Skip to main content
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 2011 Jun;31(11):2311–2325. doi: 10.1128/MCB.01432-10

A Conserved Patch near the C Terminus of Histone H4 Is Required for Genome Stability in Budding Yeast ▿

Yao Yu 1, Madhusudhan Srinivasan 1, Shima Nakanishi 2, Janet Leatherwood 3, Ali Shilatifard 2, Rolf Sternglanz 1,*
PMCID: PMC3133250  PMID: 21444721

Abstract

A screen of Saccharomyces cerevisiae histone alanine substitution mutants revealed that mutations in any of three adjacent residues, L97, Y98, or G99, near the C terminus of H4 led to a unique phenotype. The mutants grew slowly, became polyploid or aneuploid rapidly, and also lost chromosomes at a high rate, most likely because their kinetochores were not assembled properly. There was lower histone occupancy, not only in the centromeric region, but also throughout the genome for the H4 mutants. The mutants displayed genetic interactions with the genes encoding two different histone chaperones, Rtt106 and CAF-I. Affinity purification of Rtt106 and CAF-I from yeast showed that much more H4 and H3 were bound to these histone chaperones in the case of the H4 mutants than in the wild type. However, in vitro binding experiments showed that the H4 mutant proteins bound somewhat more weakly to Rtt106 than did wild-type H4. These data suggest that the H4 mutant proteins, along with H3, accumulate on Rtt106 and CAF-I in vivo because they cannot be deposited efficiently on DNA or passed on to the next step in the histone deposition pathway, and this contributes to the observed genome instability and growth defects.

INTRODUCTION

The fundamental building block of chromosomes is the nucleosome, consisting of 147 bp of DNA wrapped around a histone octamer with two copies each of histones H2A, H2B, H3, and H4 (17). During DNA replication, old histones have to be moved from parental DNA to the newly replicated DNA, and in addition, new histones have to be deposited in order to achieve the proper density of nucleosomes on the DNA. A variety of histone chaperones exist to carry out this function (25). Similarly, during transcription, the moving RNA polymerase displaces the histones as it traverses the DNA, and again, various histone chaperones play an important role in redepositing the histones behind the transcribing RNA polymerase (3, 27).

Histone chaperones play an important role in preventing nonspecific interactions between the highly basic histones and negatively charged DNA (16). Based on specificity for different histone cargos, chaperones can be classified into at least 2 groups. Chaperones for the H3/H4 dimer or tetramer include the CAF-I complex, Asf1, the Hir proteins, Rtt106, and FACT. Chaperones for H2A/H2B dimers include FACT, NAP1, nucleoplasmin, and Chz1. Because of the peripheral position of the two H2A/H2B dimers on the nucleosome, H2A/H2B dimers are not loaded onto the DNA until the central H3/H4 tetramer has been deposited. Conversely, during nucleosome disassembly, H2A/H2B dimers are removed before the H3/H4 tetramer (25). There is even a specific chaperone, Scm3/HJURP, for the centromeric histone H3 variant, CenH3 (6, 8, 31).

In order to learn more about the functions of the individual amino acids present in the highly conserved histones, two groups have systematically mutated each amino acid to alanine in the yeast Saccharomyces cerevisiae (7, 21). In this yeast, there are two copies of divergently transcribed H3 and H4 genes and, similarly, two copies of divergently transcribed H2A and H2B genes, all on different chromosomes. In one study, a plasmid shuffle techniques was used to introduce the histone mutations (21). A strain was constructed in which both chromosomal copies of the genes coding for H3 and H4 were deleted, and the strain was kept alive by a URA3 CEN plasmid encoding a wild-type (WT) H3-H4 histone gene pair, HHT1-HHF1. This strain was transformed with individual TRP1 CEN plasmids, each bearing a different H3 or H4 residue mutated to alanine. The strains were then plated on 5-fluoroorotic acid (5-FOA) to select for cells that had lost the URA3 plasmid and were being kept alive by the TRP1 plasmid carrying the H3 or H4 mutation. Only viable mutants could grow on such a medium. Surprisingly, in spite of the extreme conservation of the amino acid sequences of H3 and H4, most of the mutants were viable, although some grew poorly. An analogous strategy was used to generate viable H2A and H2B mutants in which each residue was mutated to alanine.

In examining this collection of histone mutants, we discovered that three specific H4 mutants had become polyploid. Interestingly, these mutants had alanine substitutions on three adjacent residues on H4, amino acids 97, 98, and 99, near the C terminus of the protein, in the globular domain of the nucleosome. In this report, we describe the properties of the H4 L97A, Y98A, and G99A mutants and their unusual genetic and biochemical interactions with the histone chaperones Rtt106 and CAF-I. The results suggest that this small C-terminal patch on histone H4 is important for proper kinetochore assembly and for H4/H3 deposition by Rtt106 and CAF-I.

MATERIALS AND METHODS

Yeast strains, growth media, and plasmids.

The S. cerevisiae strains used in this study are listed in Table 1 , and the plasmids used are listed in Table 2. Most of the histone plasmids used in this study were described in our paper on alanine scanning mutagenesis of the histones (21). All growth media, including yeast extract-peptone-dextrose (YPD), synthetic minimal (SD), and synthetic complete (SC) media and media with 5-FOA, were prepared as described previously (1). Unless indicated, to avoid polyploid/aneuploid cells dominating the culture, extraordinarily large colonies were excluded when inoculating cultures expressing the H4 L97A, Y98A G99A, G99L, or G99D mutant.

Table 1.

Yeast strains

Strain Genotype Source or reference
YYY67 MATaleu2Δ1 his3Δ200 ura3-52 trp1Δ63 lys2-128δ (hht1-hhf1)Δ::LEU2 (hht2-hhf2) Δ::HIS3 Ty912Δ35-lacZ::his4 <pMS329 HHT1-HHF1URA3SUP11CEN4> This study
YYY70 Same as YYY67, but with (hht1-hhf1)Δ::LEU2 replaced by (hht1-hhf1)Δ::KAN This study
FY406 MATaleu2Δ1 his3Δ200 ura3-52 trp1Δ63 (hta1-htb1)Δ::LEU2 (hta2-htb2) Δ::TRP1 <pSAB6 HTA1-HTB1 URA3> Fred Winston
YYY91 MATα leu2 his3 ura3 trp1 ade2-1 can1-100 cyh2 (hht1-hhf1)Δ::LEU2 (hht2-hhf2)Δ::HIS3 his4Δ::KAN <pMS329 HHT1-HHF1URA3SUP11CEN4> This study
DC16 MATahis1 Kim Nasmyth
DC17 MATα his1 Kim Nasmyth
YYY85a mad2Δ::KAN This study
YYY87a sml1Δ::KANmec1Δ::NAT1 This study
YYY90a rad9Δ::KAN This study
MAY8526 MATatrp1Δ63 leu2Δ ura3-52 his3Δ200lys2-8Δ1NUF2-GFP::URA3SPC29-RFP::Hb 2
MAY8539 MATatrp1Δ63 leu2Δ ura3-52 his3Δ200lys2-8Δ1SPC105-GFP::KANSPC29-RFP::Hb 2
MAY8511 MATαleu2-3,112 ura3-52 his3Δ200lys2MTW1-GFP::KANSPC29-RFP::Hb 2
YYY92a rtt106Δ::KAN This study
YYY93a mad2Δ::KANrtt106Δ::NAT This study
YYY83a cac1Δ::KAN This study
YYY88a cac2Δ::KAN This study
ZGY692 MATα ade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 RTT106-TAP::TRP1hht1-hhf1Δ::LEU2, hhf1-hhf2Δ::KAN <YCp50-HHT2-HHF2> 13
ZGY892 MATaade2-1 can1-100 his3-11,15 leu2-3,112 trp1-1 ura3-1 CAC2-TAP::TRP1 hht1-hhf1Δ::LEU2 hhf1-hhf2Δ::KAN <YCp50-HHT2-HHF2> 13
a

Isogenic relative to YYY67.

Table 2.

Plasmids used in this study

Plasmid Descriptiona Reference or source
pWZ414-F12 HHT2-HHF2 TRP1 CEN3 32
pH 4-G94A Same as pWZ414-F12, but contains H4 G94A mutation 21
pH 4-R95A Same as pWZ414-F12, but contains H4 R95A mutation 21
pH 4-T96A Same as pWZ414-F12, but contains H4 T96A mutation 21
pH 4-L97A Same as pWZ414-F12, but contains H4 L97A mutation 21
pH 4-Y98A Same as pWZ414-F12, but contains H4 Y98A mutation 21
pH 4-G99A Same as pWZ414-F12, but contains H4 G99A mutation 21
pH 4-F100A Same as pWZ414-F12, but contains H4 F100A mutation 21
pH 4-G101A Same as pWZ414-F12, but contains H4 G101A mutation 21
pH 4-G102A Same as pWZ414-F12, but contains H4 G102A mutation 21
pYY117 Same as pWZ414-F12, but contains H4 G99L mutation This study
pYY118 Same as pWZ414-F12, but contains H4 G99D mutation This study
pYY58 Same as pWZ414-F12, but contains H4 Y98F mutation This study
pZS145 HTA1-FLAG-HTB1CENHIS3 21
pH2A-V101A Same as pZS145, but contains H2A V101A mutation 21
pH2A-T102A Same as pZS145, but contains H2A T102A mutation 21
pH2A-I103A Same as pZS145, but contains H2A I103A mutation 21
pYY111 Same as pZS145, but contains H2A V101R mutation This study
pYY112 Same as pZS145, but contains H2A A104R mutation This study
pMS329 HHT1-HHF1URA3SUP11CEN4 19
pET28b-HHT2 HHT2 ORF is cloned into the NcoI (start) and XhoI (end) sites of pET28b vector (Novagen). Carl Wu
pET28b-HHF2 HHF2 ORF is cloned into the NcoI (start) and XhoI (end) sites. NcoI site is destroyed because of ligation to compatible AflIII site. Carl Wu
pYY133 Fragment containing T7 promoter and HHF2 ORF was amplified by PCR from pET28b-HHF2, with XhoI sites at both ends. The fragment was cloned into the XhoI site of pET28b-HHT2 vector. The direction of HHF2 ORF was the same as that of HHT2. This study
pYY131 Same as pYY133, but contains Y98A mutation in the ORF of HHT2 This study
pZG114 pGEX-4T-1-RTT106 13
pYY119 pRS313 with a 1.8-kb SpeI fragment containing the HHT2-HHF2 genes This study
pYY120 Same as pYY119, but contains H4 L97A mutation This study
pYY121 Same as pYY119, but contains H4 Y98A mutation This study
pYY122 Same as pYY119, but contains H4 G99A mutation This study
pYY64 CSE4 ORF with 450-bp upstream sequence and 400-bp downstream sequence was cloned into XhoI and BamH I sites of pRS425. This study
pYY134 RTT106 ORF plus 300-bp upstream sequence and 200-bp downstream sequence cloned into the BamHI and XhoI sites of pRS425. This study
a

ORF, open reading frame.

Growth assays.

Plasmid shuffling was used to generate freshly derived strains with alanine substitution mutations in the histones. Strain YYY67 carrying plasmid pMS329 (HHT1-HHF1 URA3 CEN4) was transformed with TRP1 plasmids expressing either wild-type H4 (pWZ414-F12) or mutant derivatives of that plasmid. Colonies were taken from the −Trp transformation plate and spread onto SC-Trp plus 5-FOA to select against the URA3 plasmid. Similarly, strain FY406 carrying pSAB6 (HTA1-HTB1-URA3) was transformed with HIS3 plasmids expressing wild-type or mutant histone H2A. Transformants were selected on SC-His plates and counterselected on SC-His plus 5-FOA plates. For growth assays, about 2 × 107 cells were taken from the 5-FOA plates and suspended in 100 μl H2O. Ten-fold dilutions were spotted onto SC selective medium, and the growth was checked after 2 days.

In the case of the H4 L97A, Y98A, and G99A mutants, after counterselection on SC-Trp plus 5-FOA medium, both very large and small colonies were visible after 3 days of incubation. Single colonies, large or small, were picked, resuspended in H2O, and spread onto fresh SC-Trp plus 5-FOA plates. The plates were checked after 4 days, and cells were inoculated into SC-TRP plus 5-FOA liquid medium for flow cytometry analysis.

Flow cytometry analysis.

Flow cytometry analysis was performed according to a previous protocol with minor modifications (1). About 1 × 107 cells were harvested and fixed in 70% ethanol. The cells were briefly sonicated, incubated in 1 mg/ml RNase A at 37°C for 1 h, and left at 4°C overnight. Before analysis, cells were treated with 5 mg/ml pepsin at 37°C for 10 min and stained with 1 μM Sytox Green (Invitrogen). Twenty-five thousand cells were measured by FACSCalibur (Becton Dickinson), and data were analyzed with Flowjo 2.0.

Microarray analysis of ploidy.

H4 mutant cells from large colonies that showed increased ploidy by flow cytometry analysis were restreaked 3 times on SC-Trp plus 5-FOA medium before being grown in the same liquid medium. About 5 × 106 cells were collected, and DNA was purified as described previously (1). DNA was labeled and hybridized according to the manufacturer's protocol (Agilent). The S. cerevisiae expression array was made by the Stony Brook Spotted Microarray Facility (catalog no. A-26). Data were analyzed with Feature Extraction 9.5.3.1 (Agilent).

Chromosome III loss assay.

Strain YYY91 (MATα) carrying a URA3 plasmid (pMS329) expressing wild-type H4 was transformed with TRP1 plasmids expressing wild-type or mutant H4, and transformants were selected on SC-Ura-Trp plates. About 3 × 107 cells from the transformation plate were suspended in 200 μl YPD and spread onto a lawn of DC17 (MATα) on an SD plate. As a control, the original suspension was diluted 10,000-fold in YPD, and 200 μl was spread onto a lawn of DC16 (MATa) on an SD plate. Cells that were able to mate with DC17 could result either from loss of chromosome III or from mutation of α1 or α2. To distinguish between these possibilities, the colonies on the DC17 cell lawn were streaked onto a YPD plus G418 plate to check if the KANr marker present on the left arm of chromosome III was lost. The loss frequency was calculated as follows: (number of G418-sensitive colonies formed on the DC17 cell lawn)/(number of colonies formed on the DC16 cell lawn) × 104.

CEN plasmid loss assay.

Strain YYY70 containing the CEN LEU2 plasmid pRS315 and pMS329 (HHT1-HHF1 URA3 CEN4) was transformed with a TRP1 plasmid expressing wild-type H4 or the L97A, Y98A, or G99A mutant. Transformants were selected on SC-Leu-Ura-Trp medium. Fresh colonies were suspended in H2O, and equal volumes were spread onto SC-Leu and SC plates. The CEN plasmid loss frequency was calculated as follows: 1 − (number of colonies formed on SC-Leu)/(number of colonies formed on SC) × 100%.

Fluorescence microscopy.

Strains with kinetochore components tagged with green fluorescent protein (GFP) and Spc29-red fluorescent protein (RFP) to mark the spindle pole body were transformed with plasmids expressing wild-type or mutant histone H4. In the cases of strains MAY8526 (Nuf2-GFP) and MAY8539 (Spc105-GFP), the histone plasmids had a TRP1 selectable marker, and in the case of MAY8511 (Mtw1-GFP), HIS3 plasmids were used. The transformants were grown to mid-log phase in the SC-Trp or SC-His medium. Cells were harvested, fixed with formaldehyde, and stained with DAPI (4′,6-diamidino-2-phenylindole). An Observer Z1 microscope (Carl Zeiss) was used for imaging. Fluorescence images were acquired by taking 8 steps along the z axis at 400-nm intervals. One hundred cells from each transformant were analyzed with Axiovision release 4.7.

Chromatin sensitivity to nucleases.

The integrity of the centromeric chromatin structure was assessed by protection of DraI sites inside CDE II of CEN3, as described previously (18). Strain YYY67 carrying pMS329 (HHT1-HHF1 URA3 CEN4) was transformed into TRP1 plasmids expressing wild-type or mutant H4. Transformants were counterselected on SC-Trp plus 5-FOA medium to remove the URA3 plasmid. The cells were grown in YPD medium to an optical density at 600 nm (OD600) of 0.8. Nuclei were isolated and suspended in SPC buffer as described previously (12). The buffer was adjusted to a final concentration of 10 mM MgCl2 and 20 mM Tris·HCl, pH 8.0, before incubation with the indicated concentrations of DraI at 37°C for 30 min. The reaction was stopped with 20 mM EGTA. DNA was purified, digested to completion with EcoRI, and resolved by a 1.0% Tris-borate-EDTA gel. CEN3 DNA was detected by Southern blotting using an 899-bp probe generated by PCR with primers 5′ ACTTGTCATGCGGTGAGAATCG 3′ and 5′ ATGACATGACCAAGCATTTTGTAC 3′. Hybridization was performed at 57°C. The blot was exposed to a phosphorimager (Fujitsu), scanned with a Storm 840 (Molecular Dynamics), and analyzed with ImageQuant (GE Healthcare). The percentage of cutting was calculated by the counts in the cut band (2.9 kb) divided by the sum of counts in cut bands and uncut bands (5.1 kb). The DraI site in the GAL10 gene was analyzed in a similar way. The GAL10 probe was generated by PCR using primers 5′ AGATGGTACCCCGATCAGGG 3′ and 5′ TATTGGCGTCGCTTCACCAG 3′.

For the micrococcal nuclease assay, nuclei were isolated and suspended in SPC buffer as described above. One unit of micrococcal nuclease (Worthington) was added to 200 μl of nuclei and incubated at 37°C for various amounts of time (10 to 40 min). The reactions were stopped with 300 μl of stop buffer {20 mM PIPES [piperazine-N,N′-bis(2-ethanesulfonic acid]), pH 6.3, 33.3 mM EGTA}. DNA was purified as described previously (5) and resolved by agarose electrophoresis. The DNA bands were visualized by ethidium bromide staining and scanned by a Kodak 1D image analysis system. The intensities of the bands corresponding to mono-, di-, or trinucleosomes were quantified with ImageQuant (GE Healthcare).

ChIP.

After counterselection on 5-FOA plates, fresh cells expressing wild-type or mutant histone H4 were grown in YPD to an OD600 of 1. Cells were harvested and prepared for the chromatin immunoprecipitation (ChIP) assay as described previously (4). Three microliters of H4 antibody was added to 200 μl of cell lysate for immunoprecipitation, and a no-antibody control was also prepared. Quantification of the ChIP samples was performed by real-time PCR (Roche Applied Sciences LightCycler 480). The following primers were used to check the H4 occupancies at different loci: 5′ CATCCAATACCTTGATGAACTTTTC 3′ and 5′ GTACTATAAGCGGAAGGGGAAGG 3′ for CEN3, 5′ ATTGGCGCACATCCCTCTGG 3′ and 5′ GGAACCCAAGTTCCACTCACGAC 3′ for GAL10, and 5′ CTATTATTGATGCTTTGAAGACCTCCAG 3′ and 5′ TGCCCAAAATAATAGACATACCCCATAA 3′ for PMA1. Data were expressed as the ratio of the signal in the ChIP sample relative to input. The experiments were repeated in their entirety 3 times, and the real-time PCR was performed in duplicate for each sample.

TAP purification of Rtt106 and Cac2.

Strain ZGY692 or ZGY892 was transformed with pYY119 (wild-type H4), pYY120 (H4 L97A), pYY121 (H4 Y98A), or pYY123 (H4 G99A), and transformants were selected on SC-His plates. Colonies from the transformation plate were spread onto SC-His plus 5-FOA. Fresh colonies from the 5-FOA plates were grown in 50 ml SC plus 5-FOA liquid medium for 10 h and then diluted in 1 liter YPD and grown at 30°C to an OD600 of 2.0. Cells were harvested and lysed, and the tandem affinity purification (TAP)-tagged protein was purified by IgG Sepharose 6 fast flow (GE Healthcare) and calmodulin affinity resin (Stratagene) as described previously (15). The bound proteins were eluted with Laemmli buffer, resolved by SDS-PAGE, and detected by Western blotting using antibodies against histone H3 (Abcam; ab1791), histone H4 (from the laboratory of A. Shilatifard), H3 K56Ac (from Zhiguo Zhang), or CBP tag (GenScript; A00635).

Histone-Rtt106 in vitro binding assay.

To purify histones from yeast, strain YYY67 was transformed with plasmids expressing WT H4 or each of the four mutants, and transformants were selected on SC-Trp medium and counterselected on SC-Trp plus 5-FOA. The cells were grown in YPD medium to an OD600 of 1.5 and harvested. Following spheroplasting, nuclei were isolated and histones were purified by sulfuric acid extraction as described previously (9).

To express the histone H3/H4 tetramer in Escherichia coli, pYY133 (wild type) or pYY131 (H4 Y98A) was transformed into BL21-DE3-CodonPlus cells (Stratagene). The induction, lysis, histone extraction, and purification were carried out as described previously (14), except the LB medium contained 50 μg/ml kanamycin and 34 μg/ml chloramphenicol, induction time was 2 h, and a HiTrap SP FF column (GE Healthcare 17-5054-01) was used for purification.

To express GST-Rtt106, pGEX-4T-1-RTT106 was transformed into BL21-DE3-CodonPlus cells, and the cells were grown in LB medium with 100 μg/ml ampicillin and 34 μg/ml chloramphenicol at 37°C. At an OD600 of 0.4, the culture was shifted to 23°C and induced with 0.4 mM IPTG (isopropyl-β-d-thiogalactopyranoside) for 4 h. Cells were harvested and frozen at −20°C. The cells were lysed by sonication, and GST-Rtt106 was purified on glutathione Sepharose 4 fast flow beads (GE Healthcare) according to the manufacture's protocol. For binding assays, GST-Rtt106 was immobilized on the Sepharose beads and washed with A300 buffer (25 mM Tris-HCl [pH 8.0], 10% glycerol, 1 mM EDTA, 0.01% Nonidet P-40, 300 mM NaCl) 3 times. Then, the beads were incubated at 4°C overnight with equal amounts of wild-type or mutant histones purified from yeast or E. coli. The beads were washed with A300 buffer 4 times, and the bound proteins were eluted with Laemmli buffer, resolved by SDS-PAGE, and detected by Coomassie blue staining or Western blotting.

RESULTS

H4 point mutants that cause aneuploidy.

In the course of studies focused on the identification of novel alleles of H4, we obtained genetic evidence that strains with alanine substitution mutations of three adjacent residues of H4, amino acids 97, 98, and 99, appeared to be polyploid. To check on our initial observations, we repeated the plasmid shuffle to obtain newly derived mutants. Specifically, strain YYY67, containing a URA3 plasmid expressing wild-type H4, was transformed with plasmids expressing each of the three H4 mutants, L97A, Y98A, and G99A, and 5-FOA was used to select against the URA3 plasmid. Cells that grew on 5-FOA were collected and replated by serial dilution. All three mutations caused a growth defect, particularly Y98A, whereas mutations of the adjacent residues 94 to 96 and 100 to 102 did not affect growth (Fig. 1). In cells containing both the mutant and wild-type histone H4 plasmids, the growth defect was still observed, but to a lesser extent, indicating that these three mutations were semidominant (data not shown).

Fig. 1.

Fig. 1.

Growth defect of H4 C-terminal substitution mutants. (A) Sequence of the H4 C terminus. The three adjacent residues that lead to a growth defect when mutated to Ala are underlined. (B and C) Growth of each of the H4 C-terminal Ala substitution mutants. Plasmids encoding wild-type or mutant H4 were introduced by plasmid shuffle (see Materials and Methods). Cells were taken from an SC-Trp plus 5-FOA plate and resuspended in H2O, and 10-fold serial dilutions were plated on the same medium. The plates were photographed after 2 days at 30°C.

Plating of cells containing only the mutant H4 plasmid showed that all three mutants gave rise to both large and very small colonies (Fig. 2 A). When cells from the large colonies were replated, they again grew rapidly, but not as fast as the wild type (Fig. 2B). Replating of cells from small colonies of mutants L97A and G99A yielded both small and large colonies (Fig. 2C). On the other hand, replating of the cells from small colonies of the Y98A mutant gave mainly rapidly growing cells, and a reduced number of them, suggesting that the original Y98A mutant had poor viability unless it obtained compensatory mutations. In summary, the large colonies arose from cells with compensatory mutations and the small colonies contained a mixture of cells without and with such compensatory mutations.

Fig. 2.

Fig. 2.

Colony size heterogeneity and ploidy increase of three H4 mutants compared to wild-type H4. (A) Growth heterogeneity of the H4 mutants after being plated on SC-Trp plus 5-FOA medium to remove the URA3 plasmid encoding wild-type H4. Representative large colonies are indicated by black arrowheads and small colonies by white arrowheads. (B) Replating of large colonies from each of the mutants. (C) Replating of small colonies from each of the mutants. (D) Flow cytometry analysis of progeny of large colonies. (E) Flow cytometry analysis of progeny of small colonies.

To determine the ploidy of the mutants, we performed flow cytometry analysis on them. As shown in Fig. 2D, cells from the large colonies showed increased ploidy compared to haploid wild-type cells. The DNA peaks from the mutants resembled those of an authentic diploid, with peaks at 2n and 4n DNA content, suggesting that the mutants had become diploid. The increase-in-ploidy phenotype was observed for all 9 large colonies tested from the Y98A mutant, and also for 8 out of 9 large colonies from the L97A or G99A mutant. Cells from the small colonies of the L97A and G99A mutants showed a mixed DNA distribution with both 1n and 2n peaks, characteristic of haploids, and a 4n shoulder. This pattern reflects the mixture of small and large colonies seen in Fig. 2C. On the other hand, the Y98A mutant cells from small colonies had a prominent 4n peak, probably because that mutant is the sickest of the three and there is strong selective pressure for an increase in ploidy. These data show that mutations of these three H4 residues lead to poor growth and strong selective pressure to become diploid and thus grow more rapidly.

To examine the ploidy of the rapidly growing mutants in more detail, we carried out a microarray analysis, comparing the DNA content of each yeast gene for the histone mutants versus a wild-type haploid control. Consistent with the flow cytometry data, all genes from the mutants were present in at least twice the DNA content of the haploid control (Table 3). Interestingly, the data showed that many of the cells had become aneuploid, containing more than two copies of a specific chromosome. Strikingly, in every case of aneuploidy (7/9 mutant colonies tested), chromosome XI was present in 3 or 4 copies (Table 3). In addition, several mutant isolates also had 3 copies of chromosome III, VI, or XII.

Table 3.

Microarray analysis of H4 mutants with increased ploidya

Clone Ploidy Extra chromosome(s)
H4 L97A-1 2n 2 Chr XI
H4 L97A-2 2n
H4 L97A-3 2n 2 Chr XI
H4 Y98A-1 2n 1 Chr III, 2 Chr XI
H4 Y98A-2 2n 1 Chr III, 2 Chr XI, 1 Chr XII
H4 Y98A-3 2n 2 Chr XI
H4 G99A-1 2n
H4 G99A-2 2n 1 Chr XI
H4 G99A-3 2n 1 Chr XI, 1 Chr VI
a

Large colonies were grown in SC-Trp plus 5-FOA medium. Genomic DNA was purified from the cells, labeled, and hybridized to an S. cerevisiae expression array. The chromosomal profiles of the cells were analyzed with Feature Extraction 9.5.3.1. All samples showed a 2n DNA content compared to the wild type, and some samples had extra chromosomes over and above 2n, as indicated. Chr, chromosome.

We also measured the chromosome loss frequency for the mutants. The loss of chromosome III was measured by quantifying the ability of MATα cells expressing the H4 mutant to mate with a MATα test strain. Compared to the wild type, cells expressing L97A or G99A exhibited a 5-fold-elevated chromosome III loss frequency, and the Y98A mutant had close to a 10-fold-elevated frequency (Fig. 3 A). In another test, we measured the frequency of loss of a CEN plasmid. Just as was seen for chromosome III, cells expressing the H4 mutants exhibited an increased frequency of CEN plasmid loss (Fig. 3B), reinforcing the point that the H4 mutants have a chromosome segregation defect. The experiments depicted in Fig. 3 were done with cells containing plasmids expressing both wild-type and mutant H4 and reflect the semidominant phenotype of the H4 mutants. After plasmid shuffle, similar results were seen with cells expressing only the mutant H4.

Fig. 3.

Fig. 3.

Genome instability of the H4 mutants. (A) Chromosome III loss frequency of the H4 mutants. MATα cells expressing wild-type or mutant histone H4 were tested for the capacity to mate with a MATα test strain. The loss frequency is the number of cells that were able to mate divided by the total number of cells. The average of 3 independent experiments is shown. The error bars indicate standard deviations. (B) CEN plasmid loss frequency of the H4 mutants. Strains containing a CEN LEU2 plasmid (pRS315) and expressing wild-type or mutant H4 were used to measure the plasmid loss frequency as described in Materials and Methods. The average of 4 experiments is shown.

The poor growth and polyploidy are specific to mutations of three adjacent H4 C-terminal residues.

The poor growth and polyploidy of the H4 mutants were specific to mutations of residues 97, 98, and 99 and were not observed for H4 mutations of amino acids on either side of those three amino acids (Fig. 1 and data not shown). The G99A mutation is a relatively small change in that residue. To create a more drastic mutation, we changed Gly99 to Leu or Asp. Those mutants grew more slowly than the G99A mutant and had a more prominent 4n peak (Fig. 4 A and B). We also created a conservative change in amino acid 98 by mutating it from Tyr to Phe. If phosphorylation of Tyr98 plays an important role in its function, then mutating it to Phe should lead to an observable phenotype. As seen in Fig. 4C and D, the H4 Y98F mutant grew as well as the wild type and had a haploid DNA content. Thus, it is very unlikely that phosphorylation of Tyr98 plays an important role in the function of this residue, and in fact, there is no evidence that it is phosphorylated.

Fig. 4.

Fig. 4.

Analysis of the H4 C-terminal patch and adjoining H2A residues. (A and B) Growth defects of various H4 G99 mutants and their ploidy. (C and D) Growth and ploidy of an H4 Y98F mutant. (E and F) Growth and ploidy of H2A mutations of residues that abut the H4 C-terminal patch in the nucleosome structure. In all cases, strains were analyzed after growth on 5-FOA to remove the wild-type H4 or H2A plasmid.

The nucleosome structure shows that H4 residues 97 to 99 interact with H2A residues 101 to 104 in a β sheet (17, 30). Therefore, we tested whether mutation of any of those H2A residues led to the same phenotype seen for the H4 mutants. Mutation of V101, T102, or I103 to Ala caused no growth defect, and the mutants remained haploid (Fig. 4E and F). Since H2A amino acid 104 is an alanine, we mutated it to Arg, and we also created a V101R mutant. These two H2A mutants also grew normally and had a haploid DNA content (Fig. 4E and F). H2B residues K60, S63, and I64 are also somewhat near H4 residues 97 to 99 (17, 30). Mutating those three H2B residues also did not lead to a growth defect or polyploidy. In fact, in an initial screening of all the viable H2A, H2B, H3, and H4 Ala substitution mutants by flow cytometry, only the three H4 mutants affecting amino acids 97, 98, and 99 showed polyploidy (data not shown). Thus, we conclude that the phenotype of these three H4 mutants is unlikely to be due to a defective interaction of H4 with other histones in the nucleosome.

H4 mutants have a defect in kinetochore assembly.

The observed polyploidy could result from perturbation of cell cycle progression. Various stages in the cell cycle, such as DNA replication, spindle assembly, cohesion cleavage, and cytokinesis, and the response to DNA damage are all subject to checkpoint control (29). To help clarify the defect caused by the H4 mutants, we checked the growth of the mutants in combination with deletion of different checkpoint genes. Combining each of the H4 mutants with a rad9Δ or a mec1Δ mutant did not lead to any significant synthetic sickness (data not shown). These results suggested that the H4 mutants did not cause excess DNA damage or a replication defect. In contrast, combining the H4 mutants with deletion of the MAD2 spindle assembly checkpoint gene led to a much more severe growth defect (Fig. 5). Cells expressing the L97A or the G99A mutant were barely alive, and cells expressing the Y98A mutant were dead, except for a few giant colonies derived from cells that presumably had obtained compensatory mutations. These data suggested that the H4 mutants exhibited a defect in spindle or kinetochore assembly.

Fig. 5.

Fig. 5.

H4 mutants were synthetically sick, with deletion of MAD2, a spindle checkpoint gene. Strains YYY67 (MAD2) and YYY85 (mad2Δ), carrying a URA3 plasmid expressing wild-type H4, were transformed with a TRP1 plasmid expressing wild-type or mutant histone H4, and transformants were selected on SC-Ura-Trp medium. The growth of the transformants was checked after 4 days.

To investigate the fidelity of kinetochore assembly in the H4 mutants, we checked the localization of several kinetochore proteins: Nuf2 from the Ndc80 complex, Mtw1 from the MIND complex, and Spc105. Each of these proteins was tagged with GFP in separate strains, and the spindle pole body was labeled with Spc29-RFP in each strain (2). Two RFP foci could be seen in cells after duplication of the spindle pole body. The kinetochore was assembled nearby, as shown by two GFP foci adjacent to the RFP foci in most wild-type cells (Fig. 6 and Table 4). In cells expressing one of the H4 mutants, a higher percentage of cells contained only one GFP focus (Fig. 6 and Table 4). Significantly, in almost every case, the single GFP focus was associated with the brighter of the two red foci. The brighter red focus reflects the old spindle pole body, and the dimmer one represents the new spindle pole body. These results suggest that there is a significant delay or defect in the assembly of the kinetochore at the new spindle pole body in the H4 mutants. This was the case for all three kinetochore proteins (Table 4). In addition, no GFP focus was seen in 23 out of 900 cells examined for the three H4 mutants and only once in 300 cells for the wild type, again suggesting a defect in kinetochore assembly (Table 4).

Fig. 6.

Fig. 6.

Localization of kinetochore proteins. Representative fluorescence images of the GFP foci of Nuf2 (A), Spc105 (B), and Mtw1 (C) are shown. Spindle poles are labeled with Spc29-RFP. The frequencies of normal and abnormal foci observed for wild-type H4 and the three mutants are tabulated in Table 4. DIC, differential interference contrast.

Table 4.

Localization of kinetochore componentsa

Strain Histone Late-G1 cells
S, G2, and M cells
% with 1 or 0 focus
%1 GFP focus % 0 GFP focus % 1 GFP focus % 0 GFP focus
Nuf2-GFP WT 3 0 0 0 3
H4 L97A 5 0 2 0 7
H4 Y98A 10 0 1 3 14
H4 G99A 6 0 3 0 9
Spc105-GFP WT 7 0 2 1 10
H4 L97A 21 2 4 1 28
H4 Y98A 19 2 3 2 26
H4 G99A 17 0 3 2 22
Mtw1-GFP WT 8 0 6 0 14
H4 L97A 10 1 4 7 22
H4 Y98A 24 0 6 0 30
H4 G99A 10 0 9 3 22
a

Strains MAY8526 (Nuf2-GFP), MAY8539 (Spc105-GFP), and MAY8511 (Mtw1-GFP) were transformed with a plasmid expressing wild-type or mutant H4. All the strains contain Spc29-RFP. The localization of each GFP fusion kinetochore protein was analyzed by fluorescence microscopy in 100 cells with two Spc29-RFP foci. Cells with no bud were in late G1 phase, and those with a bud were either in S, G2, or early M phase. Representative pictures of the GFP foci are shown in Fig. 6.

The three H4 mutants have a more open chromatin structure.

The defective kinetochore assembly observed in the H4 mutants suggested that the chromatin structure around the centromeric region might be altered. Therefore, we tested the susceptibility of the chromatin of a specific centromere, CEN III, to digestion by the restriction enzyme DraI. This method had been used previously to examine centromeric chromatin in the case of a cse4 temperature-sensitive (TS) mutant (18). We found that the CEN III chromatin from each of the H4 mutants was much more susceptible to DraI digestion than the wild-type chromatin, suggesting that the chromatin of the mutants had a more open or altered structure (Fig. 7 A). To check if this effect was specific to centromeres, we tested the DraI sensitivity of the GAL10 locus. We found that the locus also exhibited greater sensitivity for all three mutants (Fig. 7B). This result suggested that the H4 mutants had an altered chromatin structure throughout the genome. This was confirmed by microccocal nuclease digestion of nuclei from wild-type cells and the three H4 mutants. The digests were phenol treated, and the resultant DNA fragments were separated by agarose gel electrophoresis. We then quantified the amount of DNA corresponding to mono-, di-, and trinucleosomes released by the enzyme digestion. As seen in Fig. 7C, there was a much greater fraction of mononucleosomes in each of the three mutants than in the wild type, and also somewhat more dinucleosomes. Thus, the chromatin from the mutants was more susceptible to micrococcal nuclease digestion, again suggesting an altered, somewhat more accessible chromatin structure in the H4 mutants.

Fig. 7.

Fig. 7.

H4 mutants displayed altered chromatin structure. (A) The sensitivities of nuclei to digestion by the restriction enzyme DraI at the CEN3 locus were compared for the wild type and the H4 mutants. A schematic representation of an EcoRI fragment containing CEN3 and its CDE II element containing three DraI sites is depicted. The sensitivity of these sites to DraI digestion of nuclei was measured by Southern blotting using a 0.9-kb probe located downstream of CEN3. DNA fragments generated by DraI digestion from these closely spaced sites were not separated from each other on the agarose gel used. The percentage of the CEN3 EcoRI fragment cut by DraI was calculated from the intensity of the 2.9-kb fragment compared to the intensity of the intact 5.1-kb fragment plus the 2.9-kb fragment and is shown on the right for the wild type and the H4 mutants. (B) A measurement of DraI sensitivity similar to that in panel A was performed for the GAL10 locus. In this case, an AvaI-NdeI fragment containing a single DraI site was used. The GAL10 locus is depicted on the left, and the percent DraI digestion is shown on the right. (C) Chromatin in H4 mutants was more accessible for micrococcal nuclease (MNase) digestion. Nuclei were purified from the cells expressing wild-type or mutant histone H4 and treated with MNase for 10, 20, 30, or 40 min. DNA was purified, resolved by agarose electrophoresis, and visualized by ethidium bromide staining (left). The intensities of the bands of mono-, di-, or trinucleosomes for the 30-min samples were quantified. The amount of trinucleosomes was designated arbitrary unit 1. The relative amounts of mononucleosomes and di-nucleosomes are shown in the graph on the right. Experiments were repeated in triplicate. (D) Chromatin immunoprecipitation of H4 (WT and Y98A) at three different loci. The percentage is the signal relative to the input and is an average of three independent experiments. The error bars indicate standard deviations.

The greater susceptibility to nucleases suggested that there was lower histone occupancy on the chromatin in the mutants. To check this, we used ChIP to compare the occupancy of wild-type and mutant H4 at three different loci on the yeast genome. As seen in Fig. 7D, at all three loci, CENIII, GAL10, and PMA1, there is less of the Y98A mutant H4 than wild-type H4. The effect is more pronounced at the two loci with little or no transcription, CENIII and GAL10, than at the heavily transcribed PMA1 locus. This is expected, given that transcription lowers histone occupancy (28).

The three H4 mutants interact genetically and biochemically with the histone chaperones, Rtt106 and CAF-I.

Since the ChIP results shown in Fig. 7D showed less mutant H4 than wild-type H4, we considered the possibility that the H4 mutants might be defective in histone deposition of H3/H4 dimers. Another hint that this might be the case was the fact that the growth defects and aneuploidy we observed were so localized to mutations of three adjacent residues on H4 and were not seen for mutations of residues on H2A and H2B that are near this H4 C-terminal patch in the nucleosome structure. We noted that H4 residues 97, 98, and 99 interact with the histone deposition protein, Asf1 (10). Therefore, we examined an asf1Δ mutant to see if it was polyploid and found it to be a normal haploid. We also generated asf1Δ double mutants with each of the H4 mutants and found no synthetic lethality or sickness (data not shown). In addition, mutations of Asf1 residues that reside at the Asf1-H4 interface do not have a severe growth defect (10).

Next, we tested the genes for three other histone chaperones, Hir1, Rtt106, and CAF-I, for genetic interactions with the H4 mutations. No genetic interactions were apparent with a hir1 mutation. On the other hand, unusual genetic interactions were seen with RTT106. We found that transforming plasmids expressing the H4 mutants into a strain expressing wild-type H4, and containing an rtt106Δ mutation, led to significantly improved growth of the mutants compared to an RTT106 strain (Fig. 8A). In addition to the improvement in growth, the rtt106 deletion also delayed the onset of diploidization (Fig. 8E). On the other hand, if the plasmid expressing wild-type H4 was eliminated by growth on 5-FOA, then the growth of the mutants was equally poor in the rtt106Δ and RTT106 strains. This observation is discussed below. A striking result was found with a mad2-rtt106 double mutant; the rtt106 mutation rescued the near lethality of the H4 mutants in the mad2 background (Fig. 8B). Overexpressing Rtt106 from a multicopy plasmid had the opposite effect of an rtt106 mutation in that it exacerbated the poor growth of the H4 mutants (Fig. 8C).

Fig. 8.

Fig. 8.

RTT106, CAC1, and CAC2 showed genetic interactions with the H4 mutants. (A) rtt106Δ improved the growth of H4 mutants. Strain YYY67 (RTT106) or YYY92 (rtt106Δ) containing pMS329 (HHT1-HHF1 URA3 CEN4) was transformed with TRP1 plasmids expressing wild-type or mutant H4. Growth of the transformants on −Ura −Trp medium is shown after 3 days of incubation. (B) The synthetic sickness or lethality of the mad2Δ-H4 double mutants could be partially rescued by rtt106Δ. As in panel A, the strains were transformed with plasmids expressing wild- type or mutant H4 and selected on the SC-Ura −Trp medium. The growth of the transformants after 4 days is shown. The mad2Δ rtt106Δ strain used was YYY93. (C) Overexpression (OE) of RTT106 exaggerated the growth defect of the H4 mutants. Strains containing either a vector or an RTT106 overexpression plasmid and pMS329 (HHT1-HHF1 URA3 CEN4) were transformed with plasmids expressing wild-type or mutant H4. Growth of the transformants after 3 days is shown. (D) cac1Δ or cac2Δ improved the growth of H4 mutants. Strains YYY67 (CAC CAC2), YYY83 (cac1Δ), or YYY88 (cac2Δ) containing pMS329 (HHT1-HHF1 URA3 CEN4) was transformed with TRP1 plasmids expressing wild-type or mutant H4. Growth of the transformants on −Ura −Trp medium is shown after 3 days of incubation. (E) rtt106Δ delayed the ploidy increase in H4 Y98A mutants. RTT106 or rtt106Δ strains were transformed with plasmids expressing wild-type H4 or the H4 Y98A mutant. Fresh transformants were grown in SC-Ura-Trp medium, and flow cytometry analysis was performed to check the ploidy of the cells.

CAF-I is a replication-coupled histone chaperone for H3/H4 and consists of three subunits, Cac1, Cac2, and Msi1. Just as was seen for rtt106Δ, cac1Δ and cac2Δ mutations also improved the growth of the three H4 mutants (Fig. 8D). In an rtt106Δ-cac1Δ double mutant, there was a somewhat greater growth improvement than in either single mutant (data not shown).

In view of the genetic interactions between the H4 mutants and RTT106, CAC1, and CAC2, we investigated whether the known binding of H3/H4 to these two chaperones was altered in the H4 mutants. First, we examined Rtt106, using a TAP-tagged Rtt106 strain to purify the protein from yeast expressing either wild-type H4 or one of the three H4 mutants. Western analysis was used to determine the amounts of H4 and H3 bound to Rtt106. To our surprise, there was much more mutant H4, as well as H3, associated with Rtt106 purified from the mutants than with that purified from the wild-type H4 (Fig. 9A). Rtt106 has been shown to interact with Cac2 in vivo (13). This association was the same for the mutants as for the wild type (Fig. 9A), suggesting that the increased association between Rtt106 and mutant H4/H3 was specific. Previous studies showed that H3 acetylated at lysine 56 is incorporated onto replicating DNA and that this was at least partially due to its increased affinity for Rtt106 compared to unacetylated H3 (15). Therefore, we considered the possibility that the increased amounts of H3 and H4 bound to Rtt106 in the mutants were due to a greatly increased amount of K56Ac H3 in the mutants (15). To check this, we probed the whole-cell extracts from the four strains with an antibody specific to H3 K56Ac. As seen in Fig. 9A, the amounts of H3K56Ac in the whole-cell extracts from wild-type and mutant cells were very similar, as were the amounts of total H3 or H4. Therefore, increased H3 K56 acetylation could not account for the large increase in binding of H4 and H3 to Rtt106 seen in the mutants.

Fig. 9.

Fig. 9.

Interaction of histone chaperones Rtt106 and CAF-I with H4. (A) Rtt106 purification. Rtt106-TAP was purified from the cells expressing wild-type or mutant H4. Copurified proteins were detected with Western blots using antibodies against H4, H3, H3K56Ac, Cac2, and Rtt106 by anti-CBP antibody. The antibodies were also used to detect protein levels in the whole-cell extract (WCE). (B) CAF-I purification using TAP-tagged Cac2 from cells expressing wild-type or mutant H4. Copurified proteins were detected by Western blots using antibodies to H4 and H3. Cac2 was detected with an anti-CBP antibody. (C) In vitro binding of histones purified from yeast to Rtt106. Wild-type or H4 mutant histones were purified from yeast, resolved by SDS-PAGE, and visualized by Coomassie blue (CB) staining (top) or by Western blotting (bottom). H3* is an N-terminally truncated form of H3 commonly found in yeast extracts. The histones were used in a pulldown experiment with GST-Rtt106 as described in Materials and Methods. Two concentrations of histones were mixed with 36 pmol of GST-Rtt106. (D) In vitro binding of recombinant H4 and H3 to Rtt106. Wild-type or Y98 mutant H4, along with H3, was coexpressed and purified from E. coli. H4 and H3 were used in a pulldown experiment with GST-Rtt106. Three concentrations of histones were mixed with 30 pmol of Rtt106.

To determine if mutant H4 also accumulated on CAF-I, we performed a similar purification of TAP-tagged Cac2 from yeast. The results for the H4 Y98A mutant, the mutant with the most pronounced growth defect, were similar to those found for Rtt106 in that there was much more mutant H4 than wild-type H4 bound to Cac2, with a correspondingly larger amount of H3 (Fig. 9B). On the other hand, for the L97A mutant, less H4 and H3 were bound to Cac2 than to the wild type, while the binding of H4 and H3 for the G99A mutant was about the same as for the wild type (Fig. 9B). Very similar results were found for two completely independent purifications of Cac2.

The TAP results described above could be due to increased affinity of all three H4 mutant proteins for Rtt106 and of the Y98A mutant for CAF-I, although it seemed unlikely that mutating these H4 residues would lead to better binding. Alternatively, the mutant H4 histones might bind to these two chaperones with the same or less affinity than the wild type but have a defect in transferring the histones to the next component in the deposition pathway, whether DNA or another chaperone. To distinguish between these possibilities in the case of Rtt106, we performed in vitro pulldown assays with GST-Rtt106 and histones purified from yeast or E. coli. As shown in Fig. 9C, H4 and H3 from yeast bound to Rtt106, as reported previously (13). Importantly, in this in vitro experiment, all three H4 mutant proteins, as well as H3, bound more weakly to Rtt106 than did wild-type H4/H3. We also expressed and purified recombinant H4/H3 (wild-type H4 or the Y98A mutant) from E. coli and repeated the pulldown with GST-Rtt106. A result similar to that with histones purified from yeast was seen; the mutant H4/H3 bound slightly more weakly (Fig. 9D). Therefore, the increased amount of mutant H4 and H3 bound to Rtt106-TAP purified from yeast is not due to an increased affinity of the mutant H4 proteins for Rtt106 but instead is due to the mutant H4 accumulating on Rtt106, presumably because it is blocked in the next step in the deposition pathway. We did not attempt similar binding experiments with recombinant CAF-I because of the difficulty of expressing all three of its subunits together.

DISCUSSION

In this study, we identified a unique 3-amino-acid patch near the C terminus of histone H4, composed of L97, Y98, and G99, which when mutated led to a severe growth defect accompanied by polyploidy and aneuploidy. The precise structure of this patch must be important for function. Mutating Y98 to Ala led to a severe growth defect, while changing it to Phe did not. Gly 99 was clearly an important residue, because even a conservative change to Ala led to a significant growth defect, while mutating it to a larger residue, such as Leu or Asp, led to a more severe defect. Strikingly, mutating residues on either side of this 3-amino-acid patch did not lead to the same phenotypes, nor did mutating nearby nucleosomal residues on H2A or H2B (Fig. 4). Thus, we do not think that the phenotypes seen for these three H4 mutants are due to an altered nucleosome structure.

Yeast mutations of H4 Y98 have been the subject of previous studies. Santisteban et al. found that a Y98G mutation was lethal and that a Y98H allele grew poorly at 25°C and was temperature sensitive, while a Y98W mutant had no observable phenotype (26). The lack of a phenotype seen for the Y98W mutant was similar to what we observed for a Y98F mutant (Fig. 4). In another study, a Y98A mutation was found to be lethal in one strain background and slow growing in another background (7). In human tumors and in cultured cells exposed to nitric oxide, Y98 is sometimes found to be modified by nitration, and this modification of tyrosine is considered a biomarker for nitric oxide-dependent oxidative stress (11, 23). It is intriguing to consider that the genome instability often associated with cancer cells may be partially due to this modification of H4 Y98.

Polyploidy and a chromosome segregation defect of the mutants.

A striking phenotype of the three H4 mutants was that the strains, initially haploid, showed a rapid increase in ploidy upon further growth, and this increase was closely linked to improved growth (Fig. 2). This observation was consistent with a previous report showing that polyploidy and aneuploidy are common genetic alterations in evolving poorly growing yeast mutants (24). We found that the H4 mutants rapidly became diploid, and when examined carefully by microarray analysis, many isolates actually had more than two copies of one or more chromosomes. Interestingly, in every case of aneuploidy, cells had 2 or 3 extra copies of chromosome XI, suggesting that overexpression of one or more genes on chromosome XI led to improved growth of the mutants. There were several histone-related genes on chromosome XI, including CSE4 and NAP1. Nap1 protein is a histone chaperone for H2A-H2B dimers (20). However, overexpression of NAP1 from a 2μm plasmid had no effect on the growth of the H4 mutants (data not shown). Cse4 is the histone H3 variant present at centromeres (18). Overexpression of CSE4 did improve the growth of the mutants, but the extent of improvement was much less than that observed for the evolved aneuploid strains (data not shown). Hence, other transcriptional changes associated with the extra copies of chromosome XI, probably in combination with the alterations on other chromosomes, are required to fully rescue the growth defect of the mutants.

In addition to polyploidy, the H4 mutants exhibited a chromosome loss phenotype. Both chromosome III and a centromere-based plasmid were lost at a high frequency compared to the wild type (Fig. 3). The chromosome instability exhibited by the mutants, as well as synthetic sickness/lethality seen with a mad2 mutation (Fig. 5), suggested that the H4 mutants might have a defect in attaching the mitotic spindle to centromeric chromatin. Indeed, we found that kinetochore assembly was defective in the mutants, and the defect was almost always seen in the newer of the two spindles in cells in which spindle pole duplication had occurred (Fig. 6 and Table 4). It was particularly significant that we observed this defect in strains with a plasmid expressing the mutant H4 but with both wild-type chromosomal H4/H3 genes, relying on the semidominant phenotype of the mutants. Presumably we would have seen a higher percentage of abnormal kinetochores if we had deleted one or both of the chromosomal H4/H3 genes.

We also found that CEN III chromatin had increased sensitivity to DraI nuclease in the case of all three H4 mutants compared to the wild type (Fig. 7A). However, examination of the GAL10 gene showed the same increased sensitivity to DraI cutting, suggesting that this effect might be genome wide (Fig. 7B). The kinetochore is likely to interact not only with the Cse4-containing nucleosome, but also with surrounding H3-containing ones (K. Bloom, personal communication). Thus, the defective kinetochore assembly of the mutants may be due to a lower nucleosome density in the centromere region or, conceivably, to a direct interaction of kinetochore components with H4 residues 97 to 99.

Global lower nucleosome density in the mutants.

In view of increased DraI sensitivity of the mutants at two loci, we looked at the micrococcal nuclease sensitivity of bulk chromatin and found a larger fraction of the chromatin was digested to mono- and dinucleosomes in the mutants than in the wild type (Fig. 7C). We also looked at H4 occupancy by chromatin immunoprecipitation at two loci expressed at a very low level, CEN III and GAL10, and at the highly expressed PMA1 gene. We found a lower occupancy for the mutants than for the wild type at all three loci (Fig. 7D). The combination of all these results leads us to conclude that the mutants have a lower than normal nucleosome density throughout the genome. We also considered the possibility that the altered chromatin structure changed gene expression in the H4 mutants, thus causing the increase in ploidy and the slow growth. A microarray analysis comparing gene expression of the mutants with that of the wild type found that no clear pattern emerged that could explain how altered gene expression caused the chromosome segregation defects (data not shown).

The roles of histone chaperones Rtt106 and CAF-I.

Affinity purification of the H4/H3 chaperone Rtt106 from yeast yielded a surprising result. Much more mutant H4 than wild-type H4 was bound to Rtt106 in each of the three H4 mutants (Fig. 9A). The amount of H3 bound was also correspondingly higher in the case of the mutants, which was not unexpected, since H4 and H3 both bind to Rtt106 and are deposited together, probably as a dimer. Purification of CAF-I from yeast using TAP-tagged Cac2 yielded results similar to those seen for Rtt106 for the H4 Y98A mutant, the one with the most severe phenotypes (Fig. 9B). However, in vitro binding experiments provided a different result. Regardless of the source of histones, purified from either yeast or E. coli, the mutant H4 bound slightly more weakly to recombinant Rtt106 than the wild-type H4 (Fig. 9C and D). Thus, the large amounts of H4 and H3 bound to Rtt106 purified from yeast in the case of the mutants (Fig. 9A) were not due to a greater affinity of the mutant H4 for Rtt106. Instead, they were due to a defect in the transfer of H4/H3 (we assume dimers) from Rtt106 to the next step in the deposition pathway, whether it was to another chaperone or to DNA itself. These results are depicted in cartoon form in Fig. 10A and B. The interpretation that deposition by Rtt106 and CAF-I is defective in the H4 mutants would explain why they have a lower nucleosome density on the chromatin, as judged by three different criteria. The centromeric region of the chromosomes may be particularly sensitive to this chromatin alteration, which would explain the kinetochore assembly and chromosome segregation defects observed for the H4 mutants. A previous study found that two H2A single-amino-acid replacement mutants showed an increase-in-ploidy and a chromosome loss phenotype, similar to what we found for the three H4 mutants. In the case of the H2A mutants, both genetic and biochemical experiments suggested that the phenotypes were due to an altered centromeric chromatin (22).

Fig. 10.

Fig. 10.

Model for the deposition defect caused by the histone H4 mutants. (A) Rtt106 or CAF-I deposits wild-type H4/H3 dimers (or possibly tetramers) onto DNA. (B) Mutant (MT) H4/H3 dimers accumulate on Rtt106 or CAF-I and cannot be transferred to the next step. Poor histone deposition causes a lower nucleosome density on the chromatin. (C) In the cells expressing both wild-type and mutant histone H4, the deposition of wild-type histone H4 is also affected because a certain fraction of the chaperone becomes inactive by nonproductive binding of mutant H4. (D) In cells with RTT106, CAC1, or CAC2 deletions, mutant H4/H3 cannot accumulate on either of the chaperones and thus can be transferred onto DNA more efficiently by another chaperone (colored purple).

We also observed strong genetic interactions between the three H4 mutants and RTT106, CAC1, and CAC2. Strains expressing wild-type H4 and one of the H4 mutants from different plasmids exhibited much better growth in the presence of a rtt106Δ, cac1Δ, or cac2Δ mutation (Fig. 8A and D). Conversely, overexpression of Rtt106 exacerbated the poor growth of the H4 mutants (Fig. 8C). These genetic interactions can be explained with the following model based on the large accumulation of mutant H4 seen bound to Rtt106 purified from yeast and of the Y98A mutant in the case of CAF-I. We suggest that in cells expressing both wild-type and mutant histones, the deposition of wild-type H4/H3 through Rtt106 or CAF-I is also affected, since a certain fraction of Rtt106 and CAF-I proteins have mutant histones bound to them nonproductively (Fig. 10C). As argued above, poor histone deposition causes a lower nucleosome density on the chromatin and, hence, poor growth. We propose that when RTT106, CAC1, or CAC2 is deleted, the deposition of histones is taken over by one of the other chaperones present in cells, and these chaperones do not bind mutant H4/H3 nonproductively the way Rtt106 or CAF-I does (Fig. 10D). This can explain why the growth of the histone mutants was improved by deletion of RTT106, CAC1, or CAC2. Similarly, overexpression of Rtt106 bound even more mutant H4/H3 and thus caused greater toxicity. Surprisingly, no apparent improvement in growth was observed in rtt106Δ or cac1Δ after the plasmid expressing wild-type H4 was removed by 5-FOA treatment, leaving mutant H4 as the only source of H4. One possible explanation is that in that case, the whole chromosome is occupied by mutant H4, and that might cause other defects that cancel the positive effects of alternate, redundant chaperones.

In conclusion, we have identified a small domain near the C terminus of histone H4 that is important for genome stability. When this domain is mutated, it leads to less deposition of H4/H3 onto chromatin, which in turn causes genome instability. Structural studies of the interaction between H4/H3 and the histone chaperones Rtt106 and CAF-I should shed further light on why this domain of H4 is so important for H4/H3 deposition.

ACKNOWLEDGMENTS

We thank Nancy Hollingsworth and Aaron Neiman for important suggestions, Zhiguo Zhang and Kerry Bloom for advice and reagents, Evelyn Prugar for valuable technical assistance, Michael Schultz for technical advice, and Carl Wu for histone expression plasmids.

This work was supported by NIH grants GM55641 and PO1 GM88297 to R.S., GM76272 to J.L., and GM69905 to A.S. S.N. is supported by a Fellowship Award from the Leukemia & Lymphoma Society.

Footnotes

▿

Published ahead of print on 28 March 2011.

REFERENCES

  • 1. Amberg D. C., Burke D., Strathern J. N., and Cold Spring Harbor Laboratory 2005. Methods in yeast genetics: a Cold Spring Harbor Laboratory course manual, 2005 ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]
  • 2. Anderson M., Haase J., Yeh E., Bloom K. 2009. Function and assembly of DNA looping, clustering, and microtubule attachment complexes within a eukaryotic kinetochore. Mol. Biol. Cell 20:4131–4139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Belotserkovskaya R., et al. 2003. FACT facilitates transcription-dependent nucleosome alteration. Science 301:1090–1093 [DOI] [PubMed] [Google Scholar]
  • 4. Bhaumik S. R., Green M. R. 2003. Interaction of Gal4p with components of transcription machinery in vivo. Methods Enzymol. 370:445–454 [DOI] [PubMed] [Google Scholar]
  • 5. Bloom K. S., Carbon J. 1982. Yeast centromere DNA is in a unique and highly ordered structure in chromosomes and small circular minichromosomes. Cell 29:305–317 [DOI] [PubMed] [Google Scholar]
  • 6. Camahort R., et al. 2007. Scm3 is essential to recruit the histone h3 variant cse4 to centromeres and to maintain a functional kinetochore. Mol. Cell 26:853–865 [DOI] [PubMed] [Google Scholar]
  • 7. Dai J., et al. 2008. Probing nucleosome function: a highly versatile library of synthetic histone H3 and H4 mutants. Cell 134:1066–1078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Dunleavy E. M., et al. 2009. HJURP is a cell-cycle-dependent maintenance and deposition factor of CENP-A at centromeres. Cell 137:485–497 [DOI] [PubMed] [Google Scholar]
  • 9. Edmondson D. G., Smith M. M., Roth S. Y. 1996. Repression domain of the yeast global repressor Tup1 interacts directly with histones H3 and H4. Genes Dev. 10:1247–1259 [DOI] [PubMed] [Google Scholar]
  • 10. English C. M., Adkins M. W., Carson J. J., Churchill M. E., Tyler J. K. 2006. Structural basis for the histone chaperone activity of Asf1. Cell 127:495–508 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Haqqani A. S., Kelly J. F., Birnboim H. C. 2002. Selective nitration of histone tyrosine residues in vivo in mutatect tumors. J. Biol. Chem. 277:3614–3621 [DOI] [PubMed] [Google Scholar]
  • 12. Hirschhorn J. N., Brown S. A., Clark C. D., Winston F. 1992. Evidence that SNF2/SWI2 and SNF5 activate transcription in yeast by altering chromatin structure. Genes Dev. 6:2288–2298 [DOI] [PubMed] [Google Scholar]
  • 13. Huang S., et al. 2005. Rtt106p is a histone chaperone involved in heterochromatin-mediated silencing. Proc. Natl. Acad. Sci. U. S. A. 102:13410–13415 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Levenstein M. E., Kadonaga J. T. 2002. Biochemical analysis of chromatin containing recombinant Drosophila core histones. J. Biol. Chem. 277:8749–8754 [DOI] [PubMed] [Google Scholar]
  • 15. Li Q., et al. 2008. Acetylation of histone H3 lysine 56 regulates replication-coupled nucleosome assembly. Cell 134:244–255 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Loyola A., Almouzni G. 2004. Histone chaperones, a supporting role in the limelight. Biochim. Biophys. Acta 1677:3–11 [DOI] [PubMed] [Google Scholar]
  • 17. Luger K., Mader A. W., Richmond R. K., Sargent D. F., Richmond T. J. 1997. Crystal structure of the nucleosome core particle at 2.8 A resolution. Nature 389:251–260 [DOI] [PubMed] [Google Scholar]
  • 18. Meluh P. B., Yang P., Glowczewski L., Koshland D., Smith M. M. 1998. Cse4p is a component of the core centromere of Saccharomyces cerevisiae. Cell 94:607–613 [DOI] [PubMed] [Google Scholar]
  • 19. Morgan B. A., Mittman B. A., Smith M. M. 1991. The highly conserved N-terminal domains of histones H3 and H4 are required for normal cell cycle progression. Mol. Cell. Biol. 11:4111–4120 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Mosammaparast N., Ewart C. S., Pemberton L. F. 2002. A role for nucleosome assembly protein 1 in the nuclear transport of histones H2A and H2B. EMBO J. 21:6527–6538 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Nakanishi S., et al. 2008. A comprehensive library of histone mutants identifies nucleosomal residues required for H3K4 methylation. Nat. Struct. Mol. Biol. 15:881–888 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Pinto I., Winston F. 2000. Histone H2A is required for normal centromere function in Saccharomyces cerevisiae. EMBO J. 19:1598–1612 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Radi R. 2004. Nitric oxide, oxidants, and protein tyrosine nitration. Proc. Natl. Acad. Sci. U. S. A. 101:4003–4008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Rancati G., et al. 2008. Aneuploidy underlies rapid adaptive evolution of yeast cells deprived of a conserved cytokinesis motor. Cell 135:879–893 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Ransom M., Dennehey B. K., Tyler J. K. 2010. Chaperoning histones during DNA replication and repair. Cell 140:183–195 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Santisteban M. S., Arents G., Moudrianakis E. N., Smith M. M. 1997. Histone octamer function in vivo: mutations in the dimer-tetramer interfaces disrupt both gene activation and repression. EMBO J. 16:2493–2506 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Schwabish M. A., Struhl K. 2006. Asf1 mediates histone eviction and deposition during elongation by RNA polymerase II. Mol. Cell 22:415–422 [DOI] [PubMed] [Google Scholar]
  • 28. Schwabish M. A., Struhl K. 2004. Evidence for eviction and rapid deposition of histones upon transcriptional elongation by RNA polymerase II. Mol. Cell. Biol. 24:10111–10117 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Storchova Z., Pellman D. 2004. From polyploidy to aneuploidy, genome instability and cancer. Nat. Rev. Mol. Cell Biol. 5:45–54 [DOI] [PubMed] [Google Scholar]
  • 30. White C. L., Suto R. K., Luger K. 2001. Structure of the yeast nucleosome core particle reveals fundamental changes in internucleosome interactions. EMBO J. 20:5207–5218 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Williams J. S., Hayashi T., Yanagida M., Russell P. 2009. Fission yeast Scm3 mediates stable assembly of Cnp1/CENP-A into centromeric chromatin. Mol. Cell 33:287–298 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Zhang W., Bone J. R., Edmondson D. G., Turner B. M., Roth S. Y. 1998. Essential and redundant functions of histone acetylation revealed by mutation of target lysines and loss of the Gcn5p acetyltransferase. EMBO J. 17:3155–3167 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES