Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2011 May;193(10):2642–2646. doi: 10.1128/JB.00105-11

The spoIIE Homolog of Epulopiscium sp. Type B Is Expressed Early in Intracellular Offspring Development ▿

David A Miller 1, John Howard Choat 2, Kendall D Clements 3, Esther R Angert 1,*
PMCID: PMC3133141  PMID: 21398534

Abstract

Epulopiscium sp. type B is an enormous intestinal symbiont of the surgeonfish Naso tonganus. Intracellular offspring production in Epulopiscium shares features with endospore formation. Here, we characterize the spoIIE homolog in Epulopiscium. The timing of spoIIE gene expression and presence of interacting partners suggest that the activation of σF occurs early in Epulopiscium offspring development.

TEXT

Binary fission is an efficient means of reproduction, although alternative patterns of cell division and propagation have evolved in several bacterial lineages to better accommodate particular lifestyles (2). Epulopiscium spp. and their relatives comprise a morphologically diverse group of bacterial symbionts that inhabit the intestinal tracts of surgeonfish (17, 25, 36). These Firmicutes exhibit an array of reproductive strategies that includes the formation of multiple intracellular offspring (17, 26). Epulopiscium sp. type B is the most extensively studied member of the group. These extraordinarily large, cigar-shaped cells can grow to lengths of 200 to 300 μm, with widths of 50 to 60 μm (4). They are associated with the unicornfish Naso tonganus (Family Acanthuridae) and may aid in the breakdown of algae consumed by their host (17). Epulopiscium sp. type B reproduces solely by the formation of multiple internal offspring (Fig. 1); generally, two are produced, but as many as five within a mother cell have been observed (17). In nature, intracellular offspring formation in Epulopiscium follows a recurrent daily cycle (36), leading to developmentally synchronized populations (4, 50).

Fig. 1.

Fig. 1.

Epulopiscium sp. type B life cycle. Each major developmental transition is illustrated as a longitudinal section through a cell. (A) Prior to offspring initiation, DNA appears evenly distributed around the periphery of the cytoplasm. (B) As offspring formation begins, DNA accumulates at the poles of the cell. (C) The cell divides at both poles, trapping some of the polar DNA inside the newly formed offspring. (D) The remaining polar DNA is translocated inside the polar offspring. (E to G) Offspring are engulfed by the mother cell and elongate to fill the mother cell cytoplasm. The offspring are released from the mother cell. In this drawing, DNA accumulation and polar division are shown in single cells, but in nature, these transitions occur in offspring cells still contained within a mother cell. Cell outlines and division septa are shown in black and DNA in blue.

Intracellular offspring formation in Epulopiscium spp. appears to have evolved from bacterial endospore formation (3), based on the evolutionary relationship of Epulopiscium with endospore-forming bacteria (5, 18) and morphologically defined stages that appear to be shared by the two processes (3–5). If intracellular offspring formation in Epulopiscium is related to endospore formation, we predict that genes involved early in sporulation will be conserved in Epulopiscium and used in offspring production (4).

Endospore development has been best described for Bacillus subtilis (24, 46, 54). Progression through sporulation is driven in part by the sequential activation of alternative sigma factors. One key early forespore-specific sigma factor is σF. Expression of the spoIIA operon (comprised of the spoIIAA, spoIIAB, and sigF genes) occurs during the transition from exponential growth to stationary phase (51). The anti-sigma factor SpoIIAB holds σF inactive until polar division is complete (22, 35). Initially, the anti-anti-sigma factor SpoIIAA is inactivated through phosphorylation by SpoIIAB (16, 21, 29, 35). SpoIIE dephosphorylates and thus activates SpoIIAA, which then disrupts the σF-SpoIIAB complex. Free SpoIIAB is rapidly degraded. SpoIIE and FtsZ are binding partners that colocalize to the poles of the cell (8, 9, 33, 34, 38). Once asymmetric division is complete, SpoIIE accumulates in the polar septum (9). SpoIIE localization and its higher concentration within the smaller forespore direct forespore-specific activation of σF (6, 30–32).

The major vegetative growth sigma factor σA drives transcription of the spoIIE gene (52), but prior to sporulation, spoIIE gene expression is suppressed by Soj (39, 40). Transcription of the spoIIE gene is upregulated by phosphorylated Spo0A, and spoIIE gene transcripts can be detected approximately 1.5 h after the initiation of sporulation (t1.5) (27, 52). All of these genes, the spoIIAA, spoIIAB, sigF, spoIIE, spo0A, and soj genes, are conserved in endospore-forming bacteria and essential for sporulation (20, 39, 43, 46).

Structural analysis of the Epulopiscium SpoIIE.

Putative homologs of spoIIE, spoIIAA, spoIIAB, and sigF genes have been identified in the Epulopiscium sp. type B genome, a finding which suggests that Epulopiscium has an early offspring-specific sigma factor activated by the cascade of molecular interactions described for B. subtilis.

SpoIIE is a large protein with three distinct domains. The N terminus targets SpoIIE to the cell membrane (7, 9). Domain II facilitates interaction with FtsZ and SpoIIE oligomerization (34). Conserved amino acid residues in the C-terminal phosphatase domain place SpoIIE within the PP2C protein phosphatase family (1, 44). All strains, plasmids, and primers used in the present study are provided in Tables 1 and 2. The sequence of the spoIIE gene from Epulopiscium plus 269 bases upstream of the predicted start codon was determined. The gene is 2,352 bp long, and the predicted protein shares 22% amino acid identity and 50% similarity with B. subtilis SpoIIE (Fig. 2). A hydrophobicity plot of Epulopiscium SpoIIE reveals a potential N terminus transmembrane domain to approximately residue 304, similar to the 324-amino-acid hydrophobic domain I of B. subtilis SpoIIE (data not shown) (7, 9). Domain II is not highly conserved between known SpoIIE homologs, and the B. subtilis and Epulopiscium proteins are only 16% identical. The phosphatase domain (III) is highly conserved, with 35% identity and 64% similarity to B. subtilis SpoIIE. Two essential active-site aspartic acid residues and two downstream amino acid motifs (Fig. 2B) found in all PP2C type phosphatases (1) are conserved in Epulopiscium SpoIIE. The σA promoters of both B. subtilis and Epulopiscium spoIIE genes have an unusual spacing of 21 bp (instead of the typical 17 bp) between the −10 and −35 sequences (52).

Table 1.

Strains and plasmids used in this study

Strain or plasmid Relevant characteristics or purpose Source or reference
Strains
    Escherichia coli DH5α Plasmid cloning Laboratory stock
    E. coli TOP10 Plasmid cloning Invitrogen
    B. subtilis PY79 Laboratory strain, sporulation 53
Plasmids
    pRSET-IIE-GFP EpulopisciumspoIIE-gfp in pRSETB This study
    pSWEET2E B. subtilis spoIIE in pSWEET This study
    pDM1 Epulopiscium rpoB fragment in pCR2.1 This study
    pDM2 B. subtilis rpoB fragment in pCR2.1 This study
    pRSETB Ampr, cloning vector Invitrogen
    pSWEET Ampr, Cmr, cloning vector 10
    pCR 2.1-TOPO Ampr, Kanr, cloning vector Invitrogen

Table 2.

Primers used in this study

Designation Sequence (5′ to 3′)
GFPtagF GGGAGTGGAAGCTTGGATGAGTAAAGGAGAAGAACTTTTC
GFPtagR GGGAGTGGAAGCTTTTTGTATAGTTCATCCATGCCATG
SpoIIEABfragF AGTACCAAACGCGAAGAACAAAAT
SpoIIEABfragR ATAGTCTCCAGCAAGAAGGCTTCGAC
BsubspoIIEcompF GCGGCGTTAATTAAGGGAAAAGGTGGTGAACTACTATGGAAAAAGCAGAAAGAAGAG
BsubspoIIEcompR CCTGCGCTAGCTTATGAAATTTCTTGTTTGTTTTGAAAGAT
EpulorpoB742F CCACCAACGGTTGAAAGTGCTGAA
EpulorpoB1107R CGATGATTTCTGCCAACACTGG
BsubrpoB3503R CCGTCAGCTTGTTTCGCATCTTCT
BsubrpoB3064F ACTGGAGAGCCGTTTGATAACCGT
EpulorpoB913F GAAGCTGGTGATAAAATTTCTGAAG
EpulorpoB994R CAATCTTTACATTTGAAGTCCCAGTA
BsubrpoB3183F GCAGCCTCTTGGCGGTAA
BsubrpoB3243R CCAAACCTCCATCTCACCAAA
EpulospoIIE1203F GGTTTATAAAGGAGAACGCAATGG
EpulospoIIE1280R GCAGAGGGACATTTATTACTGAATGA
BsubspoIIE302F TGCTCATACTGGCGGCATT
BsubspoIIE358R TGAAGGCAGCCACTTTAGAAAAT

Fig. 2.

Fig. 2.

Analysis of the putative spoIIE homolog from Epulopiscium sp. type B. (A) Domain structure of SpoIIE from Epulopiscium and B. subtilis. Black bars in domain III indicate active-site residues (thin bars) and motifs (thick bars) found in PP2C phosphatases. (B) Conserved PP2C motifs from Epulopiscium, B. subtilis, and Clostridium acetobutylicum. Boldface type indicates residues conserved in all PP2C protein phosphatases. (C) Comparison of Epulopiscium and B. subtilis spoIIE promoters with σA consensus sequences found in B. subtilis and Clostridium spp. Boldface type indicates conserved bases in the B. subtilis consensus (28).

The spoIIAA, spoIIAB, and sigF genes are found in an operon in the Epulopiscium genome. Alignments of the predicted protein sequences of SpoIIAA, SpoIIAB, and SigF from Epulopiscium with B. subtilis homologs indicate 27%, 41%, and 48% identity and 66%, 67%, and 72% similarity, respectively.

Developmentally synchronized populations of Epulopiscium.

Naso tonganus, which feeds diurnally on plant material but retains food in the alimentary tract overnight (13), was collected by spearfishing on outer reefs in the vicinity of Lizard Island, Great Barrier Reef, Australia, between 1000 and 1400 h. Ethanol-fixed intestinal contents were stained with 2 μg/ml 4′,6-diamidino-2-phenylindole (DAPI) (50), and randomly selected Epulopiscium cells were classified by stage of development (Fig. 3). Since morphological transitions in Epulopiscium are similar to those in a sporulating cell (4), we used the classically described stages of endospore formation (42) to represent similar events in Epulopiscium offspring development.

Fig. 3.

Fig. 3.

Characterization of Epulopiscium cell development in N. tonganus gut samples. Drawings of the developmental stages are shown across the top. The sample number and the total number of categorized cells are shown on the left. The number of cells and percentage of the sample representing any given stage are provided. Stages are defined as follows. A stage 0 cell contains large offspring that show no signs of next-round offspring initiation. Stage I cells have large amounts of coalesced polar DNA but no septa. Stage II cells have polar septa, but not all polar DNA is inside the polar cells. Stage II-III cells have DNA translocated inside the polar cell; the polar septa are curved, indicating engulfment. Stage III and stage IV* contain cells with engulfed offspring, but stage III cells have an offspring length-to-width ratio of less than 2:1, while stage IV* cells have a greater ratio. Some of the hallmarks of stage IV forespores, such as cortex formation and coat assembly, may not occur in Epulopiscium cells. To highlight these differences, we refer to this stage as IV* for Epulopiscium.

Expression of the spoIIE gene peaks early in offspring development.

Intestinal contents from N. tonganus were also fixed with RNAprotect (Qiagen). For each sample, total RNA isolated from a 1-ml aliquot was converted to cDNA and used in quantitative PCR (qPCR) assays using Power SYBR Green master mix (Applied Biosystems). All qPCR primers were designed using Primer Express software, and qPCR was performed using an ABI 7300 real-time PCR system with default cycling conditions. To control for differences in Epulopiscium cell density in these samples, the rpoB housekeeping gene was used to normalize the data. This approach has been used in other studies of population-specific gene expression (14, 19, 41, 47) and seemed appropriate here. Based on previously published microarray studies, rpoB gene expression appears constant during the transition to stationary phase and throughout sporulation in B. subtilis (12, 23, 49). In only one study, a modest, 3-fold drop in the rpoB gene transcript level at t1 was observed (11). We found that for both Epulopiscium and B. subtilis qPCR results (described below), accounting for this drop in the rpoB gene transcript number at t1 and beyond does not affect the trends observed or the interpretation of the spoIIE gene transcription analyses. Specificity of all qPCR products generated from intestinal samples was confirmed by sequence analysis. Samples 1 and 2 had the highest spoIIE-to-rpoB gene transcript ratios (0.2256 and 0.1452), indicating that the spoIIE gene is highly expressed prior to polar division (Fig. 4 A). Sample 3 had a lower transcript ratio (0.0560), which correlates well with the distribution of the cells that had advanced beyond polar septum formation. Samples 4, 5, and 6 had low transcript ratios (0.0021, 0.0035, and 0.0020, respectively), which are consistent with these postengulfment populations.

Fig. 4.

Fig. 4.

spoIIE gene expression in Epulopiscium and sporulating B. subtilis. (A) For Epulopiscium, the bar graph on the left represents stages of development (from Fig. 3). The gray horizontal bars indicate the ratio of spoIIE transcripts to rpoB transcripts. (B) For B. subtilis, spoIIE-to-rpoB transcript ratios were determined for subsamples taken every 30 min throughout the first 3.5 h of sporulation. Error bars represent the standard errors of the means of the data generated from duplicate RT-qPCRs for the four unique spoIIE-to-rpoB pairings.

To the best of our knowledge, a reverse transcription (RT)-qPCR assay for spoIIE gene expression has never been reported for sporulating B. subtilis; thus, we wanted to validate this method. Samples of B. subtilis were taken every half hour from the onset of sporulation (t0), induced by resuspension (37), and assayed (Fig. 4B). No-template controls for the spoIIE gene yielded values that were three orders of magnitude less than that for any sample. Prior to t1, a low spoIIE-to-rpoB gene transcript ratio was observed (0.0067 for t0, 0.0052 for t0.5), and transcript ratios then increased for t1 and t1.5 (0.0219, 0.0214, respectively). Samples from t2 and later had greater ratios (0.2466, 0.1828, 0.3143, and 0.1425). Microscopic examination of cells stained with FM4-64, MitoTracker green, and DAPI (45) was used to determine the proportion of cells at specific morphological stages of sporulation (no polar septum, straight polar septum, curved septum, completely engulfed forespore) at each time point (data not shown). Large numbers of cells with a polar septum begin to appear at t1.5 (8.2% of the population), and this stage becomes more prominent at t2 (25.6%). By t3, cells with a fully engulfed forespore are more abundant than cells with a polar septum. The qPCR results are comparable to published spoIIE gene transcription profiles using β-galactosidase fusions (27), in which spoIIE expression increases considerably in populations with cells that are just beginning to divide asymmetrically and persists even when the population has progressed and engulfed cells are abundant. Compared with that for Epulopiscium, the timing of spoIIE gene expression in B. subtilis populations appears slightly later in the developmental progression, and expression persists for a longer developmental interval. This may reflect response heterogeneity of sporulating B. subtilis cultures (15, 48). Sporulation is a last resort, and there is a clear advantage to the population for some cells to delay the commitment to sporulate as long as possible. Conversely, intracellular offspring formation is essential for Epulopiscium reproduction, and synchronized development may presage recurrent fluctuations in nutrients (50); thus, there would be little advantage for some cells in the population to delay development.

spoIIE gene expression patterns suggest a role in early offspring development.

Taken together, the RT-qPCR results from Epulopiscium and B. subtilis indicate that the spoIIE homolog in Epulopiscium is expressed in a manner that would support its predicted role in offspring development. Expression peaks just prior to polar division, when SpoIIE would be needed for polar septum formation and subsequent activation of σF. The use of cell-specific sigma factors could drive the alternative cell fates of the offspring and the mother cell in Epulopiscium, allowing for the growth of the offspring while the mother cell initially supports offspring growth but eventually progresses toward apoptosis (50). Further investigation of these potential transcription programs may indicate where the line is drawn between intracellular offspring formation and sporulation.

Nucleotide sequence accession number.

The sequence of the spoIIE gene from Epulopiscium plus 269 bases upstream of the predicted start codon was submitted to GenBank under accession number HQ149097.

Acknowledgments

We thank the staff and directors of the Lizard Island Research Station, Will Robbins, and David Raubenheimer for their support in the field and John Helmann for help with promoter identification and analysis.

This research was funded by National Science Foundation grant 0721583.

Collections were carried out under Great Barrier Reef Marine Park Authority (GBRMPA) permit no. G03/3871.1 and James Cook University ethics approval no. A503.

Footnotes

▿

Published ahead of print on 11 March 2011.

REFERENCES

  • 1. Adler E., Donella-Deana A., Arigoni F., Pinna L. A., Stragier P. 1997. Structural relationship between a bacterial developmental protein and eukaryotic PP2C protein phosphatases. Mol. Microbiol. 23:57–62 [DOI] [PubMed] [Google Scholar]
  • 2. Angert E. R. 2005. Alternatives to binary fission in bacteria. Nat. Rev. Microbiol. 3:214–224 [DOI] [PubMed] [Google Scholar]
  • 3. Angert E. R., Brooks A. E., Pace N. R. 1996. Phylogenetic analysis of Metabacterium polyspora: clues to the evolutionary origin of daughter cell production in Epulopiscium species, the largest bacteria. J. Bacteriol. 178:1451–1456 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Angert E. R., Clements K. D. 2004. Initiation of intracellular offspring in Epulopiscium. Mol. Microbiol. 51:827–835 [DOI] [PubMed] [Google Scholar]
  • 5. Angert E. R., Clements K. D., Pace N. R. 1993. The largest bacterium. Nature 362:239–241 [DOI] [PubMed] [Google Scholar]
  • 6. Arigoni F., Duncan L., Alper S., Losick R., Stragier P. 1996. SpoIIE governs the phosphorylation state of a protein regulating transcription factor σF during sporulation in Bacillus subtilis. Proc. Natl. Acad. Sci. U. S. A. 93:3238–3242 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Arigoni F., Guerout-Fleury A. M., Barak I., Stragier P. 1999. The SpoIIE phosphatase, the sporulation septum and the establishment of forespore-specific transcription in Bacillus subtilis: a reassessment. Mol. Microbiol. 31:1407–1415 [DOI] [PubMed] [Google Scholar]
  • 8. Arigoni F., Pogliano K., Webb C. D., Stragier P., Losick R. 1995. Localization of protein implicated in establishment of cell type to sites of asymmetric division. Science 270:637–640 [DOI] [PubMed] [Google Scholar]
  • 9. Barak I., et al. 1996. Structure and function of the Bacillus SpoIIE protein and its localization to sites of sporulation septum assembly. Mol. Microbiol. 19:1047–1060 [DOI] [PubMed] [Google Scholar]
  • 10. Bhavsar A. P., Zhao X., Brown E. D. 2001. Development and characterization of a xylose-dependent system for expression of cloned genes in Bacillus subtilis: conditional complementation of a teichoic acid mutant. Appl. Environ. Microbiol. 67:403–410 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Britton R. A., et al. 2002. Genome-wide analysis of the stationary-phase sigma factor (sigma-H) regulon of Bacillus subtilis. J. Bacteriol. 184:4881–4890 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Caldwell R., et al. 2001. Correlation between Bacillus subtilis scoC phenotype and gene expression determined using microarrays for transcriptome analysis. J. Bacteriol. 183:7329–7340 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Choat J. H., Robbins W. D., Clements K. D. 2004. The trophic status of herbivorous fishes on coral reefs. II. Food processing modes and trophodynamics. Marine Biol. 145:445–454 [Google Scholar]
  • 14. Chow W. L., Cheng D., Wang S., He J. 2010. Identification and transcriptional analysis of trans-DCE-producing reductive dehalogenases in Dehalococcoides species. ISME J. 4:1020–1030 [DOI] [PubMed] [Google Scholar]
  • 15. Chung J. D., Stephanopoulos G., Ireton K., Grossman A. D. 1994. Gene expression in single cells of Bacillus subtilis: evidence that a threshold mechanism controls the initiation of sporulation. J. Bacteriol. 176:1977–1984 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Clarkson J., Campbell I. D., Yudkin M. D. 2004. Physical evidence for the induced release of the Bacillus subtilis transcription factor, σF, from its inhibitory complex. J. Mol. Biol. 340:203–209 [DOI] [PubMed] [Google Scholar]
  • 17. Clements K. D., Sutton D. C., Choat J. H. 1989. Occurrence and characteristics of unusual protistan symbionts from surgeonfishes (Acanthuridae) of the Great Barrier Reef, Australia. Marine Biol. 102:403–412 [Google Scholar]
  • 18. Collins M. D., et al. 1994. The phylogeny of the genus Clostridium: proposal of five new genera and eleven new species combinations. Int. J. Syst. Bacteriol. 44:812–826 [DOI] [PubMed] [Google Scholar]
  • 19. Doumith M., Ellington M. J., Livermore D. M., Woodford N. 2009. Molecular mechanisms disrupting porin expression in ertapenem-resistant Klebsiella and Enterobacter spp. clinical isolates from the UK. J. Antimicrob. Chemother. 63:659–667 [DOI] [PubMed] [Google Scholar]
  • 20. Duncan L., Alper S., Arigoni F., Losick R., Stragier P. 1995. Activation of cell-specific transcription by a serine phosphatase at the site of asymmetric division. Science 270:641–644 [DOI] [PubMed] [Google Scholar]
  • 21. Duncan L., Alper S., Losick R. 1996. SpoIIAA governs the release of the cell-type specific transcription factor σF from its anti-sigma factor SpoIIAB. J. Mol. Biol. 260:147–164 [DOI] [PubMed] [Google Scholar]
  • 22. Duncan L., Losick R. 1993. SpoIIAB is an anti-σ factor that binds to and inhibits transcription by regulatory protein σF from Bacillus subtilis. Proc. Natl. Acad. Sci. U. S. A. 90:2325–2329 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Eichenberger P., et al. 2004. The program of gene transcription for a single differentiating cell type during sporulation in Bacillus subtilis. PLoS Biol. 2:e328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Errington J. 2003. Regulation of endospore formation in Bacillus subtilis. Nat. Rev. Microbiol. 1:117–126 [DOI] [PubMed] [Google Scholar]
  • 25. Fishelson L., Montgomery W. L., Myrberg A. A. 1985. A unique symbiosis in the gut of tropical herbivorous surgeonfish (Acanthuridae: Teleostei) from the Red Sea. Science 229:49–51 [DOI] [PubMed] [Google Scholar]
  • 26. Flint J. F., Drzymalski D., Montgomery W. L., Southam G., Angert E. R. 2005. Nocturnal production of endospores in natural populations of Epulopiscium-like surgeonfish symbionts. J. Bacteriol. 187:7460–7470 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Guzman P., Westpheling J., Youngman P. 1988. Characterization of the promoter region of the Bacillus subtilis spoIIE operon. J. Bacteriol. 170:1598–1609 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Helmann J. D. 1995. Compilation and analysis of Bacillus subtilis σA-dependent promoter sequences: evidence for extended contact between RNA polymerase and upstream promoter DNA. Nucleic Acids Res. 23:2351–2360 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Ho M. S., Carniol K., Losick R. 2003. Evidence in support of a docking model for the release of the transcription factor σF from the antisigma factor SpoIIAB in Bacillus subtilis. J. Biol. Chem. 278:20898–20905 [DOI] [PubMed] [Google Scholar]
  • 30. Iber D. 2006. A computational analysis of the impact of the transient genetic imbalance on compartmentalized gene expression during sporulation in Bacillus subtilis. J. Mol. Biol. 360:15–20 [DOI] [PubMed] [Google Scholar]
  • 31. Iber D., Clarkson J., Yudkin M. D., Campbell I. D. 2006. The mechanism of cell differentiation in Bacillus subtilis. Nature 441:371–374 [DOI] [PubMed] [Google Scholar]
  • 32. King N., Dreesen O., Stragier P., Pogliano K., Losick R. 1999. Septation, dephosphorylation, and the activation of σF during sporulation in Bacillus subtilis. Genes Dev. 13:1156–1167 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Levin P. A., Losick R., Stragier P., Arigoni F. 1997. Localization of the sporulation protein SpoIIE in Bacillus subtilis is dependent upon the cell division protein FtsZ. Mol. Microbiol. 25:839–846 [DOI] [PubMed] [Google Scholar]
  • 34. Lucet I., Feucht A., Yudkin M. D., Errington J. 2000. Direct interaction between the cell division protein FtsZ and the cell differentiation protein SpoIIE. EMBO J. 19:1467–1475 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Min K. T., Hilditch C. M., Diederich B., Errington J., Yudkin M. D. 1993. σF, the first compartment-specific transcription factor of B. subtilis, is regulated by an anti-σ factor that is also a protein kinase. Cell 74:735–742 [DOI] [PubMed] [Google Scholar]
  • 36. Montgomery W. L., Pollak P. E. 1988. Epulopiscium fishelsoni n.g., n.s., a protist of uncertain taxonomic affinities from the gut of an herbivorous reef fish. J. Protozool. 35:565–569 [Google Scholar]
  • 37. Nicholson W. L., Setlow P. 1990. Sporulation, germination and outgrowth, p. 396–399, 432 In Harwood C. R., Cutting S. M. (ed.), Molecular biological methods for Bacillus. John Wiley and Sons Ltd., Chichester, England [Google Scholar]
  • 38. Prepiak P., Chromikova Z., Barak I. 2001. Use of yeast two-hybrid system for detection of Bacillus subtilis FtsZ protein partners. Folia Microbiol. 46:292–296 [DOI] [PubMed] [Google Scholar]
  • 39. Quisel J. D., Grossman A. D. 2000. Control of sporulation gene expression in Bacillus subtilis by the chromosome partitioning proteins Soj (ParA) and Spo0J (ParB). J. Bacteriol. 182:3446–3451 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Quisel J. D., Lin D. C., Grossman A. D. 1999. Control of development by altered localization of a transcription factor in B. subtilis. Mol. Cell 4:665–672 [DOI] [PubMed] [Google Scholar]
  • 41. Rahm B. G., Morris R. M., Richardson R. E. 2006. Temporal expression of respiratory genes in an enrichment culture containing Dehalococcoides ethenogenes. Appl. Environ. Microbiol. 72:5486–5491 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Ryter A. 1965. Etude morphologique de la sporulation de Bacillus subtilis. Ann. Inst. Pasteur 108:40–60 [PubMed] [Google Scholar]
  • 43. Schmidt R., et al. 1990. Control of developmental transcription factor σF by sporulation regulatory proteins SpoIIAA and SpoIIAB in Bacillus subtilis. Proc. Natl. Acad. Sci. U. S. A. 87:9221–9225 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Schroeter R., Schlisio S., Lucet I., Yudkin M., Borriss R. 1999. The Bacillus subtilis regulator protein SpoIIE shares functional and structural similarities with eukaryotic protein phosphatases 2C. FEMS Microbiol. Lett. 174:117–123 [DOI] [PubMed] [Google Scholar]
  • 45. Sharp M. D., Pogliano K. 1999. An in vivo membrane fusion assay implicates SpoIIIE in the final stages of engulfment during Bacillus subtilis sporulation. Proc. Natl. Acad. Sci. U. S. A. 96:14553–14558 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Stragier P., Losick R. 1996. Molecular genetics of sporulation in Bacillus subtilis. Annu. Rev. Genet. 30:297–341 [DOI] [PubMed] [Google Scholar]
  • 47. Szabo D., et al. 2006. Outer membrane protein changes and efflux pump expression together may confer resistance to ertapenem in Enterobacter cloacae. Antimicrob. Agents Chemother. 50:2833–2835 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Veening J. W., Hamoen L. W., Kuipers O. P. 2005. Phosphatases modulate the bistable sporulation gene expression pattern in Bacillus subtilis. Mol. Microbiol. 56:1481–1494 [DOI] [PubMed] [Google Scholar]
  • 49. Wang S. T., et al. 2006. The forespore line of gene expression in Bacillus subtilis. J. Mol. Biol. 358:16–37 [DOI] [PubMed] [Google Scholar]
  • 50. Ward R. J., Clements K. D., Choat J. H., Angert E. R. 2009. Cytology of terminally differentiated Epulopiscium mother cells. DNA Cell Biol. 28:57–64 [DOI] [PubMed] [Google Scholar]
  • 51. Wu J. J., Piggot P. J., Tatti K. M., Moran C. P., Jr 1991. Transcription of the Bacillus subtilis spoIIA locus. Gene 101:113–116 [DOI] [PubMed] [Google Scholar]
  • 52. York K., et al. 1992. Spo0A controls the σA-dependent activation of Bacillus subtilis sporulation-specific transcription unit spoIIE. J. Bacteriol. 174:2648–2658 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Youngman P., Perkins J. B., Losick R. 1984. Construction of a cloning site near one end of Tn917 into which foreign DNA may be inserted without affecting transposition in Bacillus subtilis or expression of the transposon-borne erm gene. Plasmid 12:1–9 [DOI] [PubMed] [Google Scholar]
  • 54. Yudkin M. D., Clarkson J. 2005. Differential gene expression in genetically identical sister cells: the initiation of sporulation in Bacillus subtilis. Mol. Microbiol. 56:578–589 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES