Skip to main content
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 2011 Jul;31(14):2827–2837. doi: 10.1128/MCB.01435-10

An Extended Domain of Kcnq1ot1 Silencing Revealed by an Imprinted Fluorescent Reporter▿

Meaghan J Jones 1, Aaron B Bogutz 1, Louis Lefebvre 1,*
PMCID: PMC3133412  PMID: 21576366

Abstract

The distal region of mouse chromosome 7 contains two imprinted domains separated by a relatively gene-poor interval. We have previously described a transgenic mouse line called Tel7KI, which contains a green fluorescent protein (GFP) reporter inserted 2.6 kb upstream of the Ins2 gene at the proximal end of this interval. The GFP reporter from Tel7KI is imprinted and maternally expressed in postimplantation embryos. Here, we present evidence that the distal imprinting center, KvDMR1 (IC2), is responsible for the paternal silencing of Tel7KI. First, we show that Tel7KI is silenced when the noncoding RNA Kcnq1ot1 is biallelically expressed due to absence of maternal DNA methylation at IC2. Second, we use an embryonic stem (ES) cell differentiation assay to examine the effect of an IC2 deletion in cis to Tel7KI and show that it impairs the ability of the paternal transmission Tel7KI ES cells to silence GFP. These results suggested that Kcnq1ot1 silencing extends nearly 300 kb further than previously reported and led us to examine other transcripts between IC1 and IC2. We found that splice variants of Th and Ins2 are imprinted, maternally expressed, and regulated by IC2, showing that the silencing domain uncovered by our transgenic line also affects endogenous transcripts.

INTRODUCTION

Genomic imprinting refers to the differential epigenetic marking of parental alleles, which results in allele-specific expression of particular transcripts, termed imprinted genes. So far, more than 130 imprinted genes, many of which have important developmental functions, have been identified in the mouse (50), and parent-of-origin allelic effects have been identified in nearly 1,200 more genes in adult tissues (16). Imprinted genes are often arranged in clusters containing a single regulatory element, called an imprinting center (IC), which controls the allele-specific regulation of genes in the cluster. Many of these clusters contain essential genes or genes for which misregulation results in disease or defects, such that mutations affecting ICs can lead to complex developmental phenotypes. Thus, it is important to fully understand the mechanisms and extent of regulation from imprinting centers.

The distal region of mouse chromosome 7 (Chr 7) contains two well-characterized imprinted domains separated by a relatively gene-poor interval (see Fig. 4A) (22, 44). Within this region, the proximal imprinted domain is regulated by a primary differentially methylated region (DMR) upstream of the H19 gene, referred to as IC1, which controls the maternal expression of H19 as well as paternal expression of the Igf2 and Ins2 genes (2, 3, 46). Reciprocal expression of H19 and Igf2 is due to differential access to shared enhancers on the parental alleles through the action of a methylation-sensitive boundary element (4, 25, 28). Paternal allele-specific DNA methylation at IC1 blocks binding of the insulator factor CTCF, allowing Igf2 to access the downstream enhancers (4, 17). The paternal methylation at IC1 also spreads to secondary DMRs in the domain; at the H19 promoter it silences transcription on the paternal allele while at Igf2 it allows transcription by inactivating a silencer element (2, 9, 46). H19 and Igf2 are widely expressed and imprinted, while Ins2 is known to be imprinted only in yolk sac endoderm, where it is expressed from the paternal allele (12, 15).

Fig. 4.

Fig. 4.

Targeted deletion of IC2 in ES cells hemizygous for a paternal Tel7KI allele. (A) Diagrams showing the distal mouse Chr 7 imprinted domains and the strategy for deletion of IC2. Paternally expressed genes are in gray, maternally expressed genes are in white, and genes that are biallelically expressed are in black. Imprinting centers are indicated by gray circles. Detailed close-up of the wild-type allele (wt) shows IC2 (KvDMR1) including two CpG islands and the transcription start site for Kcnq1ot1 (arrow). In the IC2KO1 allele, IC2 is replaced by a loxP-flanked PGK-puro selectable marker (fPGK-puro-pA) by homologous recombination. G and B represent the BsrGI and BstBI sites at the deletion breakpoints, respectively, and K represents the KpnI sites used in Southern blotting using a 3′ flanking probe. PCRs used to detect the vector and targeted clones (IC2KO1-5′) are shown below the IC2KO1 allele. (B) PCR screening of three puromycin-resistant clones. Clones were analyzed with a wild-type reaction for the Ins2 locus, a reaction specific to the electroporated targeting vector (vector), and a targeting-specific reaction spanning the 5′ arm of homology (IC2KO1-5′). Clone 3D is one of the two positive clones recovered out of 91 colonies analyzed. (C) Southern blot analysis of clone 3D with a KpnI digest of ES cell genomic DNA showing a 12-kb wild-type band and an 8-kb IC2KO1 band, using the 3′ flanking probe. (D) Parental allele-specific analysis of IC2KO in clone 3D by DNA methylation analysis using COBRA. Wild-type (+/+), reciprocal DelTel7 hemizygous embryos (Δ/+ and +/Δ), in which the maternal and paternal alleles of IC2 are deleted (33), respectively, and clone 3D were analyzed. COBRA analysis generates a common band (c), a methylated maternal band (m), and an uncut unmethylated paternal band (u). In clone 3D, the unmethylated paternal allele of IC2 has been deleted.

The more distal imprinted domain on Chr 7 is controlled by the noncoding RNA (ncRNA) Kcnq1ot1 produced from a promoter which overlaps with the gametic DMR KvDMR1, also called IC2. Kcnq1ot1 is produced only from the unmethylated paternal allele and represses in cis at least eight known linked protein-coding genes, which are consequently only or preferentially expressed from the maternal allele. One of these genes, Cdkn1c, also acquires allele-specific DNA methylation at a secondary DMR on the silent paternal allele in the early postimplantation period (5). All the IC2-regulated genes acquire silencing histone modifications on their paternal alleles as a consequence of expression of Kcnq1ot1 (27, 47). An interesting distinction exists between genes in this domain with respect to their distances from IC2 itself. The genes that are located in close proximity to IC2 are imprinted and maternally expressed in both placental and embryonic lineages while those located farther away are imprinted only in placental lineages (26). A model for regulation of imprinting in this cluster suggests that expression of Kcnq1ot1 from the paternal allele results in recruitment of histone methyltransferases and silencing complexes which act in cis to generate a bidirectional silent domain. RNA fluorescence in situ hybridization (FISH) for Kcnq1ot1 supports this model; in the embryo the signal observed for Kcnq1ot1 is smaller than it is in the placenta, consistent with distant genes being silenced only in the placenta (40). Both knockout of IC2 (IC2KO) and truncation of Kcnq1ot1 result in loss of silencing and subsequent reactivation of the paternal alleles of the linked genes, with some exceptions (14, 30, 43). The proximal-most gene known to be regulated by IC2 is Ascl2, the distal most gene regulated by IC1 is Ins2, and the intervening 280 kb is referred to in this study as the Ascl2-Ins2 interval. Two genes reside in this region, Th and Gm6471, and an alternative promoter for Ins2 exists ∼20 kb distal to the main promoter.

We previously described the Tel7KI mouse line containing a green fluorescent protein (GFP) reporter inserted 2.6 kb distal to the Ins2 gene (19). In this line GFP is expressed solely from the maternal allele in postimplantation embryos while in the placenta both alleles are expressed (19). In the embryo, the silent paternal allele is associated with high levels of DNA methylation at the CAG promoter driving GFP (19). This methylation is not observed in sperm, indicating that the imprint at Tel7KI is a somatic imprint established in postimplantation embryos as a consequence of a long-range effect from one of the two imprinting centers in the region. Two possible scenarios can be envisioned. Paternal DNA methylation at IC1 which spreads along the chromosome to methylate the secondary DMRs at the H19 promoter and at Igf2 could continue to spread as far as Tel7KI, inactivating the GFP on the paternal allele. Alternatively, the silent domain generated on the paternal allele by expression of Kcnq1ot1 may be larger than previously thought, and silencing modifications such as DNA methylation may be recruited to Tel7KI through the actions of the ncRNA or its transcription.

Here, we present evidence that the primary maternal imprint at KvDMR1 (IC2) is responsible for the imprinted pattern observed at Tel7KI. Together, our results demonstrate that the effects of IC2 can reach at least 280 kb further proximal than previously shown and regulate not only Tel7KI but also endogenous transcripts in the Ascl2-Ins2 interval. Our results have important implications for our understanding of imprinted gene regulation in the genome and for the description of ncRNA functions in epigenetic silencing and establish Tel7KI as a reporter for the Kcnq1ot1-mediated silencing pathway.

MATERIALS AND METHODS

Mice.

Derivation of the Tel7KI mice (accession number MGI:3833432) was previously described (19, 33). 129S1/SvImJ and C57BL/6J mice were from The Jackson Laboratory (stock numbers 002448 and 000664, respectively), CD-1 and BALB/c mice were from the University of British Columbia (UBC) Animal Care Centre. Del7AI mice (MGI:3662901) carry a deletion of the Ascl2-Ins2 interval maintained on the outbred CD-1 background and were previously described (22). DelTel7 mice carry a chromosome 7 truncated immediately distal to Ins2 (33). The IC2KO (KvDMR1 KO) mice (14) were on the C57BL/6J strain background. The congenic mouse line with distal Chr 7 Mus musculus castaneus single nucleotide polymorphisms (SNPs) on the 129S1 background (CAST7) was derived in our laboratory. All animal experimentation followed the guidelines from the Canadian Council on Animal Care under UBC animal care license numbers A03-0289, A03-0292, and A08-0890.

Embryos and genotyping.

Animals of appropriate transgenic or strain background were mated, and the day of the vaginal plug was defined as embryonic day 0.5 (E0.5). Preimplantation embryos were collected at E3.5 as described for embryonic stem (ES) cell derivation (32). For postimplantation embryo collection, females were sacrificed at appropriate gestational day, embryos were photographed, and yolk sac samples were taken for PCR genotyping (32). Photographs were taken on a Leica MS5 dissecting microscope equipped with a QImaging MicroPublisher 3.3 Real-Time Viewing color camera and the fluorescent light source MAA-03 (BLS Ltd.). Genotyping of the Tel7KI and Del7AI alleles was performed with Δ5′ PCR (33); genotyping of Dnmt3l-null females with the Dnmt3lwt (where wt is wild type) and Dnmt3lKO reactions (6) and genotyping of the IC2KO with the IC2wt and IC2KO reactions (14) were all performed as previously described. Primer sequences for genotyping are given in Table 1. Note that for all genotypes presented here, the maternally inherited allele is always given first.

Table 1.

Sequences of oligonucleotide primers used in this study

Purpose (target) Sequence Name Reference
Genotyping (I2wt) AGCACAGTCCCCTGTGTTCT I2wt-F 19
GTCTTCAACCCCATGTGACC I2wt-R 19
Genotyping (Δ5′) CCAAAGAACGGAGCCGGTTG PGK4 33
TGAATGGGAAATGTGGTCCTTGG M2G 33
Genotyping (Dnmt3lwt) GGTCCTTAGGGGTTCTGGAC 3lwt-F 6
TAGCTACCCGTGGCCAATAC 3lwt-R 6
Genotyping (Dnmt3lKO) GTTGGAGGATTGGGAAGACA 3lmut3′-F 6
CCATGGCATTGATCCTCTCT 3lmut3′-R 6
Genotyping (IC2wt) GGTTTTTCACGGTGAGGTCATATCA tF239 14
GGAGGTCTAGGCTCAGGACAAACACT tR240 14
Genotyping (IC2KO) TATGTTCACCAGGGAAGTGCCTCATA delF90 14
TCGAGGGACCTAATAACTTCGTATAG delR322 14
Bisufite (CAG) GGAGAGGTGYGGYGGTAGTTAATTAGAG BABF6 19
TCATTAAACCAAACRCTAATTACAACCC BABR4c 19
AAACCCCTCAAAACTTTCACRCAACCACAA BABR5d 19
Bisulfite (H19 DMR) GAGTATTTAGGAGGTATAAGAATT BMsp2t1 10
ATCAAAAACTAACATAAACCCCT BHha1t3 10
TGTAAGGAGATTATGTTTTATTTTTGGA BMsp2t2.2 33
AACCTCATAAAACCCATAACTATA BHha1t4.2 33
Bisulfite (KvDMR1) AAAACTTTTCTATTCAACTTAATTCCCAAC Kcnq1ot1 OR 47
GGTTTTAAGATTATTTTTGTTTTTGTAAGT Kcnq1ot1 IF 47
AATTCTCCTAAATATAATTTTTTTCTCAAC Kcnq1ot1 IR 47
RT-PCR (CAG-GFP) GCTCTGACTGACCGCGTTACT BAE1F 19
GGACACGCTGAACTTGTGG BAE1R 19
RT-PCR (Gapdh) ACCACAGTCCATGCCATCAC G3PF 33
TCCACCACCCTGTTGCTGTA G3PR 33
RT-PCR (Ppia) CGCGTCTCCTTCGAGCTGTTTG PpiaF 29
TGTAAAGTCACCACCCTGGCACAT PpiaR 29
RT-PCR (Th and Th-α) CAGAGCAGGATACCAAGCAGG Th1F This study
CAGGTGAACATCTGGTGTCCG ThαF This study
CGAAGCGCACAAAGTACTCCAG Th3R This study
TCAGTGATGCCAAGGACAAG Th12F This study
ATACAGCATGAAGGGCAGGA Th13R This study
RT-PCR (rat Th isoforms) CAGAGCAGGATGCCAAGCAGG rTh1F This study
GCAGAACGTCTGGTCCCTGAG rThαF This study
CGAAGCGCACAAAATACTCCAG rTh3R This study
RT-PCR (Ins2-006) TCCTACGCTGAAATTCCAAAA Ins2aF3 This study
CAAAGGTGCT GCTTGACAAA Ins22R1 This study
RT-PCR (Gm6471) ATGGAAGAGA GGCAAAGCAA EG624121F This study
CAGATGCTGC AGGTCCTTCT EG624121R This study
RT-PCR (Kcnq1ot1) ATTGAGATCCCAGGGCTGAGG Lqt2 33
GGCACACGGTATGAGAAAAGATTG Lqt18 33
IC2 KO screening GAGCTTCCTGGCTGTTTTTG IC2sF2 This study
AAAGAACTGGGGGTTCCACT IC2scF1 This study
ACCCGGTAGAATTTCGAGGT IC2scR1 This study
ACCAGGGAAGTGCCTCATAA IC2KODR1 This study

ES cells and differentiation assay.

F1 hybrid ES cell lines carrying the Tel7KI allele on the maternal (KIM cells) or paternal (KIP cells) Chr 7 were derived from reciprocal crosses between C57BL/6J mice and Tel7KI hemizygotes maintained on the 129S1/SvImJ background. The derivation, culture, and electroporation of embryonic stem cells followed standard protocols (32). ES cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 15% fetal bovine serum (HyClone), 2 mM l-glutamine (Gibco), 0.1 mM 2-mercaptoethanol (Sigma), 0.1 mM minimal essential medium (MEM) nonessential amino acids (Gibco), 1 mM sodium pyruvate (Gibco), 50 μg/ml each penicillin and streptomycin (Gibco), and 100 μl of leukemia inhibitory factor (LIF) concentrate (generously provided by Hao Ding, University of Manitoba). Differentiation of ES cells into embryoid bodies was performed by plating 1 × 106 cells per ungelatinized petri dish in ES medium without LIF. The medium was changed every 2 days, and samples containing approximately 15 to 20 embryoid bodies (EBs) for flow cytometry and/or DNA methylation analysis were taken at appropriate time intervals. KIMA2 and KIPC3 cells are both XX, whereas KIPC4 cells are XY.

IC2 knockout generation and screening.

The IC2KO ES cell line KIPC4-IC2KO1 was obtained by electroporation of KIPC4 cells with a targeting vector based on the published KvDMR1 knockout by Fitzpatrick et al. (14). The vector was modified to carry a puromycin resistance gene between loxP sites, replacing the original neo marker, and with the addition of a PGK-DTA-negative selectable marker outside the small arm of homology. KIPC4 ES cells were electroporated and selected for puromycin resistance, and then picked colonies were screened by PCR for the targeting vector (vector PCR) with the primers IC2sF2 and IC2scR1 and across the small arm of homology (IC2KO1-5′ PCR) with the primers IC2scF1 and IC2scR1 under the following conditions: 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 3 min. To determine which parental allele of IC2 had been deleted, in positive clones, we performed combined bisulfite restriction analysis (COBRA) (53) with the KvDMR1 bisulfite reaction described below. Southern hybridization of genomic DNA was performed as described previously (23), with two digests, KpnI and DraIII, using a 3′ flanking PCR product probe created with oligonucleotides KOp5F2 and KOp5R1. Of 72 clones picked, clone 3D with an IC2KO in cis to Tel7KI was identified, expanded, and electroporated with pCAGGS-nlsCre (22) for transient Cre production to collapse the puromycin resistance marker. Note that the KIPC4-IC2KO1 ES cells contain four loxP sites inserted in the same orientation: two flanking the PGK-puro cassette and two flanking the Tel7KI insertion (33). Replicate plates were scored for GFP expression and puromycin sensitivity. Twenty-one of 198 clones were found to be GFP positive (retaining Tel7KI) but puromycin sensitive and were screened by PCR for the deletion of the puromycin resistance marker and retention of the IC2-Tel7KI interval with primers IC2KODR1 and IC2sF2; of these 19 were found with the correct pattern.

DNA bisulfite modification and sequencing.

DNA was extracted from the remaining Trizol fraction or from tissues digested with proteinase K (23). Sodium bisulfite modification and analysis of the CAG promoter from Tel7KI as well as IC1 and IC2 have previously been described (11, 19, 33, 47). For all DNA methylation analyses by bisulfite sequencing, four independent PCRs were performed on the bisulfite-modified genomic DNA samples, and the products were individually cloned for sequencing (1 to 4 clones sequenced per PCR product). For COBRA analysis of KvDMR1 (IC2), the 335-bp fragment was digested with BccI, which cut at 45 and 165 bp, as well as with RsaI, which cut only the methylated CpG at 185. For IC1 COBRA analysis, the 425-bp product was digested with RsaI, which cut the methylated allele only at 316 bp. All oligonucleotide primer sequences used in our study are in presented in Table 1.

Flow cytometry.

Embryoid bodies were washed in phosphate-buffered saline (PBS) and incubated in trypsin (0.25%; Gibco) while adherent cells were treated with trypsin as described previously (32). Suspensions were pipetted up and down to disaggregate cells after 2 and 5 min at 37°C, and the trypsin was inactivated by the addition of fluorescence-activated cell sorting (FACS) buffer (PBS with 2 mM EDTA, 20% fetal calf serum [FCS; Gibco], and 1 μg/ml propidium iodide [Gibco]). Analyses were performed on a BD LSRII instrument, and data were processed with FlowJo, version 8.0.

RNA extraction, RT-PCR, and allele-specific analysis.

RNA was extracted from snap-frozen tissues by a single-step isolation using Trizol (Invitrogen) according to the manufacturer's directions. Approximately 1 μg of RNA was reverse transcribed as per the Invitrogen SuperScript II protocol. Reverse transcription-PCR (RT-PCR) on enhanced GFP (EGFP) transcript from Tel7KI was detected with the BAE1F and BAE1R primers as described previously (19). RT-PCR analyses of Ins2-006 (primers Ins2aF3 and Ins22R1), Th (primers Th1F and Th3R), and Th-α (primers ThαF and Th3R) were performed as follows: 95°C 2 min, followed by 40 cycles (36 for Th and Thα) of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, with a final step at 72°C for 5 min. Analysis of Gm6471 by quantitative RT-PCR (qRT-PCR) with primers EG624121F and EG624121R was performed as described previously (19). All primer sequences are given in Table 1. Allele-specific analysis of Th using a polymorphism between the BALB/c and C57BL/6J strains in the 3′ untranslated region (UTR) (SNP database [dbSNP] accession number rs3023170; BALB/c, T; C57BL/6J, C) was performed by sequencing of the Th12F/Th13R PCR product, followed by tracing analysis with the PHRED program (13). Relative values for base calls were normalized to the call of the BALB/c allele.

RESULTS

Expression of Tel7KI requires maternal methylation.

We previously proposed that the GFP reporter of the Tel7KI allele has acquired an embryonic imprinted expression pattern via long-range effects mediated from one of the flanking imprinting centers, the paternally methylated IC1 or the maternally methylated IC2 (19). To distinguish between these two possibilities, we first studied the consequence of aberrant maternal Kcnq1ot1 expression on Tel7KI by analyzing progeny of Dnmt3l-null females, in which Kcnq1ot1 is biallelically expressed due to perturbed establishment of maternal imprints at IC2 (1, 6).

Females homozygous for the Tel7KI allele and who were either wild type or null for Dnmt3l were mated to males homozygous for M. musculus castaneus polymorphisms on distal Chr 7, and embryos were collected at E9.5. Whereas Dnmt3l+/+ Tel7KI/Tel7KI females gave rise to GFP-positive progeny, as previously reported (19), embryos collected from Dnmt3l−/− Tel7KI/Tel7KI females did not show GFP expression (Fig. 1A). This result was confirmed by RT-PCR: no GFP transcript was detected from the Tel7KI allele in Tel7KI/+ embryos born to a Dnmt3l-null female (Fig. 1B). In addition, DNA methylation at the CAG promoter driving GFP expression was high in embryos born to Dnmt3l-null females (72%) but low in those born to females wild type for Dnmt3l (8.6%) (Fig. 1C). DNA methylation analysis of both imprinting centers in embryos from Dnmt3l-null females showed that while the paternally inherited DNA methylation imprint at IC1 was unaffected in these embryos, IC2 was unmethylated on both alleles (Fig. 1D). This loss of maternal DNA methylation at IC2 resulted in biallelic Kcnq1ot1 expression (Fig. 1E). Our results indicate that expression of Tel7KI requires a maternally inherited DNA methylation imprint and suggest that the methylation defect at IC2 and the biallelic expression of Kcnq1ot1 are responsible for the aberrant cis-silencing and acquisition of DNA methylation observed on the maternal allele of Tel7KI in progeny from Dnmt3l-null females.

Fig. 1.

Fig. 1.

Lack of maternal DNA methylation leads to Tel7KI silencing. (A) GFP expression is observed at E9.5 upon maternal transmission of Tel7KI from wild-type Dnmt3l +/+ females but not in maternal Tel7KI/+ embryos from Dnmt3l-null females (Dnmt3l −/+ embryo). (B) RT-PCR of total embryonic RNA samples with (+) or without (−) reverse transcriptase (RT) for the GFP transcript shows loss of expression from Tel7KI in embryos from Dnmt3l-null females. Amplification of Gapdh mRNA was used as a control. (C) Sodium bisulfite sequencing of the maternal CAG promoter driving GFP expression shows greater levels of DNA methylation in Dnmt3l maternal-null embryos (Dnmt3l−/+) than in embryos from Dnmt3l wild-type females. (D) COBRA analysis of DNA methylation at IC1 (top) and IC2 (bottom) in genomic DNA from embryos from wild-type (3l+/+) and Dnmt3l-null (3l−/+) females. Bands are marked as methylated (m), unmethylated (u), or common (c). (E) Allele-specific analysis of Kcnq1ot1 expression in Tel7KI/+ embryos from Dnmt3l wild-type (3l+/+) and null (3l−/+) females. M, maternal; P, paternal.

Imprinted silencing of Tel7KI during ES cell differentiation.

Blastocysts carrying maternal or paternal Tel7KI alleles both show GFP expression in the inner cell mass, consistent with the notion that Tel7KI is regulated by a somatic imprint acquired in postimplantation embryos (19). We established new (129S1 × C57BL/6J)F1 hybrid ES cell lines from embryos carrying a maternally (KIM cells) or paternally (KIP cells) inherited Tel7KI transgene. Both of these cell lines expressed GFP in close to 100% of cells examined by flow cytometry, confirming absence of imprinting in undifferentiated ES cells (Fig. 2A). When LIF was withdrawn and the cells were allowed to differentiate into embryoid bodies, the KIPC3 line carrying the paternal Tel7KI silenced its GFP in a greater percentage of cells than the KIMA2 line, which had Tel7KI on the maternal allele (3% versus 55% GFP-positive cells after 15 days of differentiation) (Fig. 2B). This result is reflective of what we previously observed in vivo, where at E9.5 approximately 40% of cells from maternal transmission embryos expressed GFP while there was nearly no detectable GFP expression from paternal transmission embryos (19). In these experiments, a line carrying EGFP under the control of the Oct4 (Pou5f1) promoter is shown as a control for ES cell differentiation.

Fig. 2.

Fig. 2.

Imprinted silencing of Tel7KI in differentiated embryonic stem cells. (A) Analysis of GFP expression in undifferentiated ES cell lines carrying a maternal (KIM) or paternal (KIP) Tel7KI allele by flow cytometry. Horizontal gates were set using a GFP-negative cell line and indicate the percentage of GFP-negative versus GFP-positive cells. (B) Fraction of cells that are GFP positive (%) during 15 days of ES cell differentiation in EBs, as measured by flow cytometry. Cell lines carrying a maternal (KIMA2) or a paternal (KIPC3) Tel7KI were differentiated by LIF withdrawal and compared with an Oct4-EGFP cell line (48).

We next analyzed DNA methylation levels at the CAG promoter driving GFP expression by bisulfite sequencing before and after differentiation for the KIMA2 line and two KIP lines, KIPC3 and KIPC4. In undifferentiated ES cells, both KIP and KIM ES cell lines were hypomethylated, with methylation levels averaging 7.6% (Fig. 3B, day 0). In day 15 embryoid bodies however, the KIP and KIM lines were markedly different, and the KIP cell lines acquired a greater amount of methylation at the CAG promoter than the KIM line, mirroring the difference in GFP expression (Fig. 3B, day 15). These results appropriately reflect what we had previously observed in vivo in E10.5 embryos, where the paternal and maternal Tel7KI transgenes were methylated at 69% and 16%, respectively (19). Our results show that differentiation of Tel7KI transgenic ES cells recapitulates the imprinted behavior observed for this allele in vivo and provide an assay to analyze cis- and trans-acting factors implicated in the epigenetic silencing of the paternally inherited allele.

Fig. 3.

Fig. 3.

Deletion of IC2 prevents silencing of Tel7KI during ES cell differentiation. (A) Percentage of GFP-positive cells over 15 days of ES cell differentiation into EBs, as determined by flow cytometry. Paternal hemizygous Tel7KI ES cells with (KIPC4-IC2KO1) or without (KIPC4) the targeted IC2 deletion were compared to the maternal hemizygous line (KIMA2) and an Oct4-EGFP transgenic line as a differentiation control. (B) DNA methylation analysis by bisulfite sequencing at the CAG promoter of KIMA2, KIPC3, KIPC4, and KIPC4-IC2KO1 undifferentiated ES cells (d0) and day 15 EBs (d15). Circles represent each CpG analyzed; filled circles are methylated, empty circles are unmethylated, and omitted sites were ambiguous. The overall percent methylated CpGs is indicated below each sample. (C) Southern blot analysis of genomic DNA from KIPC4-IC2KO1 and KIPC4-IC2KO1.1 cell lines with a DraIII digest showing a 13.5-kb wild-type band, an 8-kb IC2KO1 band, and a 12-kb IC2KO1.1 band, using a 3′ flanking probe. (D) Analysis of GFP silencing during ES cell differentiation. Removal of the puromycin resistance marker has no effect on the silencing defect observed in KIPC4-IC2KO1.1 cells, which behave similarly to KIPC4-IC2KO1 and KIMA2 cells.

Deletion of IC2 in cis to Tel7KI inhibits paternal silencing.

We took advantage of the differentiation assay described above to ask directly whether IC2 and Kcnq1ot1 are required for silencing of the paternally inherited Tel7KI, as suggested from the results on maternal DNA methylation imprint-deficient embryos from Dnmt3l-null females. A targeted deletion of IC2 in the paternal transmission Tel7KI ES cell line KIPC4 was engineered based on the previously generated deletion of KvDMR1 (Fig. 4A) (14). The KIPC4 line was chosen for these experiments because of its XY sex chromosome constitution and the previous observation that XX ES cells demonstrate epigenetic instability (35, 55). Furthermore, whereas the differences in GFP silencing between KIPC3 (XX) and KIPC4 (XY) were found to be reproducible in three differentiation assays, they do not reach statistical significance (P = 0.1). The CpG island KvDMR1 and transcriptional start site of Kcnq1ot1 were replaced by a loxP-flanked puromycin resistance marker, and successful targeting was confirmed by PCR and Southern blotting in clone 3D (Fig. 4B and C). To determine which parental allele of IC2 had been deleted in this clone, we analyzed the epigenetic polymorphism at IC2 itself. Our DNA methylation analysis using combined bisulfite restriction analysis (COBRA) (53) showed that clone 3D had deleted the paternal unmethylated allele of IC2, confirming that it carries the IC2 knockout in cis to Tel7KI (Fig. 4D). This cis configuration was also demonstrated by efficient Cre-mediated deletion of the IC2-Tel7KI interval in ES cells, with each allele containing two loxP sites, all in the same orientation (data not shown). The ES cell line derived from this clone and carrying this IC2 knockout allele (IC2KO1) and the Tel7KI transgene in cis on paternal Chr 7 is referred to as the KIPC4-IC2KO1 line.

The KIPC4-IC2KO1 cells were differentiated into embryoid bodies, and the GFP expression profile during differentiation was compared to that of the parental KIPC4 ES cell line, the maternal hemizygous line KIMA2, and control Oct4-EGFP ES cells (Fig. 3A). Over 15 days of differentiation monitored by FACS analysis every 5 days, the KIPC4-IC2KO1 cells were not able to silence GFP as quickly or efficiently as the parental KIP line. Both cell lines began with nearly 100% GFP-expressing cells, but by day 10 of differentiation, only 37.5% of the KIPC4 cells were GFP positive while 68% of the KIPC4-IC2KO1 cells were expressing the reporter (Fig. 3A). DNA methylation analysis at the CAG promoter showed that methylation was not acquired to the same density in KIP cells carrying the IC2 knockout as the parental cells (Fig. 3B). Thus, deletion of IC2 in cis to Tel7KI impairs the ability of KIPC4-IC2KO1 ES cells to silence the GFP from Tel7KI upon differentiation. GFP expression and DNA methylation profiles of the targeted cells were similar to those seen in the cell line carrying a maternally inherited Tel7KI and suggest an epigenotype switch.

Cre expression in these ES cells and selection for GFP-positive, puromycin-sensitive clones resulted in collapse of the resistance cassette while maintaining the presence of Tel7KI (Fig. 3C). These cells are referred to as KIPC4-IC2KO1.1. Removal of the puromycin marker had no effect on the epigenotype switch (Fig. 3D). Together, our differentiation assays comparing the parental KIPC4 ES cell line with the IC2-deleted variants revealed a statistically significant difference in GFP silencing (P = 0.036), consistent with a role for IC2 in silencing the paternal allele of Tel7KI in this ES cell-based system.

Imprinting and IC2 regulation of a placenta-specific Th isoform initiating from a retrotransposon promoter.

Our analyses of Tel7KI imprinting in the progeny of Dnmt3l-null females as well as in differentiating ES cells carrying a deletion of IC2 both suggest that the paternal allele-specific silencing pathway mediated by Kcnq1ot1 is able to extend considerably further proximally than previously thought. We wished to provide further evidence for this conclusion and examine Kcnq1ot1 silencing across the Ascl2-Ins2 interval at endogenous transcripts. The Del7AI mouse line is particularly useful for the discovery of novel imprinted transcripts in the Ascl2-Ins2 interval (22). This line contains an interstitial deletion of the entire 280-kb region, from 4.34 kb proximal to Ascl2 to 2.56 kb distal to Ins2 (22). Reciprocal inheritance of this deletion can thus reveal parent-of-origin-specific gene expression of transcripts mapping to the deleted interval.

Three currently annotated transcripts are located in the Ascl2-Ins2 interval deleted in Del7AI: Th, Gm6471-201, and an alternative transcript of Ins2, called Ins2-006. Th codes for tyrosine hydroxylase, the rate-limiting enzyme in the catecholamine synthesis pathway, for which conflicting data exist as to its imprinted status (41, 54). An alternative transcript of Th (ENSMUST00000105929), which we call Th-α, is driven by a solitary long terminal repeat (LTR) promoter of a class II retrotransposon (RMER19A, ERVK/family) and was previously shown to be deposited in oocytes (37). Transcription initiation within this LTR produces two alternatively spliced transcripts of Th, Th-α2 and Th-α3, each generating in-frame translational products with alternative N-terminal sequences (Fig. 5A). We refer to these alternative transcripts collectively as Th-α. Analysis of Th and Th-α in mouse embryos and placentas revealed reciprocal expression of these alternative transcripts in these two tissues. Th, the main form initiating at exon 1, was expressed exclusively in the embryo at E13.5, and the Th-α variants were expressed exclusively in the placenta (Fig. 5B). This placenta-specific expression is developmentally regulated, with levels increasing gradually between E8.5 and E14.5, before declining (data not shown). We found that the RMER19A LTR is conserved in the rat genome and that placenta-specific expression of the Th-α isoforms is also observed in that species (Fig. 5B).

Fig. 5.

Fig. 5.

Imprinting and IC2 regulation of alternative Th transcripts in mouse placenta. (A) Partial genomic structure of the Th gene showing the alternative exon α, located ∼30 kb upstream of exon 1 and embedded within a solitary LTR (in gray) of a RMER19A endogenous retrotransposon. Three RNA products are shown: the main form initiating at exon 1 (Th) and two alternative transcripts beginning at exon α and splicing to exon 2 or exon 3 of Th (Th-α2 and Th-α3). (B) Comparative analysis of Th and Th-α expression in mouse and rat embryo (E) and placenta (P) at embryonic day 13.5. c−, negative control. (C) RT-PCR analysis of Th expression in E13.5 placentas, using Gapdh as loading control. This PCR (Th*, with oligonucleotides Th12F and Th13R) detects all Th isoforms but is more robust than the LTR-primed Th-α reaction; only the Th-α isoforms are expressed in the placenta, as shown in panel B. (D) Allele-specific analysis of Th imprinting in wild type (+/+) and paternal IC2-knockout (+/IC2KO) placenta by sequencing of a T/C polymorphism between the C57BL/6 and BALB/c strains. (E) Sodium bisulfite sequencing analysis of DNA methylation at the LTR driving Th-α expression in E13.5 placentas and embryos recovered from reciprocal crosses between CD-1 and CAST7 mice. Parental origin of the strands sequenced (Mat, maternal; Pat, paternal) was determined using an SNP identified in the amplified region.

To assess the allele-specific expression of the Th splice variants during development, we recovered conceptuses at E13.5 from reciprocal crosses between the wild type and hemizygotes for the Del7AI allele. Expression of the embryo-specific form of Th was detected in both maternal and paternal Del7AI hemizygotes, establishing that the main isoform of Th is not imprinted (data not shown). However, for the placenta-specific Th-α isoforms, we found that expression was lost in the placenta upon maternal transmission of Del7AI, indicating maternal-specific expression of these transcripts (Fig. 5C). Additionally, paternal transmission of the IC2KO allele (original KvDMR1 deletion) resulted in increased paternal Th-α expression in Del7AI/IC2KO compound heterozygotes, as has been observed for other IC2-regulated genes (14). The results from this experiment using Del7AI were confirmed by analysis of an expressed SNP between the C57BL/6J and BALB/c strains, located in the 3′ UTR of Th, in exon 13. Analysis of E13.5 placental RNA from (BALB/c × C57BL/6J)F1 conceptuses showed no paternal C57BL/6J allele expression in wild-type placentas but expression between 30 and 35% of maternal levels in placentas carrying the IC2KO on the paternal allele (Fig. 5D). Finally, we examined CpGs in the LTR promoter driving Th-α to determine whether imprinted maternal allele-specific expression correlated with promoter DNA methylation levels. No difference was observed in DNA methylation levels at the RMER19A LTR between parental alleles in either embryo or placenta at E13.5 (Fig. 5E). A previous analysis of the effects of the IC2KO on imprinted expression on distal Chr 7 showed that, whereas most imprinted genes analyzed (Tssc3, Slc22a1l, Cdkn1c, and Ascl2) were fully derepressed from the paternal allele in +/IC2KO mutants, others (such as Kcnq1) were expressed at only ∼50% of the maternal allele levels from the mutant paternal allele (14). Our results on the Th-α isoforms suggest that the Th-α promoter is also only partially derepressed in the absence of IC2.

IC2-regulated maternal allele-specific expression of the Ins2 variant Ins2-006.

An alternative promoter and first exon located nearly 20 kb upstream of the main promoter of the insulin II gene Ins2 give rise to the alternative transcript Ins2-006 (ENSMUST00000105934) (Fig. 6A). This transcript was detected at low levels in total RNA isolated from E13.5 embryonic head of wild-type embryos and those carrying the Del7AI allele paternally but not in RNA from maternal hemizygous Del7AI embryos (Fig. 6B). When RNA from a Del7AI/IC2KO compound heterozygous embryo was analyzed, normal levels of Ins2-006 expression were observed despite the lack of a maternal allele (Fig. 6B). These results indicate that the alternative transcript of Ins2, the Ins2-006 variant, is expressed from the maternal allele in the embryo and that the silent paternal allele is reactivated in the absence of transcription of Kcnq1ot1.

Fig. 6.

Fig. 6.

Analysis of imprinted expression of Gm6471 and Ins2-006 in E13.5 embryonic head. (A) Structure of the Ins2 gene showing the alternative exon α, located ∼20 kb upstream of exon 1. Two products are shown: Ins2-001, the main Ins2 transcript, and Ins2-006, the alternative transcript beginning at the exon α and splicing unto exon 2. (B) RT-PCR analysis of Ins2-006 in the wild type, reciprocal Del7AI hemizygotes, and Del7AI/IC2KO compound heterozygotes, with Ppia as a loading control. (C) Structure of the Gm6471 gene showing four exons and the single mRNA transcript produced. (D) qRT-PCR analysis relative to Ppia levels of reciprocal Del7AI hemizygous samples compared to a wild-type control. One sample of each genotype was analyzed. Bars show the standard deviations from technical triplicates.

The Gm6471-201 transcript contains four exons and is relatively uncharacterized, and its putative protein coding sequence contains no known conserved domains (Fig. 6C). Expression of Gm6471 has been detected in postnatal cerebellum (RIKEN clone A730017L16). qRT-PCR analysis of Gm6471 in wild-type and reciprocal Del7AI E13.5 embryonic head did not show a pattern typical of an imprinted gene. The levels of Gm6471 from the paternal and maternal alleles were similar, approximately 25 to 30% of wild-type levels, suggesting that at least in embryonic brain, Gm6471 escapes imprinting (Fig. 6D).

DISCUSSION

The data presented in this study show that silencing signals from the imprinting center KvDMR1 on distal Chr 7 can spread proximally at least 300 kb further than was previously known and regulate imprinted expression of alternative transcripts of Th and Ins2 as well as the Tel7KI allele. All three of these transcripts are silenced on the paternal allele, likely through the action of the large ncRNA Kcnq1ot1 produced in cis and recruiting silencing complexes which spread along the chromosome (27, 36, 47, 49). This bidirectional spread of silencing, perhaps involving localization of Kcnq1ot1 to the chromosome itself (40), results in paternal allele inactivation and DNA methylation acquisition on the paternal allele of Tel7KI in the postimplantation period in the embryo (19).

A possible mechanism by which Tel7KI could acquire differential imprinted expression in embryo and placenta under the regulation of IC2 involves recent data on subnuclear localization of the paternal Chr 7 chromosome. In this study, Kncq1ot1 expressed from the paternal allele was found to localize to a silent chromatin domain (40). This domain is larger in the placenta than in the embryo, consistent with more of the IC2 domain being silenced in the placenta (40). A comparison of the relative positions of Ascl2 and Igf2 showed that, in the embryo, these genes are located at approximately the same distance from the edge of the silent domain while in the placenta, Ascl2 is located significantly closer to the edge (40). This reflects the fact that Ascl2 is silenced on the paternal allele in the placenta and not expressed in the embryo. The implications of this localization for genes in the Ascl2-Ins2 interval are important: in the embryo, these genes are located closer to the silent domain of Kcnq1ot1 than in the placenta. This is another possible explanation for the lack of imprinting of Tel7KI in the placenta: the paternal allele is located too far away to be affected by the silencing signal from IC2.

We presented three lines of evidence suggesting that IC2-mediated silencing can spread proximally to the Ins2 locus: (i) loss of maternal imprints and aberrant expression of Kcnq1ot1 from the maternal allele cause cis silencing of Tel7KI in vivo; (ii) deletion of IC2 disrupts the differentiation-coupled silencing of a paternal Tel7KI allele in ES cells; (iii) the endogenous splice variants Th-α and Ins2-α are maternally expressed, and silencing of their paternal allele is also IC2 dependent. One remaining issue is the possible additional role of IC1 in regulating imprinted expression at Tel7KI. The fact that loss of maternal DNA methylation can silence a maternally inherited Tel7KI suggests that the IC2-dependent pathway is sufficient to silence Tel7KI. Furthermore, the loss of silencing at Tel7KI when IC2 is deleted in cis on the paternal chromosome suggests that the IC2-dependent pathway is necessary to silence Tel7KI and that, on its own, the IC1-dependent pathway is not sufficient for Tel7KI silencing. These results therefore do not eliminate the possibility that IC1 is also necessary for silencing of Tel7KI from the paternal allele although the observation that aberrant maternal Kcnq1ot1 is sufficient to silence a maternal Tel7KI would argue against such a role for IC1.

Our results also help to reconcile previously conflicting data on the imprinting of Th during development. Targeted alleles at Th were shown to behave as recessive mutations, with no reported phenotypes in the heterozygotes but a late-embryonic to perinatal lethality observed in homozygotes (20, 54). Whereas these results suggest that Th is not imprinted during development, a chromosome-wide screen for novel imprinted genes in uniparental embryos showed that Th is preferentially expressed from the maternal allele in the placenta but is biallelic in the embryo at E13.5 (41). Our work shows that the tissue-specific imprinting of Th is regulated by alternative promoter usage, as previously described for a number of imprinted genes in mouse and human. That the imprinted placenta-specific Th-α isoforms are promoted from an LTR conserved in rodents is also significant in light of recent work identifying different retrovirus-like elements and retrotransposed genes as imprinted transcripts (7, 8, 31, 34, 42, 51). The Th-α transcripts were previously recovered in cDNA libraries from fully grown oocytes (37). More than 75 chimeric transcripts initiating within a transposable element and splicing onto downstream exons of known genes were shown to be maternally deposited in oocytes, some of which persist to the blastocyst stage (37). Although the presence of such maternal mRNA could confound imprinting studies, our demonstration that Th-α levels increase dramatically from E8.5 to E14.5 and that expression is not detected in hemizygous Del7AI embryos recovered from +/Del7AI females eliminates the possibility that the imprinted expression documented here represents the maternally deposited form or contamination of placental RNA preparations by decidual material. Whether expression of Th-α during oogenesis is mechanistically linked to the postimplantation imprinted expression remains to be addressed.

Our finding that Ins2 has an alternative maternally expressed form suggests that allele-specific expression at this locus is complex. The Ins2-006 isoform is represented by a single expressed sequence tag ([EST] GenBank AW489963.1) identified in postnatal cerebellum. Our analysis also suggests that this variant is expressed at low levels during brain development. Whether this actually reflects low levels of transcription or localized tissue-specific expression remains to be determined. No CpG islands were found near Ins2-α, implying that it may be regulated in a manner similar to Phlda2, which is imprinted in the embryo but does not acquire differential DNA methylation (27, 39). Previous work on Ins2 has shown that, while it is biallelically expressed in the embryo and neonatal pancreas, it is expressed solely from the paternal allele in the yolk sac at E14.5 (12, 15). Together with our results, this suggests that both paternally and maternally expressed forms of Ins2 are produced via alternative promoter usage. Similar examples of reciprocal imprinting have been described at other imprinted genes in mouse and human, for instance, at Grb10 (18) and Gnas (38); however, imprinted paternal expression of Ins2 in the yolk sac was reported to be regulated by IC1 (24). Our results therefore suggest that transcription at Ins2 is simultaneously regulated by IC1 and IC2, providing the first example of a transcriptional unit under the epigenetic control of two different imprinting centers.

Recently, an ES cell differentiation assay similar to the one described here was used to examine the acquisition of monoallelic expression at the imprinted Igf2r gene. In this study, Igf2r and the ncRNA Airn were expressed at low levels from both chromosomes in undifferentiated ES cells (21). Upon differentiation, the Airn ncRNA was upregulated specifically on the paternal allele, and Igf2r was upregulated specifically on the maternal allele (21). It seems unlikely that Tel7KI is regulated in a similar way since Kcnq1ot1 is imprinted in undifferentiated ES cells (47), and although both paternal and maternal alleles of Tel7KI are expressed in ES cells, our results are consistent with silencing of the paternal allele, not upregulation of the maternal allele. This suggests that different imprinted domains regulated by ncRNAs have different mechanisms to establish allele-specific expression during development. Interestingly, a recent study analyzed Cdkn1c allelic expression and DNA methylation in differentiated ES cells. The authors found that Cdkn1c, which is also regulated by IC2, is monoallelically expressed upon differentiation but does not acquire differential DNA methylation in these in vitro differentiated cells (52).

This study has interesting implications for the evolution of imprinting clusters. For clusters regulated by bidirectional silencing mediated by an ncRNA, we have shown that rearrangements introducing a new transcriptional unit are capable of becoming imprinted similarly to previously linked imprinted genes. This phenomenon has been previously hypothesized with the rodent-specific transposition of the Peg10 gene into the imprinted cluster on mouse proximal chromosome 6 (45). The finding that the Tel7KI transgenic line is regulated by IC2 opens new avenues for the study of dynamics of imprint erasure and acquisition in this domain. The distance between KvDMR1 and Tel7KI could allow for the discovery of novel factors involved in long-range silencing. In vivo, mutagenesis screens using a male carrying Tel7KI can be analyzed for offspring which show reactivation of the normally silent GFP, potentially identifying dominant mutations affecting the spreading of silencing mediated by ncRNAs. In vitro, the ES cell differentiation assay developed here can be expanded for use with small interfering RNA (siRNA) knockdowns of likely modifiers of silencing by the ncRNA Kcnq1ot1. Since the main readout for silencing of Tel7KI is GFP expression, this transgenic line should provide a valuable tool to study the timing and propagation of silencing by KvDMR1 during development.

ACKNOWLEDGMENTS

We thank T. Bestor and J. Trassler for the Dnmt3l knockout mice and genotyping information, M. Higgins for the KvDMR1 genomic clone for the IC2 knockout targeting vector and for the KvDMR1 KO mice, and A. Nagy for the Oct4-EGFP ES cell line.

This work was funded by grants from the Canadian Institutes of Health Research (CIHR) to L.L. (MOP-82863 and RMF-92093). L.L. holds a Canada Research Chair, and M.J.J. was supported by a scholarship from the Michael Smith Foundation for Health Research.

Footnotes

▿

Published ahead of print on 16 May 2011.

REFERENCES

  • 1. Arima T., et al. 2006. Loss of the maternal imprint in Dnmt3Lmat−/− mice leads to a differentiation defect in the extraembryonic tissue. Dev. Biol. 297:361–373 [DOI] [PubMed] [Google Scholar]
  • 2. Bartolomei M., Webber A., Brunkow M., Tilghman S. 1993. Epigenetic mechanisms underlying the imprinting of the mouse H19 gene. Genes Dev. 7:1663–1673 [DOI] [PubMed] [Google Scholar]
  • 3. Bartolomei M., Zemel S., Tilghman S. 1991. Parental imprinting of the mouse H19 gene. Nature 351:153–155 [DOI] [PubMed] [Google Scholar]
  • 4. Bell A. C., Felsenfeld G. 2000. Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature 405:482–485 [DOI] [PubMed] [Google Scholar]
  • 5. Bhogal B., Arnaudo A., Dymkowski A., Best A., Davis T. L. 2004. Methylation at mouse Cdkn1c is acquired during postimplantation development and functions to maintain imprinted expression. Genomics 84:961–970 [DOI] [PubMed] [Google Scholar]
  • 6. Bourc'his D., Xu G. L., Lin C. S., Bollman B., Bestor T. H. 2001. Dnmt3L and the establishment of maternal genomic imprints. Science 294:2536–2539 [DOI] [PubMed] [Google Scholar]
  • 7. Chai J. H., Locke D. P., Ohta T., Greally J. M., Nicholls R. D. 2001. Retrotransposed genes such as Frat3 in the mouse Chromosome 7C Prader-Willi syndrome region acquire the imprinted status of their insertion site. Mamm. Genome 12:813–821 [DOI] [PubMed] [Google Scholar]
  • 8. Choi J. D., et al. 2005. A novel variant of Inpp5f is imprinted in brain, and its expression is correlated with differential methylation of an internal CpG island. Mol. Cell. Biol. 25:5514–5522 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Constância M., et al. 2000. Deletion of a silencer element in Igf2 results in loss of imprinting independent of H19. Nat. Genet. 26:203–206 [DOI] [PubMed] [Google Scholar]
  • 10. Davis T. L., Trasler J. M., Moss S. B., Yang G. J., Bartolomei M. S. 1999. Acquisition of the H19 methylation imprint occurs differentially on the parental alleles during spermatogenesis. Genomics 58:18–28 [DOI] [PubMed] [Google Scholar]
  • 11. Davis T. L., Tremblay K. D., Bartolomei M. 1998. Imprinted expression and methylation of the mouse H19 gene are conserved in extraembryonic lineages. Dev. Genet. 23:111–118 [DOI] [PubMed] [Google Scholar]
  • 12. Deltour L., Montagutelli X., Guenet J. L., Jami J., Páldi A. 1995. Tissue- and developmental stage-specific imprinting of the mouse proinsulin gene, Ins2. Dev. Biol. 168:686–688 [DOI] [PubMed] [Google Scholar]
  • 13. Ewing B., Green P. 1998. Base-calling of automated sequencer traces using PHRED. II. Error probabilities. Genome Res. 8:186–194 [PubMed] [Google Scholar]
  • 14. Fitzpatrick G., Soloway P., Higgins M. 2002. Regional loss of imprinting and growth deficiency in mice with a targeted deletion of KvDMR1. Nat. Genet. 32:426–431 [DOI] [PubMed] [Google Scholar]
  • 15. Giddings S. J., King C. D., Harman K. W., Flood J. F., Carnaghi L. R. 1994. Allele specific inactivation of insulin 1 and 2, in the mouse yolk sac, indicates imprinting. Nat. Genet. 6:310–313 [DOI] [PubMed] [Google Scholar]
  • 16. Gregg C., et al. 2010. High-resolution analysis of parent-of-origin allelic expression in the mouse brain. Science 329:643–648 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Hark A. T., et al. 2000. CTCF mediates methylation-sensitive enhancer-blocking activity at the H19/Igf2 locus. Nature 405:486–489 [DOI] [PubMed] [Google Scholar]
  • 18. Hikichi T., Kohda T., Kaneko-Ishino T., Ishino F. 2003. Imprinting regulation of the murine Meg1/Grb10 and human GRB10 genes; roles of brain-specific promoters and mouse-specific CTCF-binding sites. Nucleic Acids Res. 31:1398–1406 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Jones M. J., Lefebvre L. 2009. An imprinted GFP insertion reveals long-range epigenetic regulation in embryonic lineages. Dev. Biol. 336:42–52 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Kobayashi K., et al. 1995. Targeted disruption of the tyrosine hydroxylase locus results in severe catecholamine depletion and perinatal lethality in mice. J. Biol. Chem. 270:27235–27243 [DOI] [PubMed] [Google Scholar]
  • 21. Latos P. A., et al. 2009. An in vitro ES cell imprinting model shows that imprinted expression of the Igf2r gene arises from an allele-specific expression bias. Development 136:437–448 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Lefebvre L., et al. 2009. The interval between Ins2 and Ascl2 is dispensable for imprinting centre function in the murine Beckwith-Wiedemann region. Hum. Mol. Genet. 18:4255–4267 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Lefebvre L., Viville S., Barton S. C., Ishino F., Surani M. A. 1997. Genomic structure and parent-of-origin-specific methylation of Peg1. Hum. Mol. Genet. 6:1907–1915 [DOI] [PubMed] [Google Scholar]
  • 24. Leighton P. A., Ingram R. S., Eggenschwiler J., Efstratiadis A., Tilghman S. 1995. Disruption of imprinting caused by deletion of the H19 gene region in mice. Nature 375:34–39 [DOI] [PubMed] [Google Scholar]
  • 25. Leighton P. A., Saam J. R., Ingram R. S., Stewart C., Tilghman S. 1995. An enhancer deletion affects both H19 and Igf2 expression. Genes Dev. 9:2079–2089 [DOI] [PubMed] [Google Scholar]
  • 26. Lewis A., et al. 2006. Epigenetic dynamics of the Kcnq1 imprinted domain in the early embryo. Development 133:4203–4210 [DOI] [PubMed] [Google Scholar]
  • 27. Lewis A., et al. 2004. Imprinting on distal chromosome 7 in the placenta involves repressive histone methylation independent of DNA methylation. Nat. Genet. 36:1291–1295 [DOI] [PubMed] [Google Scholar]
  • 28. Lopes S., et al. 2003. Epigenetic modifications in an imprinting cluster are controlled by a hierarchy of DMRs suggesting long-range chromatin interactions. Hum. Mol. Genet. 12:295–305 [DOI] [PubMed] [Google Scholar]
  • 29. Mamo S., Gal A. B., Bodo S., Dinnyes A. 2007. Quantitative evaluation and selection of reference genes in mouse oocytes and embryos cultured in vivo and in vitro. BMC Dev. Biol. 7:14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Mancini-Dinardo D., Steele S. J., Levorse J., Ingram R. S., Tilghman S. 2006. Elongation of the Kcnq1ot1 transcript is required for genomic imprinting of neighboring genes. Genes Dev. 20:1268–1282 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Nabetani A., Hatada I., Morisaki H., Oshimura M., Mukai T. 1997. Mouse U2af1-rs1 is a neomorphic imprinted gene. Mol. Cell. Biol. 17:789–798 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Nagy A., Gertsenstein M., Vintersten K., Behringer R. 2003. Manipulating the mouse embryo: a laboratory manual, 3rd ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]
  • 33. Oh R., et al. 2008. Epigenetic and phenotypic consequences of a truncation disrupting the imprinted domain on distal mouse chromosome 7. Mol. Cell. Biol. 28:1092–1103 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Ono R., et al. 2006. Deletion of Peg10, an imprinted gene acquired from a retrotransposon, causes early embryonic lethality. Nat. Genet. 38:101–106 [DOI] [PubMed] [Google Scholar]
  • 35. Ooi S. K., et al. 2010. Dynamic instability of genomic methylation patterns in pluripotent stem cells. Epigenetics Chromatin 3:17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Pandey R., et al. 2008. Kcnq1ot1 antisense noncoding RNA mediates lineage-specific transcriptional silencing through chromatin-level regulation. Mol. Cell 32:232–246 [DOI] [PubMed] [Google Scholar]
  • 37. Peaston A., et al. 2004. Retrotransposons regulate host genes in mouse oocytes and preimplantation embryos. Dev. Cell 7:597–606 [DOI] [PubMed] [Google Scholar]
  • 38. Peters J., et al. 1999. A cluster of oppositely imprinted transcripts at the Gnas locus in the distal imprinting region of mouse chromosome 2. Proc. Natl. Acad. Sci. U. S. A. 96:3830–3835 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Qian N., et al. 1997. The IPL gene on chromosome 11p15.5 is imprinted in humans and mice and is similar to TDAG51, implicated in Fas expression and apoptosis. Hum. Mol. Genet. 6:2021–2029 [DOI] [PubMed] [Google Scholar]
  • 40. Redrup L., et al. 2009. The long noncoding RNA Kcnq1ot1 organises a lineage-specific nuclear domain for epigenetic gene silencing. Development 136:525–530 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Schulz R., et al. 2006. Chromosome-wide identification of novel imprinted genes using microarrays and uniparental disomies. Nucleic Acids Res. 34:e88. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Sekita Y., et al. 2008. Role of retrotransposon-derived imprinted gene, Rtl1, in the feto-maternal interface of mouse placenta. Nat. Genet. 40:243–248 [DOI] [PubMed] [Google Scholar]
  • 43. Shin J. Y., Fitzpatrick G. V., Higgins M. J. 2008. Two distinct mechanisms of silencing by the KvDMR1 imprinting control region. EMBO J. 27:168–178 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Shirohzu H., et al. 2004. A 210-kb segment of tandem repeats and retroelements located between imprinted subdomains of mouse distal chromosome 7. DNA Res. 11:325–334 [DOI] [PubMed] [Google Scholar]
  • 45. Suzuki S., et al. 2007. Retrotransposon silencing by DNA methylation can drive mammalian genomic imprinting. PLoS Genet. 3:e55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Thorvaldsen J. L., Duran K. L., Bartolomei M. S. 1998. Deletion of the H19 differentially methylated domain results in loss of imprinted expression of H19 and Igf2. Genes Dev. 12:3693–3702 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Umlauf D., et al. 2004. Imprinting along the Kcnq1 domain on mouse chromosome 7 involves repressive histone methylation and recruitment of Polycomb group complexes. Nat. Genet. 36:1296–1300 [DOI] [PubMed] [Google Scholar]
  • 48. Viswanathan S., et al. 2003. Supplementation-dependent differences in the rates of embryonic stem cell self-renewal, differentiation, and apoptosis. Biotechnol. Bioeng. 84:505–517 [DOI] [PubMed] [Google Scholar]
  • 49. Wagschal A., et al. 2008. G9a histone methyltransferase contributes to imprinting in the mouse placenta. Mol. Cell. Biol. 28:1104–1113 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Williamson C., et al. 2011. Mouse imprinting data and references. MRC Harwell, Oxfordshire, United Kingdom: http://www.har.mrc.ac.uk/research/genomic_imprinting/ [Google Scholar]
  • 51. Wood A., et al. 2007. A screen for retrotransposed imprinted genes reveals an association between X chromosome homology and maternal germ-line methylation. PLoS Genet. 3:e20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Wood M., et al. 2010. Autonomous silencing of the imprinted Cdkn1c gene in stem cells. Epigenetics 5:214–221 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Xiong Z., Laird P. W. 1997. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 25:2532–2534 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Zhou Q. Y., Quaife C. J., Palmiter R. D. 1995. Targeted disruption of the tyrosine hydroxylase gene reveals that catecholamines are required for mouse fetal development. Nature 374:640–643 [DOI] [PubMed] [Google Scholar]
  • 55. Zvetkova I., et al. 2005. Global hypomethylation of the genome in XX embryonic stem cells. Nat. Genet. 37:1274–1279 [DOI] [PubMed] [Google Scholar]

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES