antibody (ECL anti-mouse IgG, NA931V, Amersham Biosciences Ltd, Little Chalfont, Buckinghamshire, UK, and anti-rabbit IgG BA-1000, Vector Laboratories, Burlingame, CA), a Liquid DAB Substrate Chromogen System used for detection (K3465, DAKO-Cytomation), and hematoxylin for counterstaining. For fluorescent staining the slides were incubated with an anti-rat IgG-FITC secondary antibody (Jackson Immunology, West Grove, PA, cat# 115-095-166) and mounted with propidium-iodide Vectashield mounting medium H-1300 (Vector Laboratories, Burlingame, CA).

The paraffin embedded human brain sections were deparaffinized, rehydrated, and treated with 1% Sodium Dodecyl Sulphate before staining. The rabbit anti-human Myeloperoxidase (Ab-1) (Neomarkers), mouse anti-human CD68 and CD163 (AbD Serotec P34810 and Q86VB7) were used with the same secondary antibodies as above.

Intratumoral viral spread was analyzed by detecting β-galactosidase activity with X-gal (5-bromo-4-chloro-3-inodolyl-β-D-galactopyranoside, Sigma-Aldrich, St. Louis, MO).

Spectrophotometric assay for MPO activity

The anterior quarter of the tumor-containing cerebrum treated with 105 pfu of virus or 5 µl of PBS for 1, 3 or 6 days (5 animals/group/time-point) was extracted, weighed, and homogenized in 50 mM potassium phosphate buffer at pH 6.0. After centrifugation, the pellet was re-suspended in cetyltrimethylammonium bromide buffer (Sigma-Aldrich), homogenized again, and sonicated. After three cycles of freeze-thaw-sonication, the cell lysates were centrifuged and the supernatants were collected. Protein concentration was measured with the BCA Protein Assay kit (23225, Pierce, Thermo Fischer Scientific, Rockford, IL). The protein extracts were then used to measure MPO activity by detecting Amplite ADHP (AAT Bioquest, Sunnyvale, CA) oxidation through spectrophotometry at 535 nm. The units of activity were computed according to the formula: activity (U/mL) = (ΔOD × Vt × 4)/(E × Δt × Vs) where ΔOD is the change in absorbance, Vt is the total volume, Vs is the sample volume, E is the extinction coefficient=3.9 × 104 M−1s−1, and Δt is the change in time. The resulting activity was normalized to 1 mg of protein or 1 mg of tissue to derive the specific activity. The specificity of the MPO activity was tested by adding 4-aminobenzyoic acid hydrazide to the protein lysates before the spectrophotometric reading (38).

MR Imaging

Rats treated with 105 or 106 pfu of virus or 5 µl PBS for 1, 3 or 7 days (3 animals/treatment-group/viral-dose/time-point) were anesthetized with isoflurane (2.0 % at 2 L/min) and imaged using a 4.7-Tesla, 16-cm bore MRI system (Bruker Pharmascan, Billerica, MA). Rats were imaged one day before and 1, 3 and 7 days after injection of hrR3. MR images were acquired before and for 2 hours after the intravenous administration of MPO-Gd [synthesized as previously described (29) from DTPA-Gd (Magnevist, Berlex Laboratories), and injected at 0.3 mmol/kg mouse and 0.1 mmol/kg rat] using a T1-weighted rapid-acquisition with refocused echoes (RARE) sequence (repetition time [TR] = 800 ms, echo time [TE] = 13 ms, matrix [MTX] = 192 × 192, slice thickness = 1.0 mm, number of excitations [NEX] = 8, field of view [FOV] = 2.5 cm for mouse and 3.5 cm for rats). T2-weighted imaging was also performed (TR=4217 ms, TE=60 ms, MTX = 192 × 192, slice thickness = 0.8 mm, NEX = 8, FOV is the same as for T1-weighted sequences). Standard DTPA-Gd was used in control animals to verify that MPO-Gd enhancement was specific for MPO activity.

MRI data analysis

Regions of interest (ROI) including the tumor, contralateral brain tissue, and muscle were selected using the freeware OsiriX (www.oxirix-viewer.com). Contrast-to-noise ratios (CNRs) were computed for each ROI with the formula: CNR = (postcontrast ROIlesion −postcontrast ROImuscle)/SDnoise) − (precontrast ROIlesion − precontrast ROImuscle)/SDnoise), where ROIlesion is the ROI of the enhancing areas, and SDnoise is the standard deviation of noise measured from an ROI placed in an empty area of the image. CNRs were normalized by dividing each CNR by the highest CNR to enable comparison between different animals. Activation ratios (ARs) were computed by dividing the CNR of the late phase (75 minutes) over the CNR of the early phase (first post-contrast images, 5 minutes) to account for nonspecific enhancement from leakage. Tumor radius was computed by measuring the maximum transverse dimension.

Statistical analysis

Comparisons between multiple groups were performed with 2-sided ANOVA test followed by means comparisons with post hoc Tukey’s test using the software Prism (Graphpad Software Inc. La Jolla, CA). Comparison between two groups was performed using the student t-test. A p-value < 0.05 was considered to be statistically significant. All error bars indicate SEM.

Results

Kinetics of activation and recruitment of inflammatory cells

We have previously established that treatment of a rat glioma with hrR3 induces intratumoral recruitment of mature peripheral macrophages (CD68+/CD163+) and activation of brain inflammatory cells (CD68+/CD163−) that accumulate around the tumor borders (19, 20). To use OV-treatment as a model for establishing in vivo imaging techniques of intracerebral/intratumoral inflammation, we analyzed the kinetics of CD68+ and CD163+ cells activation/recruitment during treatment of the D74-HveC rat glioma with hrR3 beginning one day post viral injection to a point when the animals appeared moribund (6 days from PBS injection in control animals, and 9 days from viral dosing in treated rats), which was considered as end of therapy. Because both these inflammatory cells subtypes engulfed hrR3-infected cancer cells (19, 20), we compared this kinetic profile with the kinetics of viral clearance.

The virus was gradually and completely cleared from the tumor between day 1 post viral dosing and the end of therapy (Figure 1). The intratumoral viral concentration matched with activation/infiltration of CD68+ and CD163+ cells which were prominent at day 1 post virus (compared to animals receiving PBS), decreased at day 3, and were similar to control in moribund animals.

Figure 1. Correlation of hrR3 clearance with activation/infiltration of CD68+ and CD163+ immune cells in the rat D74-HveC glioma.

Figure 1

1) Decrease of viral intratumoral spread (LacZ: blue) between days 1 and 9 post-hrR3 (black arrows indicate persisting OV clones); 2) CD68+ cells (brown) in the tumor and peritumoral area (black arrows) in animals receiving hrR3 (CD68-hrR3) or PBS (CD68-PBS); 3) CD163+ cells (brown) localized exclusively inside the tumor of hrR3- and PBS-treated animals (CD163-hrR3 and CD163-PBS). For each time-point adjacent slides are shown.

Because brain inflammatory cells produce high levels of MPO (31, 39), we hypothesized that MPO-Gd-MRI could monitor OV-induced infiltration and activation of CD68+ and CD163+ cells. To test this hypothesis, we analyzed whether the kinetics of activation/infiltration of these inflammatory cells and viral clearance corresponded to changes in MPO mRNA levels and enzymatic activity (Figure 2). For this assay, rats with established D74-Hvec gliomas were treated with PBS (controls) or hrR3 and sacrificed at days 1, 3 and 6 after virus injection. We chose 6 days as the last time point because of the high mortality of the control rats. We found that more than 90% of viral LacZ mRNA is cleared from the tumor between days 1 and 3 and the remainder is cleared by day 6 (undetectable by RT-PCR, Figure 2A). Accordingly, we observed the highest levels of MPO mRNA and activity at day 1 post viral dosing and both significantly decreased by day 3 (Figure 2B–D). No MPO mRNA levels were detected by RT-PCR in control animals and at day 6 after virus injection, however, we could still observe some MPO activity in both these situations (Figure 2B,C). The decrease of MPO activity between days 3 and 6 was not very strong in OV-treated animals and demonstrated a high variability among animals, suggesting that intratumoral decrease of macrophages is ongoing but not yet fully established as observed when rats appear moribund (Figure 2C). Because it is impossible to precisely dissect the tumor tissue from adjacent cerebrum these assays do not distinguish between intratumoral and peritumoral MPO activity. However, IHC staining of rat brains harboring gliomas and treated with OV or PBS clearly shows the presence of MPO in both the intratumoral and peritumoral areas (Supplementary Figure S1), thus matching the distribution of CD68+ and CD163+ cells observed in Figure 1.

Figure 2. Kinetics of intracerebral viral LacZ and host MPO mRNA levels and of MPO activity.

Figure 2

A,B) Decrease in viral LacZ and host MPO mRNA levels between days (d) 1 and 6 post-hrR3 (N=3). The mRNA levels at day 1 were arbitrary considered as 1 and the fold of decrease at day 3 and day 6 from day 1 were calculated. At each time point we also collected RNA from animals treated with PBS, but no LacZ or MPO mRNA was detected in this control group and is indicated with a dotted flat line at 0. C) Average MPO activity (N=5) in excised rat brains bearing glioma treated with hrR3 (continued curve) or PBS (dotted flat line) for 1, 3 and 6 days (significant difference only between day 6 and day 1 post-hrR3, and at day 1 and 3 between PBS and hrR3-treated animals, p<0.0001). The specificity of the assay for MPO activity was established in a preliminary experiment by inhibiting MPO with 4-aminobenzyoic acid hydrazide (ABAH, (38)) before the spectrophotometric reading (D).

We have previously reported on the similarity of inflammatory cellular responses in mice and rats carrying human or syngeneic gliomas treated with different types of OV (19, 20, 22, 23). Accordingly, comparison of hrR3 spread in the CT-2A mouse glioma between 6 and 72 hours from OV injection showed that most of the intratumoral virus was cleared within 3 days of delivery, and this matched with infiltration of F4/80+ macrophages (Figure 3A), as well as increased MPO mRNA levels and enzymatic activity (Figure 3B). Moreover, the GBM from a patient treated with the oncolytic adenovirus ONYX-015 (40) also presented infiltration of CD68+ and CD163+ cells (20) expressing MPO (Supplementary Figure S2).

Figure 3. Intratumoral hrR3 persistence, macrophage infiltration, and MPO levels in the mouse CT-2A glioma.

Figure 3

Figure 3

A) Decrease of intratumoral hrR3 (blue) between 6 and 72 hours post-OV, and infiltration of F4/80+ macrophages (green) into the tumor (red, propidium iodide) treated with hrR3 or PBS for 72 hours. The images show almost the whole tumor area, which occupies the entire photographic field. B) MPO mRNA (fold-induction in hrR3 versus PBS, N=3) and enzymatic activity (N=5) in brains with CT-2A gliomas treated with hrR3 or PBS.

Altogether, these data indicate that the inflammatory response induced by OV is associated with MPO mRNA levels and enzymatic activity. This phenomenon is not species-specific and suggests the possibility to image inflammation in vivo with MPO-Gd-MRI.

MPO-Gd MRI during OV-treatment

We determined if MPO-Gd-MRI could detect the kinetics of CD68+ and CD163+ cells activation/infiltration observed by IHC and distinguish the areas of inflammation from the bulk tumor tissue. We imaged rats carrying D74-HveC tumors 1 day pre-viral dosing for tumor baseline signal, and 1, 3 and 7 days post-hrR3 (Figure 4). Each imaging session included analysis of tumor size (we measured the diameter of the region enhancing 5 minutes after injection of the MPO-Gd contrast agent), and quantification of the MPO activation ratio (determined by analyzing the persistence of the contrast 75 minutes after injection of MPO-Gd). We could not image the animals after day 7 post viral dosing because of a rapid health decline.

Figure 4. MPO-Gd-MRI during oncolytic virotherapy of rat gliomas.

Figure 4

Figure 4

A) MRI scans of 1 rat with D74-HveC tumor pre- (day 0) and post-hrR3 (days 1, 3 and 7) performed 5 and 75 minutes after MPO-Gd injection. The black circles indicate the tumor area determined from the scans at 5 minutes post-MPO-Gd; black arrows indicate areas of enhancement in peritumoral area; at day 1 and day 3 the enhancement reaches areas distal from the tumor, whereas at day 7 it is concentrated at the tumor border. B) MRI scans of one rat at day-1 post-hrR3 for 5 and 75 minutes post-injection of DTPA-Gd. C) Kinetics of intra- and peritumoral MPO-Gd enhancement in 3 rats treated with hrR3 (p values for significant temporal differences are indicated). D) Comparison of MRI-calculated MPO activation rate in animals imaged with MPO-Gd or with DTPA-Gd at 1 day post-OV. E) Kinetics of tumor growth (maximum tumor radius=MTD) in rats treated with PBS or OV.

Before viral dosing (day 0) the MPO-Gd enhancement faded over time during the imaging session, indicating low MPO activity (Figure 4A). At days 1 and 3 post-virus, the MPO-Gd contrast decreased comparably slower inside the tumor center and increased in the parenchyma surrounding the tumor (Figure 4A). Calculation of the MPO activation ratio from MPO-Gd-MRI showed a 3-fold increase between days 0 and 1 and a trend of decrease from day 1 to 7 (Figure 4C), which matched with the MPO activity measured through the enzymatic assays (Figure 2C). At day 7 most of the enhancement in the center of the tumor faded 75 minutes after MPO-Gd injection (Figure 4A,C) and few CD163+ macrophages were detected by histopathology in these tumors (Supplementary Figure S3). However, there was persistence of MPO-Gd contrast at the periphery between the tumor and the brain parenchyma and histopathology revealed accumulation of CD68+ cells in the same regions (Supplementary Figure S3). MRI performed at day 1 after OV treatment using standard DTPA-Gd as contrast agent indicated rapid leakage of this agent from the tumor tissue and adjacent brain (Figure 4B,D). These results demonstrate that MPO-Gd contrast enhancement comes from MPO secreted by two distinct cell populations, inside and surrounding the treated tumor, reflecting a difference in the host response to OV therapy.

Comparison of images obtained through MPO-Gd MRI with those obtained using dextran-coated iron oxide particles (MION), which are incorporated by phagocytes and confer superparamagnetic properties to these cells (41), on animals treated with hrR3 for 3 days indicates that these two technologies for in vivo imaging of immune cells overlap only partially. MION imaging did not detect the peritumoral area of inflammation visible through MPO-Gd MRI, but had a broader distribution inside the tumor (Supplementary Figure S3).

Analysis of tumor size (Figure 4E) indicated tumor growth between days 0 and 1. This growth was slower between days 1 and 3 post-hrR3 injection, and became again pronounced between days 3 and 7. The retardation of tumor growth observed between days 1 and 3 is likely due to the oncolytic activity of the virus and was not observed in animals treated with PBS. Notably, the overall trend of tumor size change after virotherapy, as reported on the diameters measured by MRI at 5 minutes after delivery of the contrast agent, is opposite of the trend of in vivo MPO activity measured from delayed images (75 minutes post MPO-Gd, compare Figures 4C and 4E), underscoring that this technology can distinguish areas of inflammation from the tumor tissue.

We then imaged and measured hrR3-mediated induction of MPO activity with MPO-Gd MRI in mice carrying the CT-2A glioma (Figure 5). Also in this case, we detected a spatiotemporal change in the enhancement pattern between the early and delayed images, which differentiated tumor from inflammation. We found that increased in vivo MPO activity reported by molecular MRI following viral treatment matched with the infiltration of F4/80+ monocytic cells (Figure 3) and with increased MPO activity measured through enzymatic assays on excised tumors (Figure 3), suggesting that this technology is applicable to different species.

Figure 5. MPO-Gd-MRI in the mouse CT-2A glioma.

Figure 5

A) MRI scans 5 and 75 minutes after MPO-Gd injection in one mouse with CT-2A tumor 1 day before (day 0) and 3 days post-hrR3. B) Quantification of MPO activation rate in 3 mice before and after treatment.

Increased viral dose augments the inflammatory response and does not allow prolonged viral persistence

To further match the MPO-Gd contrast enhancement with changes in virus-induced inflammation, we compared rats treated with 2 different doses of hrR3 (105 and 106 pfu). Increasing viral load at the time of injection did not change the time frame with which the virus is completely cleared; i.e. at seven days no virus was detected through RT-PCR in either treatment group (data not shown). One day after virus injection there was 10-fold difference in LacZ between these two treatment groups that related to the difference of viral dose, but the MPO mRNA levels were similar (Figure 6A,B). At day 3, the difference in LacZ mRNA between these two treatment groups was only about 2-fold and the group receiving the higher viral dose had increased MPO mRNA (Figure 6A,B). This corresponded to increased MPO activity measured by MPO-Gd-MRI (Figure 6C) and smaller tumor size (Figure 6D).

Figure 6. Treatment diagnosis in animals receiving different doses of hrR3.

Figure 6

A,B) Changes in mRNA levels for the viral LacZ and host MPO genes between animals receiving 105 pfu of hrR3 (considered as baseline level 1) and those receiving 106 pfu of virus at 1 and 3 days after treatment (N=4). C,D) Differences in MPO activation rate and tumor radius measured through MPO-Gd-MRI at 1 and 3 days post-hrR3 at 105 or 106 pfu (N=3).

Discussion

We have shown that the myeloid cells activated in the brain and infiltrating the tumor upon OV treatment induce MPO, thus allowing MR-imaging of their inflammatory activity through a gadolinium-based molecular imaging agent (27, 29). Our data indicate that the kinetics of intracerebral/intratumoral inflammation, verified by histopathology of CD68+ and CD163+ cells in a rat orthotopic glioma model treated with an oncolytic herpes simplex virus, corresponds to the kinetics of MPO activity measured on excised brains through an enzymatic assay. These changes can be tracked in vivo through MPO-Gd-MRI. The specificity of the contrast induced by MPO-Gd was proved by comparing MPO-Gd-MRI with standard DTPA-Gd-MRI. Moreover, previously published works have shown that there is no detectable MPO-Gd-MRI contrast in mice knock-out for MPO, thus emphasizing the specificity of this MRI agent (26, 28, 31). The levels of viral LacZ and host MPO mRNAs display similar kinetics. However, whereas MPO mRNA is only detectable during the acute phase of this inflammatory response, a baseline of MPO activity is always present. This could be due to a general low abundance of MPO mRNA molecules or to a dual MPO regulation system: genetic and enzymatic (42). Because MPO-Gd-MRI is reproducible in mouse and rat gliomas established in the respective syngeneic animal model, and because we have shown that activation of CD68+ and CD163+ cells is not virus-, tumor-, or species-specific and that these cells infiltrate the tumor of patients treated with OV (19, 20, 22, 23) and secrete MPO, there is high translational potential for this technology. This is strengthened by the lower toxicity of MPO-Gd compared to many clinically-approved MRI agents (30).

An important advantage of MPO-Gd-MRI is its ability to distinguish between inflammation and tumor. While inflammation decreases between days 1 and 7 post viral dosing, the tumor size increases. Moreover, comparison of animals treated with two different doses of virus show stronger inflammation and smaller tumors for animals receiving the highest viral dose. Indeed, even though OV induce other oxidases in cancer cells, MPO-Gd is specific to MPO which is expressed only in myeloid cells. Current MRI strategies are not able to distinguish between inflammatory areas from tumor re-growth. This is a recurrent diagnostic dilemma that prevents the ability of the oncologists to provide the timeliest and most suitable treatment plan to the patient. Thus, this MRI technology can solve a critical diagnostic problem for the treatment of brain tumors. To establish the broad diagnostic applicability of this technology, it is important to test its capacity to detect inflammation during other therapeutic strategies such as radiation, immunotherapies, and treatment with anti-inflammatory and anti-angiogenic drugs.

Attempts to image intracerebral inflammation through MRI were previously done using MIONs (41), which detect all phagocytic cells. However, even though this strategy can detect OV-induced intratumoral macrophages (19, 20), it does not enhance the peritumoral inflammation, nor provides information on tumor size. Conversely, MPO-Gd-MRI can identify spatiotemporal changes of active inflammatory cells infiltrating into the cancer as well as in the brain parenchyma surrounding the tumor. Fusion of MION and MPO-Gd MRI scans in the same tumor model suggests that these two strategies detect three different cellular subsets: 1) intratumoral phagocytic cells not making MPO, 2) peritumoral MPO-secreting cells that are not phagocytic and 3) intratumoral phagocytic cells that also produce MPO. It is not clear if the peritumoral cells are not enhanced by MION-MRI because MIONs do not reach them or because they are not phagocytic. We have previously published that CD68+ microglia surrounding the tumor infiltrate into the tumor region and engulf the infectious OV (20), suggesting that MIONs do not diffuse to the peritumoral parenchyma. However, the phagocytic activity of these cells may be acquired only after their infiltration into the tumor, indicating that the different cellular subsets enhanced by MION and MPO-Gd-MRI are the same cells at different stages of inflammatory activation. Further comparison and combination of these imaging technologies will allow a deeper understanding of the distinct role of individual innate immune cells in the inflammatory responses (31, 39, 43–46).

Imaging inflammation is also useful in ways other than simply recognizing it in a re-occurring tumor after a specific treatment. As our understanding of cancer biology advances, increased relevance is being given to this host defense response. Even though the role of inflammation in the ultimate therapeutic outcome is unclear (being described both as controlling and promoting tumor recurrence and progression), it is accepted that it influences tumor treatment one way or another. It is therefore crucial to establish in vivo techniques that allow understanding of the relationship between inflammation and the outcome of tumor treatment. Demand for these techniques is further emphasized by the current trend of examining drugs that modulate immune processes (such as COX-2 inhibitors and NSAIDs) as anti-cancer agents. Finally, inflammation poses a crucial dilemma in OV-treatment. Even though it is established that host innate immunity is detrimental for OV lytic activity, inflammatory cells can also kill cancer cells and synergize with OV in tumor treatment (47, 48). Virotherapies aimed at increasing and suppressing OV-induced immunity were studied and both strategies presented positive results (47, 48). In this respect, our data indicate that increasing the viral dose, temporally augments also the infiltration/activation of MPO+ cells. Even though the higher viral dose transiently decreases the tumor size, it is impossible to establish from these data whether the temporal lysis of the tumor is mediated by OV or immune cells alone, or by the combination of these two factors. Further studies comparing MPO-Gd-MRI and MION-MRI during OV-treatment in presence of anti-inflammatory or pro-inflammatory agents will bring more insights into the role that different innate immune cells may have in the therapeutic outcome.

In conclusion, MPO-Gd MRI will strongly improve our diagnostic ability of the effects of cancer treatment on the tumor versus tumor micro-environment. Imaging inflammation during pro-inflammatory and immunosuppressive therapies will allow understanding of its role in cancer treatment and on side-effects of current therapies.

Statement of translational relevance.

Glioma management induces intracerebral inflammation undistinguishable from tumor re-growth with current MRI technologies. This poses a recurrent diagnostic dilemma that prevents the ability of the oncologists to provide the patients with a suitable treatment plan in a timely fashion. Moreover, it is accepted that inflammation influences the outcome of the treatment, but the role of this host response remains controversial, being described to control as well as promote tumor recurrence and progression. Because of the lack of means to monitor inflammation in vivo, this host response is not taken in consideration by current therapies, thus preventing further understanding of its clinical significance. Herein we have addressed this diagnostic problem and have established a molecular MRI technology that tracks the spatiotemporal evolution of peri- and intra-tumoral inflammation while monitoring glioma response to treatment. Because this technology utilizes a stable gadolinium-based compound, it has a strong translational potential.

Supplementary Material

1

Acknowledgments

Funding

This work was supported by: the National Cancer Institute (R21-CA135526 to Giulia Fulci), the National Institute for Neurological Disorders (R01-NS070835, and R01-NS072167 to John Chen, R01-NS032677 to Robert Martuza, and P30-NS045776 to Samuel Rabkin), and the National Heart, Lung and Blood Institute (K08-HL081170 to John Chen) at the National Institutes of Health, USA.

References

  • 1.Auf G, Carpentier AF, Chen L, Le Clanche C, Delattre JY. Implication of macrophages in tumor rejection induced by CpG-oligodeoxynucleotides without antigen. Clin Cancer Res. 2001;7:3540–3543. [PubMed] [Google Scholar]
  • 2.Castriconi R, Daga A, Dondero A, et al. NK cells recognize and kill human glioblastoma cells with stem cell-like properties. J Immunol. 2009;182:3530–3539. doi: 10.4049/jimmunol.0802845. [DOI] [PubMed] [Google Scholar]
  • 3.Chang GH, Barbaro NM, Pieper RO. Phosphatidylserine-dependent phagocytosis of apoptotic glioma cells by normal human microglia, astrocytes, and glioma cells. Neuro Oncol. 2000;2:174–183. doi: 10.1093/neuonc/2.3.174. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Friese MA, Steinle A, Weller M. The innate immune response in the central nervous system and its role in glioma immune surveillance. Onkologie. 2004;27:487–491. doi: 10.1159/000080371. [DOI] [PubMed] [Google Scholar]
  • 5.Graf MR, Jadus MR, Hiserodt JC, Wepsic HT, Granger GA. Development of systemic immunity to glioblastoma multiforme using tumor cells genetically engineered to express the membrane-associated isoform of macrophage colony-stimulating factor. J Immunol. 1999;163:5544–5551. [PubMed] [Google Scholar]
  • 6.Graf MR, Prins RM, Merchant RE. IL-6 secretion by a rat T9 glioma clone induces a neutrophil-dependent antitumor response with resultant cellular, antiglioma immunity. J Immunol. 2001;166:121–129. doi: 10.4049/jimmunol.166.1.121. [DOI] [PubMed] [Google Scholar]
  • 7.Nickles D, Abschuetz A, Zimmer H, et al. End-stage dying glioma cells are engulfed by mouse microglia with a strain-dependent efficacy. J Neuroimmunol. 2008;197:10–20. doi: 10.1016/j.jneuroim.2008.03.022. [DOI] [PubMed] [Google Scholar]
  • 8.Wallace PK, Romet-Lemonne JL, Chokri M, Kasper LH, Fanger MW, Fadul CE. Production of macrophage-activated killer cells for targeting of glioblastoma cells with bispecific antibody to FcgammaRI and the epidermal growth factor receptor. Cancer Immunol Immunother. 2000;49:493–503. doi: 10.1007/s002620000142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Condeelis J, Pollard JW. Macrophages: obligate partners for tumor cell migration, invasion, and metastasis. Cell. 2006;124:263–266. doi: 10.1016/j.cell.2006.01.007. [DOI] [PubMed] [Google Scholar]
  • 10.Coussens LM, Werb Z. Inflammation and cancer. Nature. 2002;420:860–867. doi: 10.1038/nature01322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.de Visser KE, Korets LV, Coussens LM. De novo carcinogenesis promoted by chronic inflammation is B lymphocyte dependent. Cancer Cell. 2005;7:411–423. doi: 10.1016/j.ccr.2005.04.014. [DOI] [PubMed] [Google Scholar]
  • 12.Hussain SF, Yang D, Suki D, Grimm E, Heimberger AB. Innate immune functions of microglia isolated from human glioma patients. J Transl Med. 2006;4:15. doi: 10.1186/1479-5876-4-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Iliopoulos D, Hirsch HA, Struhl K. An epigenetic switch involving NF-kappaB, Lin28, Let-7 MicroRNA, and IL6 links inflammation to cell transformation. Cell. 2009;139:693–706. doi: 10.1016/j.cell.2009.10.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Markovic DS, Glass R, Synowitz M, Rooijen N, Kettenmann H. Microglia stimulate the invasiveness of glioma cells by increasing the activity of metalloprotease-2. J Neuropathol Exp Neurol. 2005;64:754–762. doi: 10.1097/01.jnen.0000178445.33972.a9. [DOI] [PubMed] [Google Scholar]
  • 15.Morandi E, Zingaretti C, Chiozzotto D, et al. A cDNA-microarray analysis of camptothecin resistance in glioblastoma cell lines. Cancer Lett. 2006;231:74–86. doi: 10.1016/j.canlet.2005.01.017. [DOI] [PubMed] [Google Scholar]
  • 16.Morimura T, Neuchrist C, Kitz K, et al. Monocyte subpopulations in human gliomas: expression of Fc and complement receptors and correlation with tumor proliferation. Acta Neuropathol (Berl) 1990;80:287–294. doi: 10.1007/BF00294647. [DOI] [PubMed] [Google Scholar]
  • 17.Synowitz M, Glass R, Farber K, et al. A1 adenosine receptors in microglia control glioblastoma-host interaction. Cancer Res. 2006;66:8550–8557. doi: 10.1158/0008-5472.CAN-06-0365. [DOI] [PubMed] [Google Scholar]
  • 18.Friedman A, Tian JP, Fulci G, Chiocca EA, Wang J. Glioma virotherapy: effects of innate immune suppression and increased viral replication capacity. Cancer Res. 2006;66:2314–2319. doi: 10.1158/0008-5472.CAN-05-2661. [DOI] [PubMed] [Google Scholar]
  • 19.Fulci G, Breymann L, Gianni D, et al. Cyclophosphamide enhances glioma virotherapy by inhibiting innate immune responses. Proc Natl Acad Sci U S A. 2006;103:12873–12878. doi: 10.1073/pnas.0605496103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Fulci G, Dmitrieva N, Gianni D, et al. Depletion of peripheral macrophages and brain microglia increases brain tumor titers of oncolytic viruses. Cancer Res. 2007;67:9398–9406. doi: 10.1158/0008-5472.CAN-07-1063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kurozumi K, Hardcastle J, Thakur R, et al. Effect of tumor microenvironment modulation on the efficacy of oncolytic virus therapy. J Natl Cancer Inst. 2007;99:1768–1781. doi: 10.1093/jnci/djm229. [DOI] [PubMed] [Google Scholar]
  • 22.Lamfers ML, Fulci G, Gianni D, et al. Cyclophosphamide increases transgene expression mediated by an oncolytic adenovirus in glioma-bearing mice monitored by bioluminescence imaging. Mol Ther. 2006;14:779–788. doi: 10.1016/j.ymthe.2006.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Wakimoto H, Fulci G, Tyminski E, Chiocca EA. Altered expression of antiviral cytokine mRNAs associated with cyclophosphamide's enhancement of viral oncolysis. Gene Therapy. 2004;11:214–223. doi: 10.1038/sj.gt.3302143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Arnhold J, Flemmig J. Human myeloperoxidase in innate and acquired immunity. Arch Biochem Biophys. 500:92–106. doi: 10.1016/j.abb.2010.04.008. [DOI] [PubMed] [Google Scholar]
  • 25.Saran M, Beck-Speier I, Fellerhoff B, Bauer G. Phagocytic killing of microorganisms by radical processes: consequences of the reaction of hydroxyl radicals with chloride yielding chlorine atoms. Free Radic Biol Med. 1999;26:482–490. doi: 10.1016/s0891-5849(98)00187-7. [DOI] [PubMed] [Google Scholar]
  • 26.Breckwoldt MO, Chen JW, Stangenberg L, et al. Tracking the inflammatory response in stroke in vivo by sensing the enzyme myeloperoxidase. Proc Natl Acad Sci U S A. 2008;105:18584–18589. doi: 10.1073/pnas.0803945105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Chen JW, Pham W, Weissleder R, Bogdanov A., Jr Human myeloperoxidase: a potential target for molecular MR imaging in atherosclerosis. Magn Reson Med. 2004;52:1021–1028. doi: 10.1002/mrm.20270. [DOI] [PubMed] [Google Scholar]
  • 28.Nahrendorf M, Sosnovik D, Chen JW, et al. Activatable magnetic resonance imaging agent reports myeloperoxidase activity in healing infarcts and noninvasively detects the antiinflammatory effects of atorvastatin on ischemia-reperfusion injury. Circulation. 2008;117:1153–1160. doi: 10.1161/CIRCULATIONAHA.107.756510. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Querol M, Chen JW, Weissleder R, Bogdanov A., Jr DTPA-bisamide-based MR sensor agents for peroxidase imaging. Org Lett. 2005;7:1719–1722. doi: 10.1021/ol050208v. [DOI] [PubMed] [Google Scholar]
  • 30.Rodriguez E, Nilges M, Weissleder R, Chen JW. Activatable magnetic resonance imaging agents for myeloperoxidase sensing: mechanism of activation, stability, and toxicity. J Am Chem Soc. 2010;132:168–177. doi: 10.1021/ja905274f. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Swirski FK, Wildgruber M, Ueno T, et al. Myeloperoxidase-rich Ly-6C+ myeloid cells infiltrate allografts and contribute to an imaging signature of organ rejection in mice. J Clin Invest. 2010;120:2627–2634. doi: 10.1172/JCI42304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ronald JA, Chen JW, Chen Y, et al. Enzyme-sensitive magnetic resonance imaging targeting myeloperoxidase identifies active inflammation in experimental rabbit atherosclerotic plaques. Circulation. 2009;120:592–599. doi: 10.1161/CIRCULATIONAHA.108.813998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Chen JW, Breckwoldt MO, Aikawa E, Chiang G, Weissleder R. Myeloperoxidase-targeted imaging of active inflammatory lesions in murine experimental autoimmune encephalomyelitis. Brain. 2008;131:1123–1133. doi: 10.1093/brain/awn004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Chen JW, Querol Sans M, Bogdanov A, Jr, Weissleder R. Imaging of myeloperoxidase in mice by using novel amplifiable paramagnetic substrates. Radiology. 2006;240:473–481. doi: 10.1148/radiol.2402050994. [DOI] [PubMed] [Google Scholar]
  • 35.Goldstein DJ, Weller SK. An ICP6::lacZ insertional mutagen is used to demonstrate that the UL52 gene of herpes simplex virus type 1 is required for virus growth and DNA synthesis. J Virol. 1988;62:2970–2977. doi: 10.1128/jvi.62.8.2970-2977.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Wakimoto H, Johnson PR, Knipe DM, Chiocca EA. Effects of innate immunity on herpes simplex virus and its ability to kill tumor cells. Gene Ther. 2003;10:983–990. doi: 10.1038/sj.gt.3302038. [DOI] [PubMed] [Google Scholar]
  • 37.Marsh J, Mukherjee P, Seyfried TN. Akt-dependent proapoptotic effects of dietary restriction on late-stage management of a phosphatase and tensin homologue/tuberous sclerosis complex 2-deficient mouse astrocytoma. Clin Cancer Res. 2008;14:7751–7762. doi: 10.1158/1078-0432.CCR-08-0213. [DOI] [PubMed] [Google Scholar]
  • 38.Kettle AJ, Gedye CA, Hampton MB, Winterbourn CC. Inhibition of myeloperoxidase by benzoic acid hydrazides. Biochem J. 1995;308(Pt 2):559–563. doi: 10.1042/bj3080559. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Swirski FK, Nahrendorf M, Etzrodt M, et al. Identification of splenic reservoir monocytes and their deployment to inflammatory sites. Science. 2009;325:612–616. doi: 10.1126/science.1175202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Chiocca EA, Abbed KM, Tatter S, et al. A phase I open-label, dose-escalation, multi-institutional trial of injection with an E1B-Attenuated adenovirus, ONYX-015, into the peritumoral region of recurrent malignant gliomas, in the adjuvant setting. Mol Ther. 2004;10:958–966. doi: 10.1016/j.ymthe.2004.07.021. [DOI] [PubMed] [Google Scholar]
  • 41.Moore A, Weissleder R, Bogdanov A., Jr Uptake of dextran-coated monocrystalline iron oxides in tumor cells and macrophages. Journal of Magnetic Resonance Imaging. 1997;7:1140–1145. doi: 10.1002/jmri.1880070629. [DOI] [PubMed] [Google Scholar]
  • 42.van der Veen BS, de Winther MP, Heeringa P. Myeloperoxidase: molecular mechanisms of action and their relevance to human health and disease. Antioxid Redox Signal. 2009;11:2899–2937. doi: 10.1089/ars.2009.2538. [DOI] [PubMed] [Google Scholar]
  • 43.Anderson CF, Mosser DM. A novel phenotype for an activated macrophage: the type 2 activated macrophage. J Leukoc Biol. 2002;72:101–106. [PubMed] [Google Scholar]
  • 44.Gordon S, Taylor PR. Monocyte and macrophage heterogeneity. Nat Rev Immunol. 2005;5:953–964. doi: 10.1038/nri1733. [DOI] [PubMed] [Google Scholar]
  • 45.Nahrendorf M, Swirski FK, Aikawa E, et al. The healing myocardium sequentially mobilizes two monocyte subsets with divergent and complementary functions. J Exp Med. 2007;204:3037–3047. doi: 10.1084/jem.20070885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Sunderkotter C, Nikolic T, Dillon MJ, et al. Subpopulations of mouse blood monocytes differ in maturation stage and inflammatory response. J Immunol. 2004;172:4410–4417. doi: 10.4049/jimmunol.172.7.4410. [DOI] [PubMed] [Google Scholar]
  • 47.Prestwich RJ, Errington F, Diaz RM, et al. The Case of Oncolytic Viruses vs The Immune System: Waiting On The Judgment of Solomon. Hum Gene Ther. 2009 doi: 10.1089/hum.2009.135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Stanford MM, Breitbach CJ, Bell JC, McFadden G. Innate immunity, tumor microenvironment and oncolytic virus therapy: friends or foes? Curr Opin Mol Ther. 2008;10:32–37. [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES