Abstract
Expressed sequence tags (ESTs) can be used to identify microsatellite markers. We developed 30 polymorphic microsatellite markers from 5053 ESTs of the Miichthys miiuy. Out of 123 EST derived microsatellites for which PCR primers were designed, 30 loci were polymorphic in 30 individuals from a single natural population with 2–13 alleles per locus. The observed and expected heterozygosities were from 0.1024 to 0.7917 and from 0.2732 to 0.8845, respectively. Nine loci deviated from the Hardy-Weinberg equilibrium, and linkage disequilibrium was significant between 22 pairs of loci. These polymorphic microsatellite loci will be useful for genetic diversity analysis and molecule-assisted breeding for M. miiuy.
Keywords: microsatellite, Expressed sequence tags (ESTs), Miichthys miiuy
1. Introduction
Miiuy croaker, Miichthys miiuy, is a promising marine fish species for culture in China and is distributed throughout eastern China ([1–3]. Although it is an important commercial fish species, little is known about the genetic information of miiuy croaker. There are no abundant molecular markers such as microsatellites isolated from this species. Lack of enough polymorphic molecular markers has limited development of molecular phylogeny, population structure, and conservation genetics and assisted selective breeding in this species. Thus, screening for polymorphic microsatellite or other molecular markers is necessary for analyzing genetic information in the miiuy croaker. Microsatellites are useful molecular markers to study population structure and genetic evolutionary information [4]. We have published 12 polymorphic microsatellite markers derived from two genomic libraries [5]. Up-to-date, only a few microsatellies markers are available for research in miiuy croaker.
There are many approaches for the development of microsatellite markers such as screening DNA or cDNA libraries for repeat motifs using hybridization and sequencing candidate clones [6], isolation from randomly amplified polymorphic DNA products [7], bioinformatic mining from database [8], etc. In general, the development of microsatellite markers has been limited by the labor and time required to construct, enrich, and sequence genomic libraries [9]. However, the development of microsatellite markers from expressed sequence tag (EST) database provides a rich source of valuable functional molecular markers. Herein, 30 polymorphic microsatellite markers were developed by bioinformatic mining EST sequences from M. miiuy.
2. Materials and Methods
We have constructed a normalized cDNA library from the spleen of the miiuy croaker. A total of 5053 ESTs from the library were sequenced [10]. The EST sequences were screened for mono-, di-, tri-, tetra-, penta-, and hexanucleotide repeats, 491 sequences contained repeat motifs. Primers for these partial loci were designed using PRIMER PREMIER 5.0 software (PREMIER Biosoft International, CA, USA). One hundred and twenty-three primer pairs were designed successfully. Some possessed only few repeats, which held less potential for useful polymorphism.
Genomic DNA was prepared from 30 individuals of miiuy croaker were captured from the Zhoushan fishing ground of the East China Sea. Total genomic DNA was extracted from gills using the TIANamp Genomic DNA Kit (Tiangen) following the manufacturer’s instructions. PCR amplifications were carried out in 25-μL volumes containing 2.5 μL of 10× PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPS, 0.2 μM of the forward and reverse primers, and 1.5 units of Taq polymerase (Takara). Cycling conditions were 94 °C for 4 min followed by 30 cycles of 94 °C for 40 s, annealing temperature for 45 s (see Table 1), and 72 °C for 40 s, followed by 1 cycle of 72 °C for 5 min and then holding at 4 °C. PCR amplification was performed on an ABI 9700 thermal cycler. Denatured amplified products were separated on 6% denaturing polyacrylamide (19:1 acrylamide:bis-acrylamide) gels using silver staining [6]. A denatured pBR322 DNA/MspI molecular weight marker (Tiangen) was used as a size standard to identify alleles. POPGENE32 [11] and ARLEQUIN 3.11 software [12] were used to calculate the number of alleles, observed (HO) and expected (HE) heterozygosity, violation of Hardy-Weinberg equilibrium (HWE) expectations and genotypic linkage disequilibrium. All results for multiple tests were corrected using sequential Bonferroni correction [13].
Table 1.
Characterization of 30 polymorphic expressed sequence tags (EST)-derived microsatellite markers in M. miiuy.
| Locus | GenBank Accession No. | Repeat Motif | Gene | Primer (5′-3′) [Forward (above) and Reverse (below)] | Tm (°C) | No. of Alleles | Size range (bp) | No. of Null Alleles |
HO HE |
P-Value |
|---|---|---|---|---|---|---|---|---|---|---|
| Mimi-4-C07 | GW668081 | (GAA)5 | Ras-related protein Rab-35 | TGAGGCACAATATGATGG ACCGAGGACTTGGCTACT |
52 | 5 | 249–288 | 1 | 0.1481 0.2732 |
0.0286 |
| Mimi-5-B04 | GW668148 | (AGTCAG)3 | unknown | CTACCGCTGCTCTTCTGG GATGGCTGGTCTACTTCG |
49 | 4 | 144–162 | 0 | 0.4286 0.4662 |
0.0143 |
| Mimi-5-G02 | GW668197 | (AGA)5 | NADH-cytochrome b5 reductase 2 | TGTCCGTGCTGTTCTTCC ATGGCTTATGTCCTGTTTCT |
49 | 5 | 157–169 | 0 | 0.2800 0.3502 |
0.5507 |
| Mimi-8-D03 | GW668391 | (T)14 | unknown | TTCAGTCAGGAGATTCAGGGTG CAGCGGTTCAAACGGTCA |
48 | 6 | 119–128 | 1 | 0.4231 0.7360 |
0.0020 |
| Mimi-13-G10 | GW668718 | (TTTG)5 | unknown | GCGACAACGCAGACAGGA CTTGGGCGGATGGTAGGA |
52 | 3 | 108–116 | 0 | 0.5217 0.6309 |
0.1552 |
| Mimi-16-A03 | GW668869 | (T)15 | Cytochrome c | TGGAGAACCCAAAGAAAT CCACAAAGGAGCGTCATA |
52 | 7 | 282–297 | 1 | 0.3793 0.8119 |
0.0000 * |
| Mimi-16-E10 | GW668916 | (TAGCT)5 | unknown | GTTCTTTCACTGGCATCT GCTGTTTCCACCTGTTTT |
50 | 6 | 189–224 | 1 | 0.4483 0.6062 |
0.0262 |
| Mimi-16-H01 | GW668939 | (T)12 | unknown | CAGTTGTGGGTTTGTTTG TGTGGCGATGTTTCTTGT |
52 | 7 | 137–150 | 1 | 0.5909 0.8478 |
0.0117 |
| Mimi-21-G10 | GW669314 | (TTTAT)3 | phosphatidic acid phosphatase type 2B |
GAGCGGGCTTTCCATTCA TTCCCAAATCTGGTGTCTCG |
52 | 2 | 177–182 | 1 | 0.2222 0.3522 |
0.0636 |
| Mimi-28-G08 | GW669768 | (A)14 | unknown | GGGGAAGCACTTTATG TCTTAGCGTGTTCTCGT |
52 | 5 | 199–203 | 1 | 0.1538 0.6380 |
0.0000 * |
| Mimi-29-C05 | GW669810 | (AGG)5…(T)16 | similar to transmembrane protein | AGCCCTCCTCTGCTGTGA CTGTTGCCTCCTGCCTGT |
52 | 5 | 119–126 | 1 | 0.2759 0.5590 |
0.0311 |
| Mimi-32-A10 | GW669955 | (A)14N12(T)17 | Transmembrane protein 32 precursor | GAACCACCCATCCTTTTA CTTTGCCCCTTCTGTCTA |
52 | 6 | 226–246 | 1 | 0.4348 0.7739 |
0.0008 |
| Mimi-32-B08 | GW669962 | (A)14…(T)14 | unknown | CGTCGCACCAAGAATGAG TGAAACCTACCGTCTACAAAT |
50 | 5 | 236–245 | 1 | 0.3846 0.7398 |
0.0006 * |
| Mimi-33-G06 | GW670085 | (CT)10N20(CA)9 | unknown | GGTAGGAGACTGGGTGGT CAATGTTTCAGGCAAATGTA |
50 | 5 | 259–279 | 1 | 0.4815 0.6723 |
0.0581 |
| Mimi-34-A09 | GW670103 | (A)13 | unknown | TTTGGGTCACTAAATGGT CGTCTGTAAAGCAGGTAA |
50 | 6 | 221–242 | 1 | 0.5172 0.7992 |
0.0244 |
| Mimi-35-E08 | GW670215 | (T)12 | unknown | ACGCACCCAACAACTCAG ATGCTCATCTCCGCCTTA |
50 | 3 | 175–182 | 1 | 0.1923 0.3288 |
0.0995 |
| Mimi-36-C02 | GW670261 | (TTTTC)3 | ATPase, Ca++ transporting, plasma membrane 1a | AATATCCCTGCCCTGCTA TGTTCGCCATTGTCTTGC |
50 | 4 | 207–227 | 1 | 0.1034 0.3575 |
0.0001 * |
| Mimi-40-C05 | GW670563 | (A)13 | unknown | GTGTAACAAATAACCCTCG TGCTGCTCGTCACAATAA |
50 | 4 | 131–143 | 1 | 0.4800 0.7224 |
0.0152 |
| Mimi-40-E05 | GW670585 | (AAT)5 | Krueppel-like factor 6 | AGGGCTCTGATCCATACA TTCCGAAGTGCTCTACAA |
50 | 6 | 219–243 | 1 | 0.1333 0.4418 |
0.0037 |
| Mimi-40-H12 | GW670618 | (CCT)5 | unknown | TCATCAGCACCAGCCTCT CACATCCTCTTACCTCCTATCT |
55 | 3 | 233–239 | 0 | 0.3704 0.3934 |
0.0136 |
| Mimi-41-E11 | GW670665 | (GAA)5 | unknown | CCTCCTTCACCTCACCTT ACATCTGTCCAGCCGTTT |
52 | 3 | 238–244 | 1 | 0.1379 0.4120 |
0.0002 * |
| Mimi-42-E04 | GW670734 | (ATA)7 | interleukin-8 receptor CXCR1 |
CATTCATCACGGCTCCTT TTCCCACTCTTATCTATCCA |
48 | 6 | 163–181 | 0 | 0.7200 0.8196 |
0.1213 |
| Mimi-42-G06 | GW670752 | (TCC)6 | unknown | TTGTTGTCTCGGTGATGG GACTCCTGCTGTTGCTCC |
52 | 6 | 139–181 | 0 | 0.3750 0.4787 |
0.4739 |
| Mimi-43-H04 | GW670839 | (TTTC)6 | unknown | GCTTCCTGTCCCGTTTAT TTTGCTCCCGTGGGTTAT |
52 | 13 | 141–217 | 1 | 0.6552 0.8845 |
0.6188 |
| Mimi-49-C10 | GW671186 | (A)26 | eIF5A | CGGCTTTACTTCAGTGGTT TCTCCTCCTCGGTTGTCG |
54 | 7 | 180–190 | 1 | 0.4583 0.8032 |
0.0192 |
| Mimi-52-H10 | GW671455 | (GA)9(CTGT)4… (T)14 | unknown | ACGCATTTGTTTACTTTCTC CACCACCATTCAGTTTCT |
50 | 4 | 188–202 | 1 | 0.4074 0.7939 |
0.0001 * |
| Mimi-54-A11 | GW671541 | (CTGGTC)6 | unknown | AACCAAAGGGACCAAACG GGAGCAGGCAGGTAAACG |
52 | 5 | 128–152 | 0 | 0.6207 0.7042 |
0.0000 * |
| Mimi-54-D06 | GW671567 | (T)13…(A)15 | unknown | TCCTCCCATACAAACTAA GGTGGAAGACCGAAAA |
50 | 3 | 159–163 | 0 | 0.5769 0.6750 |
0.0000 * |
| Mimi-56-G05 | GW671751 | (AGC)5 | unknown | AGACACCCGACCAGAACC ACAGCCTCCATCCACAAA |
54 | 4 | 154–160 | 0 | 0.7917 0.6764 |
0.5599 |
| Mimi-57-A05 | GW671772 | (T)14 | unknown | CTCCTGCCCTTCGTGATT TCTTTCCCTGCTTGTTGTA |
50 | 6 | 113–133 | 1 | 0.1429 0.4292 |
0.0011 * |
HO: Observed heterozygosity; HE: Expected heterozygosity; Tm: Annealing temperature;
indicates significant deviation from HWE after Bonferroni correction (P < 0.0017).
3. Results and Discussion
Details of the newly developed micorastellite loci and variability measures are summarized in Table 1. In total, 30 of 123 loci were successfully amplified and shown to be polymorphic in miiuy croaker. The number of alleles per locus ranging from two to thirteen, and observed and expected heterozygosities ranged from 0.1024 to 0.7917 and from 0.2732 to 0.8845, respectively. The remaining 93 loci were no products or monomorphic in miiuy croaker. Nine loci significantly deviated from Hardy-Weinberg equilibrium in the sampled population after sequential Bonferroni correction (P < 0.0017), possibly due to the presence of null alleles, it is thought that these null alleles were caused by genetic instability within this region, the remaining 21 loci conformed to HWE. Further, null alleles were found in twenty-two loci (Table 1) and stuttering were found in nine loci (Mimi-16-A03, Mimi-21-G10, Mimi-28-G08, Mimi-29-C05, Mimi-32-B08, Mimi-36-C02, Mimi-40-E05, Mimi-41-E11, and Mimi-52-H10) detected with MICRO-CHECKER utility after Bonferroni correction [14], but no evidence for allelic dropout were found in any of the loci. In total, 24 pairwises (Mimi-16-E10 and Mimi-5-B04, Mimi-16-E10 and Mimi-13-G10, Mimi-16-E10 and Mimi-21-G10, Mimi-49-C10 and Mimi-21-G10, Mimi-5-B04 and Mimi-21-G10, Mimi-16-A03 and Mimi-21-G10, Mimi-16-H01 and Mimi-21-G10, Mimi-49-C10 and Mimi-32-A10, Mimi-16-H01 and Mimi-32-A10, Mimi-21-G10 and Mimi-32-A10, Mimi-32-A10 and Mimi-34-A09, Mimi-34-A09 and Mimi-35-E08, Mimi-4-C07 and Mimi-36-C02, Mimi-35-E08 and Mimi-40-H12, Mimi-36-C02 and Mimi-40-H12, Mimi-35-E08 and Mimi-41-E11, Mimi-36-C02 and Mimi-41-E11, Mimi-49-C10 and Mimi-54-D06, Mimi-32-A10 and Mimi-54-D06, Mimi-32-B08 and Mimi-54-D06, Mimi-35-E08 and Mimi-57-A05, Mimi-36-C02 and Mimi-57-A05, Mimi-40-H12 and Mimi-57-A05, Mimi-41-E11 and Mimi-57-A05) significant genotypic linkage disequilibrium were found among 285 pairs of the 30 loci after Bonferroni correction (P < 0.0017).
4. Conclusions
In the present study, 30 polymorphic microsatellite DNA markers were developed by cDNA sequences. These polymorphic microsatellite loci in miiuy croaker will enable studies of the genetic variation, population structure, conservation genetics and molecular assisted selective breeding of the miiuy croaker in the future.
Acknowledgements
This study was supported by Nation Nature Science Foundation of China (31001120), Zhejiang Provincial Natural Science Foundation of China (Y3100013) and Foundation of Zhejiang Educational Committee (Y200908463).
References
- 1.Zhang QY, Hong WS. Status and prospects of artificial propagation and breeding technique of marine fish in China in the 1990s. Mod Fish Inform. 2000;15:3–6. (in Chinese) [Google Scholar]
- 2.Shan XJ, Cao L, Huang W, Dou SZ. Feeding, morphological changes and allometric growth during starvation in miiuy croaker larvae. Environ. Biol. Fishes. 2008;86:121–130. [Google Scholar]
- 3.Shan XJ, Xiao ZZ, Huang W, Dou SZ. Effects of photoperiod on growth, mortality and digestive enzymes in miiuy croaker larvae and juveniles. Aquaculture. 2008;281:70–76. [Google Scholar]
- 4.Liu YG, Liu CY, Li FZ, Li ZX, Wang L. Development of microsatellite markers in sea perch, Lateolabrax Japonicus, from codominant amplified fragment length polymorphism bands. J. World Aquacult. Soc. 2009;40:522–530. [Google Scholar]
- 5.Wang RX, Xu TJ, Sun YN, He GY. Polymorphic microsatellite loci from two enriched genomic libraries for the genetic analysis of the miiuy croaker, Miichthys miiuy. Genet. Mol. Res. 2010;9:931–934. doi: 10.4238/vol9-2gmr806. [DOI] [PubMed] [Google Scholar]
- 6.Xu TJ, Shao CW, Liao XL, Ji XS, Chen SL. Isolation and characterization of polymorphic microsatellite DNA markers in the rock bream (Oplegnathus fasciatus) Conserv. Genet. 2009;10:527–529. [Google Scholar]
- 7.Liu YG, Bao BL, Liu LX, Wang L, Lin H. Isolation and characterization of polymorphic microsatellite loci from RAPD product in half-smooth tongue sole (Cynoglossus semilaevis) and a test of cross-species amplification. Mol. Ecol. Res. 2007;8:202–204. doi: 10.1111/j.1471-8286.2007.01923.x. [DOI] [PubMed] [Google Scholar]
- 8.Ji XS, Chen SL, Ma HY, Xu TJ, Liao XL, Jiang YL. Isolation and characterization of 19 EST-linked polymorphic microsatellite loci for olive flounder (Paralichthys olivaceus) Aquacult. Res. 2009;40:980–983. [Google Scholar]
- 9.Edwards KJ, Barker JHA, Daly A, Jones C, Karp A. Microsatellite libraries enriched for several microsatellite sequences in plants. Biotechniques. 1996;20:758–760. doi: 10.2144/96205bm04. [DOI] [PubMed] [Google Scholar]
- 10.Xu TJ, Meng FX, Sun YN, Shi G, Wang RX. Identification of immune genes of the miiuy croaker (Miichthys miiuy) by sequencing and bioinformatic analysis of ESTs. Fish Shellfish Immunol. 2010;29:1099–1105. doi: 10.1016/j.fsi.2010.08.013. [DOI] [PubMed] [Google Scholar]
- 11.Yeh FC, Boyle TJB. Population genetic analysis of co-dominant and dominant markers and quantitative traits. Belg. J. Bot. 1997;129:157. [Google Scholar]
- 12.Schneider S, Roessli D, Excoffier L. ARLEQUIN: A Software for Population Genetics Date Analysis, Version 2.000. Genetics and Biometry Laboratory, Department of Anthropology, University of Geneva; Geneva, Switzerland: 2000. [Google Scholar]
- 13.Rice WE. Analyzing tables of statistical tests. Evolution. 1989;43:223–225. doi: 10.1111/j.1558-5646.1989.tb04220.x. [DOI] [PubMed] [Google Scholar]
- 14.van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. MICRO-CHECKER: software for identifying and correcting genotyping errors in mirosatellite data. Mol. Ecol. Notes. 2004;4:535–538. [Google Scholar]