Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Aug 1.
Published in final edited form as: Reproduction. 2011 Apr 28;142(2):353–368. doi: 10.1530/REP-11-0060

Evidence for a Conserved Function of Heart- and Neural Crest Derivatives-Expressed Transcript 2 (Hand2) in Mouse and Human Decidualization

DV Huyen 1, BM Bany 1,2,3
PMCID: PMC3141103  NIHMSID: NIHMS293706  PMID: 21527398

Abstract

Previously we showed that Hand2 mRNA levels dramatically increase in mouse uterine endometrial stromal cells as they undergo decidualization in vivo. However, very little is still known about the expression and function of this transcription factor in the mouse or human uterusdecidualization. Therefore, the current study was undertaken to provide a more detailed assessment of Hand2gene expression and function in the mouse uterus during the periimplantation period and also in mouse plus human endometrial stromal cells during decidualization in vitro. The results show that Hand2 mRNA and protein levels increase in the mouse uterus during decidualization and this does not depend on the presence of a conceptus. Interestingly Hand2 mRNA and protein are present in endometrial stromal cells adjacent to the luminal epithelium in the uterus prior to the onset of implantation. We find that progesterone is likely a regulator of Hand2expression during uterine sensitization of the mouse uterus. Finally, Hand2 expression increases in mouse and human fibroblast cells as they undergo decidualization in vitro. This expression is significantly increased in response to prostaglandin E2. Notably, reduction of Hand2 expression in these cells using shRNA or siRNA approaches, results in the reduced extent of decidualization as shown by the reduced expression ofa subset of decidualization markers. The results of this study support the hypothesis that Hand2 expression not only plays an important role decidualization but may also play a role in obtaining proper progesterone-dependent uterine sensitization required for implantation to begin.

INTRODUCTION

Implantation begins with the attachment of the embryo to the uterine wall and ends in the formation of the definitive placenta. In mice and humans this process involves the differentiation of the endometrial tissue into decidual tissue, a process commonly referred to as decidualization (Abrahamsohn & Zorn 1993, Dunn et al. 2003, Salamonsen et al. 2003). In humans, decidualization begins in the late proliferative phase of the menstrual cycle and it continues only if menstruation is prevented due to pregnancy. In mice and other rodents, decidualization does not begin each estrous cyclebut rather begins in response to an implantation stimulus. This stimulus can be the presence of a blastocyst or can be artificial such as the injection of sesame oil or blastocyst-sized beads (artificially-induced tissue is called the deciduoma to discern it from pregnance-induced decidua). Common features of decidualization in mouse and human endometria include progesterone dependence and the requirement for proper hormonal preparation (Ramathal et al. 2010). Hormonal preparation occurs in a transient window in time and is called uterine sensitization or receptivity.

Besides the progesterone receptor (PGR), several other transcription factors play a key role in uterine receptivity and decidualization. These include, but are not limited to,forkhead box O1 (FOXO1A) (Buzzio et al. 2006, Grinius et al. 2006),homeobox A10 (HOXA10) (Lu et al. 2008, Vitiello et al. 2008) andE26 avian leukemia oncogene 1, 5' domain (ETS1) (Kessler et al. 2006). Some of these, such as FOXO1A have been shown to play a critical role in uterine sensitization and decidualization in humans but not that of mice. On the other hand, some are believed to play a role in both human and mouse endometrial sensitization and decidualization (HOXA10, PGR). Finally, in a very recent publication, another transcription factor called heart- and neural crest derivatives-expressed transcript 2 (Hand2)was shown to play a key role in uterine receptivity in mice (Li et al. 2011). Previously we showed that this gene is expressed in mouse uterine endometrial stromal cells as they undergo decidualization (Bany & Cross 2006). However, currently very little detail is known about the expression and function of this transcription factor in the mouse uterus during decidualization. In addition, to the best of our knowledge, nothing has been published regarding Hand2 expression and its role in human endometrial stromal cells during decidualization. Therefore, the current study was undertaken to provide a detailed assessment of Hand2 expression and function in the mouse uterus during the peri-implantation period and in mouse plus human endometrial stromal cells during decidualization in vitro. The results suggest Hand2expression plays a role in decidualization of both mouse and human endometrial stromal cells. Further, the results alsosupport the hypothesis that Hand2 expression might play a role in the hormonal sensitization of the pre-implantation uterus so that it is receptive to an implantation stimulus.

RESULTS

Hand2Expression Dramatically Increases in the Mouse Uterus During Implantation

Steady-state Hand2 mRNA levels were measured in the mouse uterus prior to the onset of implantation (day 3.5),and in implantation site (IS) and non-implantation site (NIS) tissues of uteri after the onset of implantation (Days 4.5–8.5) (Fig. 1A). On day 3.5, prior to the onset of implantation and decidualization, Hand2 mRNA was detected in the uterine tissue. Although mRNA levels did slightly change in NIS tissues after the onset of implantation, significant increases were seen in the IS tissue compared to NIS tissue on Days 4.5 (P<0.01), 5.5 (P<0.005), 6.5 (P<0.05), 7.5 (P<0.001) and 8.5 (P<0.001). This increased expression of Hand2 in implantation site tissue was accompanied by increases in other markers of decidualization including FK506 binding protein 3 (Fkbp3) (Fig. 1B), gap junction protein alpha 1 (Gja1) (Fig. 1C) and Runt-related transcription factor 1 (Runx1) (Fig. 1D). We utilized bead-induced deciduoma (BID)in pseudopregnant mice as a model (Herington et al. 2009)to determine if the increased Hand2 mRNA levels in the IS tissues on Days 4.5–8.5 requires the presence of a conceptus. No significant difference (P>0.05) was detected inHand2 (Fig. 2E) or Gja1 (Fig. 2F) mRNA levels between the BID and IS tissues on each day examined

Figure 1.

Figure 1

Open in a new tab

Changes in uterine mRNA levels in the mouse uterus during decidualization. (A) Hand2, (B) Fkbp3, (C) Gja1, and (D) Runx1 mRNA levels in Days 3.5 to 8.5 of pregnant uteri non-implantation (NIS) and implantation segment (IS) tissue. (E) Hand2 and (F) Gja1 mRNA levels in in bead-induced deciduoma segment (BID) and IS tissues of pseudopregnant and pregnant uteri. Bars represent the mean ± SEM (N=3–4). *P<0.05, **P<0.01, ***P<0.005 and ****P<0.001.

Figure 2.

Figure 2

Open in a new tab

Localization of Hand2 mRNA in the uteri of Day 3.5, 4.5 and 5.5 pregnant mice using in situ hybridization. (A) Section from Day 3.5 pre-implantation uterus. Sections from (B) Day 4.5 and (C) Day 5.5 non-implantation segments (NIS). Sections from (D-F) Day 4.5 and (G-I) Day 5.5 implantation segments (IS). All sections are oriented with mesometrium (m) downward and numbers above scale bars are in microns. Abbreviations: am, antimesometrial region; c, conceptus; endo, endometrium; ge, glandular epithelium; le, luminal epithelium; mm, mesometrial region; myo, myometrium. These results are representative of at least 3 independent samples. Global linear adjustments of the brightness and color level were made on the photomicrographs to more accurately represent what was seen on the slides under the microscope.

Hand2 mRNA was localized in the mouse uterus on Days 3.5–8.5 of pregnancy using insitu hybridization and a color development time of 18 h.Although mRNA could be detected using qRT-PCR in the NIS tissues of Days3.5–8.5 pregnant uteri, levels were too low tobe detectedbyin situ hybridization. Representative photomicrographsare shown for NIS tissue from Day 3.5, 4.5 and 5.5pregnant uteri (Fig. 2A-C). In IS tissue of Day 4.5 uteri, very strong hybridization signals for Hand2 mRNA areseen in the subepithelial endometrial stromal cells making up the wall of the antimesometrial implantation “crypt” that surrounds the implanting blastocyst (Fig. 2D). This layer of Hand2 mRNA localization was found to be approximately 6–7 cell layers deep (Fig. 2E). Lighter hybridization signals are seen in some stromal cells deeper into the antimesometrial stroma (Fig. 2E) and also within a small population of endometrial stromal cells in near the luminal epithelium in the mesometrial region (Fig. 2F). A similar area of strong hybridization signals for Hand2 mRNA that surrounds the conceptus (c) in the antimesometrial region is also seen in the endometrial stroma of Day 5.5 IS tissue (Fig. 2G). However, this area of intense signalis significantly larger compared to that of Day 4.5. A well-formed primary decidual zone (PDZ) is generated at Day 5.5. A strong signal in the antimesometrial decidua is up to 20 cell layers into the endometrium from the conceptus (Fig 2H), which is larger than the fully formed PDZ. Also notable is that the conceptus is now in direct contact with the endometrial stroma in the antimesometrial region,as the luminal epithelium in this regionhas now disappeared. On the other hand, the luminal epithelium is still intact in the mesometrial region of the endometrium and strong hybridization signals for Hand2 mRNAare seen in the subepithelial stroma cell (Fig. 2I). The cells that appear to have strong hybridization signals on Day 5.5 appear to be decidual cells, especially those in the PDZ which is well formed at this time point.Cells showing moderate to low hybridization signals seen deeper into the endometrium have smaller nuclei, and are presumably cells beginning the process of decidualization as slowly it spreads throughout most of the endometrium. On days 6.5–8.5, the conceptus noticeably enlarges and the ectoplacental cone seen on days 6.5 (Fig 3A) and 7.5 (Fig. 3E) then flattens by Day 8.5 (Fig. 3I). Hybridization signals for Hand2 mRNA appear pretty well throughout the endometrium on these days, including signals in the polyploid decidual cells of the antimesometrial decidua (Fig. 3B,F,J) and the mesometrial decidua (Fig.3C,G, K). Notably, hybridization signals are not seen in endometrial stromal cellslocated adjacent to the circular muscle layer of the myometrium that do not undergo decidualization (Fig.3D,H,L). At no time were hybridization signals seen in trophoblast cells of the conceptus (Fig.3F) or any other endometrial cells except those which were undergoing or had completed the process of decidualization.

Figure 3.

Figure 3

Open in a new tab

Localization of Hand2 mRNA in the uteri of Day 6.5, 7.5 and 8.5 pregnant mice using in situ hybridization. Sections from (A-D) Day 6.5, (E-G) Day 7.5 and (H-J) Day 8.5 implantation segments (IS). All sections are oriented with mesometrium (m) downward and numbers above scale bars are in microns. Abbreviations: c, conceptus; cm, circular muscle of the myometrium; epc, ectoplacental cone; g, trophoblast giant cell; lm, longitudinal muscle of the myometrium; myo, myometrium. These results are representative of at least 3 independent samples. Global linear adjustments of the brightness and color level were made on the photomicrographs to more accurately represent what was seen on the slides under the microscope. Blue arrows in panels D, H and L denote the endometrial cell layer adjacent to the myometrium which does not undergo decidualization.

HAND2 protein was localized in the mouse uterus on Days 4.5–9.5 of pregnancy by immunohistochemistry. Sections from Day 3.5 pregnant uteri, just prior to the onset of implantation reveal strong HAND2 staining in a subpopulation of endometrial stromal cells near the luminal epithelium (Fig. 4A). The depth of this staining varies but is up to approximately 12 cells deep adjacent to the luminal epithelium in the antimesometrial (Fig. 4B) and lateral mesometrial (Fig. 4C) regions. At this stage, no staining is seen in the glandular epithelia (Fig. 4D). NIS tissue from Day 4.5 pregnant uteri show similar staining for HAND2 in the stroma beneath the luminal epithelium, exceptthat more cells stain positive (Fig. 4E). IS tissue from Day 4.5 pregnant uteri show very strong HAND2 staining in the developing primary decidual zone cells of the endometrial stroma adjacent to the implanting blastocyst (Fig. 4G,H). Unlike Day 3.5, glandular epithelial cells now stain positive in both the NIS (Fig.4F) and IS (Fig. 4I) tissues. Unlike the staining in the stromal cells which appears to be localized almost solely to the nuclei at all stages of implantation, HAND2 appears to be located in the cytoplasm of the glandular epithelial cells. HAND2 protein is detected in the endometrial stromal cells adjacent to the luminal epithelium in NIS tissue from Day 5.5 pregnant uteri (Fig. 4J,K). However, unlike that of Day 4.5 NIS tissues, staining is not seen in the glandular epithelia. HAND2 was localized to primary decidual zone cells as well as some developing secondary decidual zone cells in IS tissue from Day 5.5 pregnant uteri (Fig. 4L,M,N). No staining is seen adjacent to the extreme mesometrial region of this tissue (Fig. 4O).On Days 6.5 (Fig. 5A) and 7.5 (Fig. 5E), subepithelial stromal cells continue to stain for HAND2 in NIS tissue. In the IS tissue on these days almost all areas of the endometrial stroma stain for HAND2 (Fig 5B,F). In the antimesometrial (Fig. 5C,G) and mesometrial (Fig. 5D,H) decidua most of the staining appears to be localized to the nuclei of decidual cells. The outer edge of the endometrial tissues contains a thin layer of endometrial stromal cells and occasionally some glandular epithelia that do not show staining above background (Fig. 5I). By Day 8.5 (Fig. 5J), the staining in IS tissue remains quite similar in the antimesometrial (Fig.5K,L) and mesometrial (Fig. 5M) regions as the previous day. However, by Day 9.5 when decidualization is complete, the strongest staining for HAND2 appears to be near the myometrium, relatively closer to the conceptus (Fig. 5N).

Figure 4.

Figure 4

Open in a new tab

HAND2 protein localization in Day 3.5, 4.5 and 5.5 of pregnant mouse uteri using immunohistochemistry.(A-D) Sections from pre-implantation sites from Day 3.5 pregnant mouse uteri. Sections from non-implantation (NIS) segments (E,F) and implantation (IS) segments (G-I) from Day 4.5 pregnant mouse uteri. Sections from non-implantation (NIS) segments (J,K) and implantation (IS) segments (L-O) from Day 5.5 pregnant mouse uteri. All sections are oriented with mesometrium (m) downward and numbers above scale bars are in microns. Abbreviations: ge, glandular epithelium; b, blastocyst; le, luminal epithelium; pdz, primary decidual zone. These results are representative of at least 3 independent samples. Global linear adjustments of the brightness and color level were made on the photomicrographs to more accurately represent what was seen on the slides under the microscope.

Figure 5.

Figure 5

Open in a new tab

HAND2 protein localization in Day 6.5, 7.5 and 8.5 of pregnant mouse uteri using immunohistochemistry. Section from non-implantation (NIS) segments (A) and implantation (IS) segments (B-D) from Day 6.5 pregnant mouse uteri. Sections from non-implantation (NIS) segments (E) and implantation (IS) segments (F-I) from Day 7.5 pregnant mouse uteri. Sections from implantation (IS) segments (K-M) Day 8.5 and (N) Day 9.5 pregnant mouse uteri. All sections are oriented with mesometrium downward and numbers above scale bars are in microns. These results are representative of at least 3 independent samples. Global linear adjustments of the brightness and color level were made on the photomicrographs to more accurately represent what was seen on the slides under the microscope.

Hand2 Expression Increases in the Mouse Uterus During Uterine Sensitization

Since the results above show that Hand2expression can be seen in the mouse uterus on Day 3.5 of pregnancy, we wanted to determine if this expression is associated with uterine sensitization for decidualization. To study this we used an artificial model, taking ovariectomized mice and injecting them with estradiol and/or progesteroneat 9 a.m. for up to 9 days (Fig. 6A). This model is commonly used to obtain uteri that can respond fully to an artificial deciduogenic stimulus early on Day 8 of hormone treatment (Bany et al. 2000, Bany & Cross 2006). Using this model, we used qRT-PCR to assess the expression of select genes, including Hand2, in uteri obtained at 3 p.m. on Days 5–9 of treatment. Uterine leukemia inhibitory factor (Lif) gene expression is required to obtain proper uterine sensitization (Stewart et al. 1992) and its expression transiently increases in the pregnant uterus during a period of optimal sensitivity (Bhatt et al. 1991, Song et al. 2000). As shown in Fig.6B, Lif mRNA levels significantly (P<0.001) increase on Days 7 and 8 of hormone treatment,which corresponds to the period of optimal uterine sensitivity. In contrast, levels on Days 5 plus 6 (pre-receptive) and 9 (refractory period) remain low. These are days of the hormone regimen in Fig. 6A, where application of a physiological deciduogenic stimulus such as anintraluminal injection of sesame oil, does not result in a decidualization response (Bany, unpublished data). Interestingly, Hand2 mRNA levels show a quite different expression profile (Fig. 6C) compared to that of Lif. Although levels are low on Day 5, Hand2 mRNA levels significantly (P<0.05) increase to a similar levels in Day 6–9 uteri, starting just after the first injection of progesterone plus estrogen. Homeobox A10 (Hoxa10) expression in the mouse uterus is dependent on progesterone during the peri-implantation period and this expression is required for implantation. As shown in Fig.6D, the expression profile of Hoxa10 in the sensitization model was similar to that of Hand2. Although levels were low on Day 5, after the first injection of progesterone there was a significant (P<0.05) increase in Hoxa10 mRNA to a similar level on Days 6–9. Finally, Indian hedgehog (Ihh) expression is also a progesterone-induced gene in the uterus during the peri-implantation period (Matsumoto et al. 2002)and this expression is essential for implantation to begin (Lee et al. 2006). As shown in Fig. 6E, Ihh mRNA levels arelow on Day 5 but after the first injection of progesterone plus estrogen on Days 6 there isa significant (P<0.05) increase. On Days 7 and 8 Ihh mRNA levels arestill significantly greater compared to that of Day 5 but at a significantly (P<0.05) lower levels than Day 6. Finally, on Day 9 the levels of Ihh mRNA return back to the same levels as seen on Day 5.

Figure 6.

Figure 6

Open in a new tab

Gene expression in the uteri of ovariectomized mice during hormone-induced sensitization to a deciduogenic stimulus. (A) Timeline of hormone injections to ovariectomized mice during steroid induced uterine sensitization. Mice were injected subcutaneously with the indicated steroids in 0.1 ml sesame oil at 9 a.m. on the days of hormone treatment indicated. Tissues were collected on days indicated at 3 p.m. Relative Levels of (B) Lif, (C) Hand2, (D) Hoxa10, and (E) Ihh mRNAs as determined by qRT-PCR. Bars represent mean ± SEM (N=4) and those with different letters are significantly (P<0.05) different.

Next we localized HAND2 protein in the uteri of ovariectomized mice during hormone-induced sensitization on Days 5–9 of hormone injection. HAND2 is not detected in uterine sections from uteri collected on Day 5 of treatment (Fig.7A). On the other hand, HAND2 protein canbe detected in endometrial stromal cells adjacent to the luminal epithelium of sections from uteri collected on days 6 (Fig.7B,C), 7 (Fig.7D,E), 8 (Fig.7F,G) and 9 (Fig.7H,I). This representsthe period of time where the animals were injected with daily a combination of both estradiol and progesterone. Notably, the HAND2 protein appearsto be localized mainly to the nuclei of endometrial stromal fibroblast cells in these tissue sections. For sections from Day 7 uteri, additional staining just above background canbe seen in the glandular epithelial cells (Fig.7D,E). Control Day 7 (Fig.7J) as well as Day 6 plus 8–9 (Data not shown) sections stained with goat IgG in place of the goat-anti-HAND2 IgG showed no staining above background.

Figure 7.

Figure 7

Open in a new tab

HAND2 protein localization the uterus of ovariectomized mice during uterine sensitization and the role of progesterone. Sections are from uteri collected on (A) Day 5, (B-C) Day 6, (D-E) Day 7, (F-G) Day 8 and (H-I) Day 9 of uterine sensitization. (J) Control Day 7 section incubated with the same concentration of IgG in place of the anti-HAND2 IgG. (K) In some mice after the treatment of mice on Days 1–5 as outlined in Fig. 6A, mice received 3 daily treatments of either estrogen (E, 10 ng), progesterone (P, 1 mg) or a combination of estrogen plus progesterone (B). Hand2 mRNA levels were then determined by qRT-PCR. Localization of HAND2 protein in uterine sections of mice treated with (L) progesterone and (M) estrogen plus progesterone. Numbers above scale bars are in microns. Immunohistochemistry results are representative of at least 3 independent samples. Global linear adjustments of the brightness and color level were made on the photomicrographs to more accurately represent what was seen on the slides under the microscope. Bars in the graph represent the mean ± SEM (N=4) and those with different letters (a,b) are significantly different (P<0.05).

Since it appearsthat expression of Hand2significantly increases in the uteri of ovariectomized mice in response to estradiol plus progesterone on Days 6–9 of the sensitization protocol, we examined the individual and combined effects of these steroids on Hand2 mRNA levels. Ovariectomized mice received 3 days of estradiol and 2 days of no injections as in the sensitization protocol. However, on Days 6, 7 and 8 the mice received estradiol alone, progesterone alone or estradiol plus progesterone. As shown in Fig.7K, Hand2 mRNA levels in the uteri of mice treated with estradiol alone remain low. However, in the same tissues of mice injected with progesterone alone or progesterone plus estradiol there is a significant (P<0.01) and similar increase in Hand2 mRNA levels. Immunohistochemistry was used to determine if there isa difference in the localization of HAND2 protein in sections from the uteri of mice treated with progesterone compared to those treated with estradiol plus progesterone. The localization profile of HAND2 protein in these uteri issimilar (Fig.7L,M) and is similar to the Day 8 uteri in Fig. 7F. In some sections, background staining occurred in the lumens of some blood vessels. Thisisalso seen in sections incubated with the same concentration of normal IgG in place of the Goat anti-HAND2 IgG (Fig.7J).

Alterations in Hand2 Expression in an In Vitro Mouse Model Provide Evidence for Hand2 Function in Decidualization

Mouse endometrial stromal cells (ESCs) isolated from optimally-sensitized uteri of pregnant or ovariectomized mice have the ability to undergo decidualization in vitro (Bell & Searle 1981). This in vitrodecidualization is accompanied by an increased expression of markers of decidualization such as prolactin family 8, subfamily a, member 2 (Prl8a2) (Kimura et al. 2001) and alkaline phosphatase (Chen et al. 2009). ESCs were isolated from sensitized uteri of mice to study Hand2 expression in mouse uterine cells during decidualization in vitro. Incubation of the cells with only steroids for 0–3 days resultsin the progressive increase in expression of Prl8a2 on days 1–3 of culture (Fig.8A). Unlike Prl8a2, Hand2 mRNA isdetected in the cells on Day 0 of culture (Fig.8B). Thereafter, the levels of Hand2 mRNA significantly (P<0.01) increase in the cells on Days 1–3 of culture. Immunocytochemistry was used to verify that HAND2 protein levels were also up-regulated in these cells during decidualization in vitro. HAND2 protein was localized mainly in a few nuclei on Days 0 of culture (Fig. 8B). By days 1, 2 and 3 of culture there is an increase in the number of cells staining positive for HAND2 and most of this staining appears to be localized to the nuclei (Fig. 8C-E).

Figure 8.

Figure 8

Open in a new tab

Gene expression in cultured mouse endometrial stromal cells as they undergo decidualization in vitro. Expression of (A) Hand2 and the decidualization marker (B) Prl8a2 during decidualization in vitro as determined by qRT-PCR. Bars with different letters are significantly (P<0.05) different. Immunocytochemical localization of HAND2 protein in cells atDay 0 (B), 1 (C), 2 (D) and 3 (E) of culture.

Prostaglandins play a key role in implantation and decidualization in rodents (Wang & Dey 2005, Kennedy et al. 2007). Further, prostaglandin E2 (PGE2) can enhance the decidualization of rodent and human endometrial stromal cells in vitro (Yee & Kennedy 1993, Frank et al. 1994, Pakrasi & Jain 2008). Therefore, we determined the effect of PGE2 on Hand2, Prl8a2 and alkaline phosphatase 2 (Akp2) mRNA levels in mouse ESCs. Cells were incubated for 2 days in the presence ofsteroids without or with the addition of PGE2. As shown in Fig.9A, the mRNA levels for both Hand2 and the decidualization marker Akp2increase significantly (P<0.01) in response to PGE2. On the other hand, Prl8a2 mRNA levels decrease slightly but significantly (P<0.05) in response to PGE2.

Figure 9.

Figure 9

Open in a new tab

Effects of PGE2 and Hand2 siRNA in mouse endometrial stromal cells in vitro. (A) Effect of incubating cells without (−PGE2) or with (+PGE2) PGE2(10 µM) for 2 days on relative Hand2 Prl8a2 and Akp2 mRNA levels. Bars with different letters (a,b,c) are significantly different (P<0.05). (B) Effect of transient transfection with control siRNA and Hand2 siRNA on relative Hand2 Prl8a2 and Akp2 mRNA levels in cells after 2 days in medium containing PGE2.*Denotes a significant (P<0.01) difference in mRNA levels between treatments. For all graphs, the bars represent mean ± SEM (N=4). ND denotes mRNA not detected. Immunocytochemical localization of HAND2 protein in cells transiently transfected with (C) control and (D)HAND2 siRNA.

In the final experiment using mouse endometrial cell cultures, the effect of reducingHand2 expression on decidualization was determined. As shown in Fig.9B, Hand2 mRNA levels significantly (P<0.01) decrease in cells transiently transfected with Hand2small interfering RNA (siRNA), as compared to those treated with a control siRNA. Although a decrease in Prl8a2mRNA levels is not seen, the levels for Akp2 mRNA also significantly (P<0.01) decrease in the cells transfected with Hand2 siRNA. Immunohistochemical staining for HAND2 protein seen in control cells (Fig. 9C) is reduced in cells transfected with Hand2 siRNA (Fig. 9D)

HAND2 Expression in Human Endometrial Cells Undergoing Decidualization In Vitro

To determine if increased HAND2 gene expression also occurs in human endometrial stromal cells during decidualization we utilized the HESC cell line. HESC cells were incubated with vehicle, steroid hormones or steroid hormones plus PGE2 for 0–3 days. To verify an increase in decidualization of the cells we measured the mRNA levels of several established decidualization markers,including FOXO1A, insulin-like growth factor binding protein 1 (IGFBP1), prolactin (PRL), and tissue inhibitor of metalloproteinase 3(TIMP3) (Buzzio et al. 2006).As shown in Fig.10A-D, FOXO1A, IGFBP1, PRL and TIMP3 mRNA levels significantly(P<0.05) increased on Day 1 in response to PGE2 plus hormones compared to control and steroid-treated cells. On Day 2 and 3 of culture, mRNA levels significantly (P<0.05) increased in response to hormones alone compared to control. On the other hand, mRNA levels significantly (P<0.05) increased even more in response to PGE2 plus hormones compared to those treated with vehicle or hormones. As human endometrial stromal cells undergo decidualization, proliferation of the cells dramatically decreases and cyclin E2 (CCNE2) mRNA levels in the cells decrease (Tierney et al. 2003). Therefore we also used a decrease in CCNE2 mRNA levels as a marker of decidualization. For Days 1–3 of culture, treatment with hormones caused a significant (P<0.05) decrease in CCNE2 mRNA levels compared to those incubated with vehicle (Fig.10E). CCNE2 mRNA levels significantly (P<0.05) decreased even more in response to PGE2 plus hormones compared to those treated with vehicle or hormones on each day. Finally, HAND2 mRNA levels were significantly (P<0.05) greater in cells treated with hormones compared those incubated with vehicle on Days 1, 2 and 3 of culture (Fig.10F). On these days, HAND2 mRNA levels were significantly (P<0.05) greater in cells treated with PGE2 plus hormones compared those incubated with vehicle or hormones alone

Figure 10.

Figure 10

Open in a new tab

Changes in gene expression in human HESC cells undergoing decidualization in vitro. Cells were treated with vehicle (Veh), steroid hormones (H; estradiol-17β, 10 nM; medroxyprogesterone, 1 µM) or hormones plus PGE2 (10 µM; H+PGE2) for 0, 1, 2 or 3 days and relative (A) FOXO1A, (B) IGFBP1, (C) PRL, (D) TIMP3, (E) CCNE2 and (F) HAND2 mRNA levels were determined by qRT-PCR. Bars with a different letter on a given day denotes a significant (P<0.05) difference in mRNA levels. Cells were treated with vehicle (Veh), or steroid hormones plus PGE2 (H+PGE2) for 0, 6, 12, 18 or 24 hours and relative (G) HAND2 and (H) FOXO1A mRNA levels were determined by qRT-PCR.* Denotes a significant (P<0.05) difference in mRNA levels between treatments at a given time point.For all graphs the bars represent mean ± SEM (N=4).

Since HAND2 expression in HESC cells increasesrapidly in HESC cultures, a shorter time course for induction of expression was examined. Cells were treated with vehicle or steroids plus PGE2 for 0, 6, 12, 18 or 24 hours. As shown in Fig.11A,HAND2 mRNA levels significantly (P<0.05) increased in the steroid plus PGE2 treated cells compared to those treated with vehicle at each time point between 6–24 h. This was paralleled with increases in the levels of FOXO1A mRNA in the steroid plus PGE2 treated cells at these time points (Fig.9H).

Figure 11.

Figure 11

Open in a new tab

Gene expression in HESC cells stably expressing control shRNA and HAND2 shRNA after incubation with steroids (estradiol-17β, 10 nM; medroxyprogesterone, 1 µM) plus PGE2 (10 µM) for 2 days. (A) Relative mRNA levels determined by qRT-PCR. Bars represent mean ± SEM (N=4). Difference in mRNA levels significantly different *P<0.05, **P<0.01 and ***P<0.001. Immunocytochemical localization of HAND2 protein in HESC cells expressing (B) control and (C) HAND2 shRNA.

Depletion of HAND2 in a Human In Vitro Cell Model Suggests a Regulatory Role for this Transcription Factor in Decidualization

In order to assess the function of HAND2 expression in human endometrial stromal cell decidualization, we established HESC cells which stably express either control non-target or HAND2-targettingsmall hairpin RNA (shRNA). These cells were treated with steroids plus PGE2 for 2 days and the mRNA levels of several genes were determined. As shown in Fig.11A, HAND2 shRNA caused a significant (P<0.01) decrease in HAND2 mRNA levels. This was accompanied by significant decreases in FOXO1A (P<0.05) and IGFBP1 (P<0.001) mRNA levels. Unexpectedly HAND2 shRNA significantly (P<0.05) increased PRL mRNA levels. To verify that HAND2 shRNA-expressing cells also have a reduced level of nuclear HAND2 protein in the HESC cells we used immunocytochemistry. Cells expressing non-targeting control shRNA (Fig. 11B) robustly stained for HAND2 protein while those expressing HAND2 shRNA did not (Fig. 11C).

DISCUSSION

Hand2 expression dramatically increases in the mouse uterus during decidualization. Previously, using Northern blot methods and limited in situ hybridization studies, we have shown that Hand2 mRNA levels in the mouse uterus increase during decidualization (Bany & Cross 2006). In these experiments we extended this approach to include the more sensitive technique of qRT-PCR, and find using this method that there is a dramatic increase in Hand2 mRNA levels in the mouse uterus during decidualization.Further, we verified that the magnitude and timing of the induction of Hand2 expression in a pregnant mouseis similar to expression ina pseudopregnant uterus undergoing bead-induced decidualization. This suggests that blastocyst-specific molecular or physical stimuli are not required for Hand2 expression in the mouse uterus during decidualization. Besides assessing the localization of Hand2mRNA, this study also assessed the localization of HAND2 protein.Increased expression at the mRNA as well as protein levels occurred in cells undergoing decidualization. Further,HAND2 protein islocalized mainly to the nuclei of these cells. Therefore, the protein is located in the proper subcellular compartment for it to be potentially regulating the expression of downstream genes that play a key role in the decidualization process.

The uterus must go through a series of hormone-dependent changes in order to mountnormal implantation and decidualization responses. Certainly estrogen and progesterone both play key roles in thisprocess of uterine sensitization or receptivity (Psychoyos 1973, Psychoyos 1976, Psychoyos 1986). A very recent study using uterine-specific Hand2 knockout miceshowed that Hand2 is expressed in the subepithelial stroma during the receptive phase and that this expression is essential for stromal-epithelial signaling to to obtain a receptive uterus (Li et al. 2011), The present study confirmed that Hand2 is expressed in the mouse uterus prior to the onset of implantation. Although expression levels are much lower compared to that during decidualization, this expression was localized to a subpopulation of stromal cells adjacent to the luminal epithelium. Ovariectomized mice can be treated with a specific regimen of injections with estrogen and progesterone in order to transiently sensitize their uteri for an artificial deciduogenic stimulus (Milligan & Mirembe 1985, Herington & Bany 2007b). The present study also shows that there is a progesterone-dependent increase in Hand2 expression the endometrial stromal cells adjacent to the luminal epithelium during hormone-induced uterine sensitization of ovariectomized mice. This is consistent with previous work on the effects of RU486 on reducing Hand2 expression in the preimplantation mouse uterus on Day 3.5 of pregnancy (Li et al. 2011). However, although all these results strongly suggest Hand2 expression is downstream of the progesterone receptor, it still remains to be determined if Hand2 transcription is directly regulated by progesterone receptors or by other downstream targets.

Progesterone is a key regulator of uterine gene expression during the uterine sensitization period. For example,Hoxa10 expression in the mouse and human endometrium is induced by progesterone prior to the onset of implantation (Ma et al. 1998, Taylor et al. 1998)and plays a key role in endometrial receptivity (Gui et al. 1999, Vitiello et al. 2008). Very recent work also suggests progesterone is a major regulator of Hand2 expression in the mouse uterus during the receptive phase (Li et al. 2011). Using ovariectomized mice and an exogenous hormone sensitization model, the present study shows that Hand2expression increases in response to progesterone.The localization of Hand2 expression in the stromal cells adjacent to the luminal epithelium on Day 3.5 of pregnancy or in optimally-sensitized uteri of ovariectomized steroid-treated mice is consistent with the localization of PGR protein in these cells on Day 3.5 of pregnancy (Tan et al. 1999). However, PGR is also found in the luminal epithelia on Day 3.5 of pregnancy (Tan et al. 1999) while these cells do not appear to express appreciable amounts of Hand2. These observations suggest that regulation ofHand2 expression in the subepithelial endometrial stromal cells of the mouse uterus during sensitization might be complex. However, our results support the hypothesis that Hand2 expression is dependent at least in part onthe actions of progesterone.

Studies to date suggest that the endometrial expression of Hoxa10 plays a critical role in uterine sensitization and decidualization (Das 2010) and several observations raise the possibility thatHOXA10 might be thedirect regulator of Hand2 expression in the uterus during the early peri-implantation period. The present study shows that the expression level profiles of Hand2 and Hoxa10 are similar in the mouse uterus during hormone-induced uterine sensitization in ovariectomized mice. Progesterone is the major regulator of Hoxa10 expression in the mouse and human uterus (Ma et al. 1998, Taylor et al. 1998, Lim et al. 1999, Godbole et al. 2007). On Day 3.5 of pregnancy in the mouse, expression of Hoxa10 is restricted to the endometrial stroma, then dramatically increases in areas undergoing decidualization (Das 2010). In a similar fashion, Hoxa10 expression is also seen in mouse and human endometrial stromal cells as they undergo decidualizationin vitro (Godbole & Modi 2010). Finally, the promoter region of the mouse and human Hand2 genes contain conserved putative Hoxa10- but not PGR- binding sites (Voth et al. 2009). Therefore, future work determining how Hand2 gene expression is potentially controlled by the direct actions of HOXA10 at the Hand2promoter region is warranted.

Currently little is known about the function of Hand2 expression in the mouse or human uterus during uterine sensitization and decidualization. Hand2-knockout mice are embryonic lethals (Srivastava et al. 1997), so approaches other than the use of generic mouse knockout models are needed to study HAND2 function in mouse endometrial stromal cell decidualization. A very recent study using uterine tissue-specific Hand2knockout mouse clearly shows that Hand2 expression is critical for proper uterine receptivity (Li et al. 2011). These mice showed no decidual swellings and this is likely due to a failure of the embryo to begin implantation and thus pregnancy fails prior to the onset of decidualization. The current study has used endometrial stromal cell culture models to assess the function of Hand2 expression during the decidualization of mouse and human endometrial stromal fibroblast cells. We find that Hand2 expression significantly increases during the decidualization of these cells. Suppressing Hand2 expression in mouse or human endometrial cells may cause a decrease in the decidualization of these cells as indicated by the reduction of the expression ofmarkers of decidualization. However, this may be an oversimplification. For example, our results support the hypothesis that HAND2 plays a key role in the expression of IGFBP1 and FOXO1A, established markers of decidualization in humans. On the other hand, PRL expression increased when HAND2 expression was suppressed in human cells. Since PRL is also a marker of decidualization, this suggests HAND2 might somehow suppress PRL expression and decidualization. In a similar fashion, the expression of Akp2 but not Prl8a2 decreased in the mouse endometrial stromal cells when Hand2 expression was suppressed. Therefore, although of the present study suggest it plays a key role in decidualization of mouse and human endometrial stromal cells, the identity and function ofdownstream target genes of Hand2 expression needs to be elucidated further.

PGE2 isa regulator of Hand2 expression in endometrial cells undergoing decidualization. PGE2plays a key role in decidualization and endometrial stromal cell decidualizationin rodents (Kennedy & Ross 1997, Cong et al. 2006, Pakrasi & Jain 2008). The results of this study suggest that Hand2 expression in mouse and human endometrial stromal cells during decidualization is enhanced by PGE2. PGE2 has 4potential receptors (prostaglandin E receptors 1 to 4) which activate distinct intracellular signaling pathways (Sugimoto & Narumiya 2007). The identity of which one(s) is important in Hand2 expression in the cells during decidualization is not known.However, recent evidence suggests that prostaglandin E receptor 2 may be the key receptor involved in rat uterine decidualization (Pakrasi & Jain 2008).On the other hand, potentially more than one receptor might play a role in the mouse (Yang et al. 1997). Regardless, the effect of PGE2 on enhancing the decidualization of rodent and human endometrial stromal cells has been attributed to increased cAMP levels in the cells (Yee & Kennedy 1991, Yee & Kennedy 1993, Brar et al. 1997).It possible that cAMP may be able to modulate transcription througha highly conserved cAMP response element-binding protein (CREB) sitepreviously described in the Hand2promoter region (Voth et al. 2009). However, further work is needed to determine with certainty if increased cAMP production andactivation of related downstream intracellular signaling pathways,including CREB-mediated transcriptional regulation,areinvolved in mediating the effects of PGE2 onendometrial stromal cell Hand2expression during decidualization.

In conclusion, this study was undertaken to better characterize the expression and function of Hand2 expression in the uterus during mouse implantation and in decidualization of mouse and human endometrial stromal cells.The results of the present study support the hypothesis that Hand2 expression in mice plays an important role both in uterine sensitization prior to the onset of implantation, and in decidualization after the onset of implantation. Further, our results suggest Hand2 may play a key role in the decidualization of human endometrial stromal cells.Hand2 expression might play a conserved role in the mouse and human endometrial stromal celldecidualization. These results should form the basis for further research on Hand2 function in the uterus during implantation.

MATERIALS AND METHODS

Animals and Tissue Collection

All procedures involved the use female (9–12 week old) and male (3–10 months old) CD1 mice (Charles Rivers Laboratory, Wilmington, MA) and were approved by the Southern Illinois University Institutional Animal Care and Use Committee. Mice were allowed free access to food (Formulab 5008 LabDiet, Purina Mills, Gray Summit, MO) and water while housed under controlled light conditions (lights on: 0700 h to 1900 h). Females were mated with fertile males and the morning a vaginal plug was observed was termed Day 0.5 of pregnancy. The model used to obtain concanavalin A (ConA)(Sigma-Aldrich, St. Louis) artificially-induced deciduomas for this study has been described in detail elsewhere (Herington et al. 2009). Briefly, females were mated with vasectomized males and the morning a vaginal plug was observed was considered Day 0.5 of pseudopregnancy. At 13:00–15:00 h on Day 2.5, ConA-coated agarose beads were transferred into the uterine lumen. This deciduoma model was chosen over other artificial decidualization models because it better recapitulates the decidual changes that occur in the pregnant uterus compared to other commonly used models (Herington et al. 2009). Tissues were collected at approximately 09:00 h on Days3.5–8.5 of pregnancy or pseudopregnancy.

For some experiments, animals were ovariectomized and allowed at least 10 days recovery. These mice were then injected subcutaneously with a series of steroidhormones in 0.1 ml of sesame oil (Fisher Scientific, Pittsburgh, PA) at 9 a.m. to sensitize their uteri for a deciduogenic stimulus as shown in Fig.6A. Tissues were collected at 3 p.m. on Days 5–9 of treatment.

After killing the mice, uterine horns were dissected and cleared of mesentery. For Day 4.5–8.5 of pregnancy or pseudopregnancy samples, non-implantation site (NIS) and implantation site (IS) or non-bead site (NB) and bead-induced deciduoma (BID) site segments were separated using a scalpel. For uteri collected on Day 4.5 of pregnancy or pseudopregnancy, mice received intravenous injections of Evans blue dye as previously described (Herington et al. 2009) in order to visualize embryo and bead implantation segments. For implantation segment tissue, all tissues of the conceptus (embryo and trophoblast cells) were carefully dissected out and discarded prior to RNA isolation. For qRT-PCR the tissue samples were placed in RNAlater (Qiagen, Valencia, CA). For in situ hybridization and immunohistochemistry the tissues were collected, fixed and prepared into paraffin blocks as previously described (Herington & Bany 2007b).

qRT-PCR

Total RNA isolation and qRT-PCR was carried out exactly as described previously (Herington et al. 2009). Oligonucleotide primers for mouse Akp2 mRNA and 18 S rRNA have previously been published (Herington & Bany 2007a, Herington et al. 2009). Primers used for human FOXO1A, H36B4, HAND2, IGFBP1, PRL, and TIMP3 mRNA’s have previously been published (Buzzio et al. 2006). Mouse Hand2 (upstream 5’-AGATCAAGAAGACCGACGTGA-3’, downstream 5’- CTGTCCGGCCTTTGGTTTTC -3’), mouse Prl8a2 (upstream 5’-GCTGCATCAATTCCTGAATGTCA-3’, downstream 5’- CCTCATCACGTCTATACATGCG-3’), mouse Fkbp3(upstream 5’-ATGGGCCTACGGAAAGAAAG-3’, downstream 5’-CCACTTCAAAAATGAGCTTGG −3’), mouse Gja1(upstream 5’-TTTGACTTCAGCCTCCAAGG-3’, downstream 5’-CCATGTCTGGGCACCTCT-3’), mouse Runx1(upstream 5’-CTCCGTGCTACCCACTCACT-3’, downstream 5’-ATGACGGTGACCAGAGTGC-3’) and human CCNE2 (upstream 5’-CCCCAAGAAGCCCAGATAAT-3’, downstream 5’-CAGGTGGCCAACAATTCC −3’) primers were obtained from IDT DNA Technologies.Briefly, High Capacity RNA-to-cDNA Kits (Applied Biosystems, Foster City, CA) were used to generate the cDNA and 2x iQ SYBR Green Supermix plus a CFX real-time PCR machine (BioRAD, Hercules, CA) was used to perform the quantitative PCR. PCR primers were used at a final concentration of 200 nM and cycle conditions were 3 min at 94○C followed by 40 cycles of 94 ○C, 62–64○C for 20 sec, and 72 ○C for 1 min for melting, annealing, and extension steps, respectively. Cycle thresholds (Ct) were determined using the CFX software (BioRAD) and relative mRNA levels were determined as previously described after normalization to mouse 18 S rRNA (Herington & Bany 2007a) or human H36B4 (Buzzio et al. 2006).

In Situ Hybridization

A 314 base pair Hand2 cDNA was generated by RT-PCR using TopTaq mastermix (Qiagen) and primers (IDT DNA Technologies, upstream 5’-CGAGGAGAACCCCTACTTCC-3’ and downstream 5’-CGCAGTGTCTTGATCTTGGA-3’) as directed by the manufacturer (Qiagen). The cDNA was purified using a Cycle-Pure kit (Omega BioTek, Norcross, GA) then cloned into pGEM-Teasy vector (Promega, Madison, WI) and grown in bacteria as directed by the manufacturers. Plasmid preparation and purification was carried out using the Omega BioTek Maxiprep kit as recommended by the manufacturer (Omega Biotek). The sequence and orientation of the cDNA clone was then verified (W. M. Keck Center for Comparative and Functional Genomics, University of Illinois Urbana-Champaign). To generate sense and antisense probes, transcription templates were generated by PCR using the appropriate combination of M13 forward or reverse plus upstream or downstream Hand2 primers. The PCR amplicons were isolated using anE.Z.N.A. Cycle Pure Kit as directed by the manufacturer (Omega Biotek). Preparation and purification of the DIG-labeled sense and antisense probes using these transcription templates was carried out as previously reported (Bany & Cross 2006).

Paraffin sections mounted on Superfrost plus glass slides (Fisher Scientific) were cleared in xylene,and then hydrated in graded ethanol solutions followed by water. The sections were then digested with proteinase K (Amresco, Solon, OH), and treated with triethanolamine (Sigma) as previously described (Bany & Cross 2006). Hybridization, post-hybridization washes, immunological detection of DIG and colorimetric development using BCIP/NBT was carried out exactly as previously described (Simmons et al. 2008). After counterstaining in nuclear fast red, the sections were covered with glass coverslips and observed under a Leica Microscope equipped with a Retiga Camera and QImaging Pro software (QImaging, Surrey, BC). Nuclei and Hand2 mRNA stain red and purple, respectively. Sections incubated with sense riboprobes in place of antisense riboprobe exhibited no positive Hand2 mRNA staining (data not shown).

HAND2 Immunohistochemistry

Paraffin sections mounted on Superfrost plus glass slides were cleared in xylene, and then hydrated in graded ethanol solutions followed by water. The sections were then exposed to high temperature antigen unmasking and washed in PBS containing 0.05 % Tween-20 (PBST). The sections were then incubated with blocking buffer containing 2% normal horse serum (Vector Labs, Burlingame, CA) in PBST at room temperature for 1 hour followed by 0.1µg/ml goat anti-HAND2 IgG (Santa Cruz, Santa Cruz, CA) in blocking buffer overnight at 4 C. After washing in PBST, the sections were incubated with biotinylated horse anti-goat IgG (Vector Labs, 2 µg/ml) in blocking buffer for 1 hour at room temperature. After washing in PBST, the sections were incubated with streptavidin-alkaline phosphatase conjugate (Vector Labs) in PBST for 30 minutes at room temperature. After washing with PBST, the sections were incubated with Alkaline Phosphatase Blue or BCIP/NBT chromogenic substrates (Vector Labs) as directed by the manufacturer. After counterstaining in nuclear fast red, the sections were covered with glass coverslips and observed under a Leica Microscope. Nuclei and HAND2 protein stain red and blue/purple, respectively. Recently the same antibody used in this study was shown to stain similar cells in the receptive mouse uterus and was lost in a uterine-specific knockout mouse (Li et al. 2011) verifying the specificity of the antibody. In the present study, sections incubated with the same concentration of normal goat IgG in place of the anti-HAND2 IgG exhibited no positive staining except where noted (data not shown).

Primary Cultures of Mouse Endometrial Stromal Cells

To obtain primary endometrial cell cultures, we ovariectomized mice and treated them with steroids to sensitize the uterus for a deciduogenic stimulus exactly as described in Fig. 14. At three hours after the steroid injection on Day 8 of hormone treatment, the mice were killed and the uteri were dissected. Endometrial stromal cells were isolated and plated exactly as previously described (Bany et al. 2000, Bany & Schultz 2001). Once plated, the cells were incubated with DMEM:F12 (InVitrogen, Carlesbad, CA) containing 10% charcoal stripped serum, 100 U/L penicillin, 0.1 g/L streptomycin and 1.25 mg/L fungizone (InVitrogen) with or without treatments. Unless otherwise indicated, the medium contained 17β-estradiol (10 nM)plusmedroxyprogesterone (1 µM) (Sigma) with or without PGE2 (10 µM, Cayman Chemical, Ann Arbor, MI). Cells were incubated with treatments for 1, 2 or 3 days with fresh medium supplied every 24 hours.

In some experiments cells were transiently transfected with mouse control non-targeting or Hand2siGENOME SMARTpool®siRNA (Dharmacon, Inc., Lafayette CO). Transfections were carried out for 6h on freshly plated primary cell cultures using Lipofectamine 2000 (InVitrogen) according to the manufacturer’s instructions using 100 nM of siRNA pool. The cells were then incubated with steroids plus PGE2 as above for 2 days with fresh medium supplied every 24 hours.

HAND2 Immunocytochemstry

Cells were washed with PBS and fixed with PBS containing 4% paraformaldehyde for 10 minutes. After washing in PBS, the cells were incubated in blocking buffer (PBS, 0.2% Triton-X100, 10% horse serum) for 1 hour. Next, the cells were incubated overnight at 4 ○C with blocking buffer containing 0.1µg/ml goat anti-HAND2 IgG (Santa Cruz). After washing in PBS, the cells were incubated inblocking buffer containing 0.2 µg/ml biotinylated donkey anti-goat IgG (Vector Labs) for 30 minutes. After washing in PBS the cells were incubated with 1 mg/ml Cy3-conjugated streptavidin (Jackson Immunoresearch)hours. Finally, after washing and staining the nuclei with 4,6’-diamidino-2-phenylindole (DAPI, Pierce), the cells were observed under a Leica inverted fluorescence microscope equipped with the appropriate filters and Retiga camera controlled by QImaging software (QImaging). Positive staining for HAND2 protein and nuclei were red and blue, respectively.

In Vitro Decidualization Model of Human Endometrial Stromal Cells

The previously described (Krikun et al. 2004) immortalized human endometrial stromal cell (HESC) line was obtained from ATCC (Washington, DC) and cultured, passaged and preserved as recommended by the supplier. Once reaching 70% confluence, the cells were incubated with various treatments in phenol-red free DMEM:F12 containing 3.1 g/L glucose and 1mM sodium pyruvate (Sigma) supplemented with 1.5 g/L sodium bicarbonate (InVitrogen), 1% ITS+ Premix (Becton-Dickinson, Franklin-Lakes, NJ) and 10% charcoal-stripped serum (Fisher Scientific). Treatments included estradiol-17β (10 nM) plus medroxyprogesterone (1 µM, Sigma)and PGE2 (10 µM, Cayman Chemicals).Medium was replaced every 24 h of culture.

Electroporation and Establishing HESC’s that Stably Express shRNA

Suresilencing™ shRNA expression vectors targeting human HAND2 (Hand2 shRNA: GTGCGTTTGTGAAGTGTATCT) or that were a negative non-targeting control (GGAATCTCATTCGATGCATAC)(SABiosciences, Frederick, MD) were electroporated into HESC cells. These vectors carry neomycin-resistance sequences allowing for positive selection of cells that stably express the shRNA’s. Electroporation was carried out using a Gene Pulser Xcell Electroporation System (BioRAD). Suspensions of HESC cells (3×106) in Ingenio™ Electroporation Solution (Mirus, Madison, WI) were mixed with 20 µg of shRNA vector, then exposed to a 15 millisecond pulse of 2.5 volts. After electroporation, the cells were recovered and plated in medium as above but containing 0.4 mg/ml neomycin. After 4 passages under neomycin selection, the HESC cells were stored in liquid nitrogen until used.

Acknowledgements

This work was supported by a Eunice Kennedy Shriver National Institute of Child Health and Human Development (HD049010) grant and Central Research Committee Grant from NIH and Southern Illinois University School of Medicine, respectively. We would like to thank Ms. Sheila Scillufo for her excellent technical assistance on this project.

REFERENCES

  1. Abrahamsohn PA, Zorn TM. Implantation and decidualization in rodents. The Journal of experimental zoology. 1993;266:603–628. doi: 10.1002/jez.1402660610. [DOI] [PubMed] [Google Scholar]
  2. Bany BM, Cross JC. Post-implantation mouse conceptuses produce paracrine signals that regulate the uterine endometrium undergoing decidualization. Developmental biology. 2006;294:445–456. doi: 10.1016/j.ydbio.2006.03.006. [DOI] [PubMed] [Google Scholar]
  3. Bany BM, Harvey MB, Schultz GA. Expression of matrix metalloproteinases 2 and 9 in the mouse uterus during implantation and oil-induced decidualization. Journal of reproduction and fertility. 2000;120:125–134. doi: 10.1530/jrf.0.1200125. [DOI] [PubMed] [Google Scholar]
  4. Bany BM, Schultz GA. Tissue inhibitor of matrix metalloproteinase-3 expression in the mouse uterus during implantation and artificially induced decidualization. Molecular reproduction and development. 2001;59:159–167. doi: 10.1002/mrd.1018. [DOI] [PubMed] [Google Scholar]
  5. Bell SC, Searle RF. Differentiation of decidual cells in mouse endometrial cell cultures. Journal of reproduction and fertility. 1981;61:425–433. doi: 10.1530/jrf.0.0610425. [DOI] [PubMed] [Google Scholar]
  6. Bhatt H, Brunet LJ, Stewart CL. Uterine expression of leukemia inhibitory factor coincides with the onset of blastocyst implantation. Proceedings of the National Academy of Sciences of the United States of America. 1991;88:11408–11412. doi: 10.1073/pnas.88.24.11408. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Brar AK, Frank GR, Kessler CA, Cedars MI, Handwerger S. Progesterone-dependent decidualization of the human endometrium is mediated by cAMP. Endocrine. 1997;6:301–307. doi: 10.1007/BF02820507. [DOI] [PubMed] [Google Scholar]
  8. Buzzio OL, Lu Z, Miller CD, Unterman TG, Kim JJ. FOXO1A differentially regulates genes of decidualization. Endocrinology. 2006;147:3870–3876. doi: 10.1210/en.2006-0167. [DOI] [PubMed] [Google Scholar]
  9. Chen L, Belton RJ, Jr, Nowak RA. Basigin-mediated gene expression changes in mouse uterine stromal cells during implantation. Endocrinology. 2009;150:966–976. doi: 10.1210/en.2008-0571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cong J, Diao HL, Zhao YC, Ni H, Yan YQ, Yang ZM. Differential expression and regulation of cylooxygenases, prostaglandin E synthases and prostacyclin synthase in rat uterus during the peri-implantation period. Reproduction. 2006;131:139–151. doi: 10.1530/rep.1.00861. [DOI] [PubMed] [Google Scholar]
  11. Das SK. Regional development of uterine decidualization: molecular signaling by Hoxa-10. Molecular reproduction and development. 2010;77:387–396. doi: 10.1002/mrd.21133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Dunn CL, Kelly RW, Critchley HO. Decidualization of the human endometrial stromal cell: an enigmatic transformation. Reproductive biomedicine online. 2003;7:151–161. doi: 10.1016/s1472-6483(10)61745-2. [DOI] [PubMed] [Google Scholar]
  13. Frank GR, Brar AK, Cedars MI, Handwerger S. Prostaglandin E2 enhances human endometrial stromal cell differentiation. Endocrinology. 1994;134:258–263. doi: 10.1210/endo.134.1.7506205. [DOI] [PubMed] [Google Scholar]
  14. Godbole G, Modi D. Regulation of decidualization, interleukin-11 and interleukin-15 by homeobox A 10 in endometrial stromal cells. Journal of reproductive immunology. 2010;85:130–139. doi: 10.1016/j.jri.2010.03.003. [DOI] [PubMed] [Google Scholar]
  15. Godbole GB, Modi DN, Puri CP. Regulation of homeobox A10 expression in the primate endometrium by progesterone and embryonic stimuli. Reproduction. 2007;134:513–523. doi: 10.1530/REP-07-0234. [DOI] [PubMed] [Google Scholar]
  16. Grinius L, Kessler C, Schroeder J, Handwerger S. Forkhead transcription factor FOXO1A is critical for induction of human decidualization. The Journal of endocrinology. 2006;189:179–187. doi: 10.1677/joe.1.06451. [DOI] [PubMed] [Google Scholar]
  17. Gui Y, Zhang J, Yuan L, Lessey BA. Regulation of HOXA-10 and its expression in normal and abnormal endometrium. Molecular human reproduction. 1999;5:866–873. doi: 10.1093/molehr/5.9.866. [DOI] [PubMed] [Google Scholar]
  18. Herington JL, Bany BM. The conceptus increases secreted phosphoprotein 1 gene expression in the mouse uterus during the progression of decidualization mainly due to its effects on uterine natural killer cells. Reproduction. 2007a;133:1213–1221. doi: 10.1530/REP-07-0085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Herington JL, Bany BM. Effect of the conceptus on uterine natural killer cell numbers and function in the mouse uterus during decidualization. Biology of reproduction. 2007b;76:579–588. doi: 10.1095/biolreprod.106.056630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Herington JL, Underwood T, McConaha M, Bany BM. Paracrine signals from the mouse conceptus are not required for the normal progression of decidualization. Endocrinology. 2009;150:4404–4413. doi: 10.1210/en.2009-0036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kennedy TG, Gillio-Meina C, Phang SH. Prostaglandins and the initiation of blastocyst implantation and decidualization. Reproduction. 2007;134:635–643. doi: 10.1530/REP-07-0328. [DOI] [PubMed] [Google Scholar]
  22. Kennedy TG, Ross HE. Temporal- and hormone-dependent changes in uterine sensitization for the decidual cell reaction and decidualization in vitro of rat endometrial stromal cells. Journal of reproduction and fertility. 1997;109:129–136. doi: 10.1530/jrf.0.1090129. [DOI] [PubMed] [Google Scholar]
  23. Kessler CA, Schroeder JK, Brar AK, Handwerger S. Transcription factor ETS1 is critical for human uterine decidualization. Molecular human reproduction. 2006;12:71–76. doi: 10.1093/molehr/gal008. [DOI] [PubMed] [Google Scholar]
  24. Kimura F, Takakura K, Takebayashi K, Ishikawa H, Kasahara K, Goto S, Noda Y. Messenger ribonucleic acid for the mouse decidual prolactin is present and induced during in vitro decidualization of endometrial stromal cells. Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology. 2001;15:426–432. doi: 10.1080/gye.15.6.426.432. [DOI] [PubMed] [Google Scholar]
  25. Krikun G, Mor G, Alvero A, Guller S, Schatz F, Sapi E, Rahman M, Caze R, Qumsiyeh M, Lockwood CJ. A novel immortalized human endometrial stromal cell line with normal progestational response. Endocrinology. 2004;145:2291–2296. doi: 10.1210/en.2003-1606. [DOI] [PubMed] [Google Scholar]
  26. Lee K, Jeong J, Kwak I, Yu CT, Lanske B, Soegiarto DW, Toftgard R, Tsai MJ, Tsai S, Lydon JP, DeMayo FJ. Indian hedgehog is a major mediator of progesterone signaling in the mouse uterus. Nature genetics. 2006;38:1204–1209. doi: 10.1038/ng1874. [DOI] [PubMed] [Google Scholar]
  27. Li Q, Kannan A, DeMayo FJ, Lydon JP, Cooke PS, Yamagishi H, Srivastava D, Bagchi MK, Bagchi IC. The antiproliferative action of progesterone in uterine epithelium is mediated by Hand2. Science. 2011;331:912–916. doi: 10.1126/science.1197454. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Lim H, Ma L, Ma WG, Maas RL, Dey SK. Hoxa-10 regulates uterine stromal cell responsiveness to progesterone during implantation and decidualization in the mouse. Molecular endocrinology. 1999;13:1005–1017. doi: 10.1210/mend.13.6.0284. [DOI] [PubMed] [Google Scholar]
  29. Lu Z, Hardt J, Kim JJ. Global analysis of genes regulated by HOXA10 in decidualization reveals a role in cell proliferation. Molecular human reproduction. 2008;14:357–366. doi: 10.1093/molehr/gan023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Ma L, Benson GV, Lim H, Dey SK, Maas RL. Abdominal B (AbdB) Hoxa genes: regulation in adult uterus by estrogen and progesterone and repression in mullerian duct by the synthetic estrogen diethylstilbestrol (DES) Developmental biology. 1998;197:141–154. doi: 10.1006/dbio.1998.8907. [DOI] [PubMed] [Google Scholar]
  31. Matsumoto H, Zhao X, Das SK, Hogan BL, Dey SK. Indian hedgehog as a progesterone-responsive factor mediating epithelial-mesenchymal interactions in the mouse uterus. Developmental biology. 2002;245:280–290. doi: 10.1006/dbio.2002.0645. [DOI] [PubMed] [Google Scholar]
  32. Milligan SR, Mirembe FM. Intraluminally injected oil induces changes in vascular permeability in the 'sensitized' and 'non-sensitized' uterus of the mouse. Journal of reproduction and fertility. 1985;74:95–104. doi: 10.1530/jrf.0.0740095. [DOI] [PubMed] [Google Scholar]
  33. Pakrasi PL, Jain AK. Cyclooxygenase-2 derived PGE2 and PGI2 play an important role via EP2 and PPARdelta receptors in early steps of oil induced decidualization in mice. Placenta. 2008;29:523–530. doi: 10.1016/j.placenta.2008.03.001. [DOI] [PubMed] [Google Scholar]
  34. Psychoyos A. Hormonal control of ovoimplantation. Vitamins and hormones. 1973;31:201–256. doi: 10.1016/s0083-6729(08)60999-1. [DOI] [PubMed] [Google Scholar]
  35. Psychoyos A. Hormonal control of uterine receptivity for nidation. Journal of reproduction and fertility. Supplement. 1976:17–28. [PubMed] [Google Scholar]
  36. Psychoyos A. Uterine receptivity for nidation. Annals of the New York Academy of Sciences. 1986;476:36–42. doi: 10.1111/j.1749-6632.1986.tb20920.x. [DOI] [PubMed] [Google Scholar]
  37. Ramathal CY, Bagchi IC, Taylor RN, Bagchi MK. Endometrial decidualization: of mice and men. Seminars in reproductive medicine. 2010;28:17–26. doi: 10.1055/s-0029-1242989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Salamonsen LA, Dimitriadis E, Jones RL, Nie G. Complex regulation of decidualization: a role for cytokines and proteases--a review. Placenta. 2003;24 Suppl A:S76–S85. doi: 10.1053/plac.2002.0928. [DOI] [PubMed] [Google Scholar]
  39. Simmons DG, Rawn S, Davies A, Hughes M, Cross JC. Spatial and temporal expression of the 23 murine Prolactin/Placental Lactogen-related genes is not associated with their position in the locus. BMC genomics. 2008;9:352. doi: 10.1186/1471-2164-9-352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Song H, Lim H, Das SK, Paria BC, Dey SK. Dysregulation of EGF family of growth factors and COX-2 in the uterus during the preattachment and attachment reactions of the blastocyst with the luminal epithelium correlates with implantation failure in LIF-deficient mice. Molecular endocrinology. 2000;14:1147–1161. doi: 10.1210/mend.14.8.0498. [DOI] [PubMed] [Google Scholar]
  41. Srivastava D, Thomas T, Lin Q, Kirby ML, Brown D, Olson EN. Regulation of cardiac mesodermal and neural crest development by the bHLH transcription factor, dHAND. Nature genetics. 1997;16:154–160. doi: 10.1038/ng0697-154. [DOI] [PubMed] [Google Scholar]
  42. Stewart CL, Kaspar P, Brunet LJ, Bhatt H, Gadi I, Kontgen F, Abbondanzo SJ. Blastocyst implantation depends on maternal expression of leukaemia inhibitory factor. Nature. 1992;359:76–79. doi: 10.1038/359076a0. [DOI] [PubMed] [Google Scholar]
  43. Sugimoto Y, Narumiya S. Prostaglandin E receptors. The Journal of biological chemistry. 2007;282:11613–11617. doi: 10.1074/jbc.R600038200. [DOI] [PubMed] [Google Scholar]
  44. Tan J, Paria BC, Dey SK, Das SK. Differential uterine expression of estrogen and progesterone receptors correlates with uterine preparation for implantation and decidualization in the mouse. Endocrinology. 1999;140:5310–5321. doi: 10.1210/endo.140.11.7148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Taylor HS, Arici A, Olive D, Igarashi P. HOXA10 is expressed in response to sex steroids at the time of implantation in the human endometrium. The Journal of clinical investigation. 1998;101:1379–1384. doi: 10.1172/JCI1597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Tierney EP, Tulac S, Huang ST, Giudice LC. Activation of the protein kinase A pathway in human endometrial stromal cells reveals sequential categorical gene regulation. Physiological genomics. 2003;16:47–66. doi: 10.1152/physiolgenomics.00066.2003. [DOI] [PubMed] [Google Scholar]
  47. Vitiello D, Pinard R, Taylor HS. Gene expression profiling reveals putative HOXA10 downstream targets in the periimplantation mouse uterus. Reproductive sciences. 2008;15:529–535. doi: 10.1177/1933719108316911. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Voth H, Oberthuer A, Simon T, Kahlert Y, Berthold F, Fischer M. Co-regulated expression of HAND2 and DEIN by a bidirectional promoter with asymmetrical activity in neuroblastoma. BMC molecular biology. 2009;10:28. doi: 10.1186/1471-2199-10-28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wang H, Dey SK. Lipid signaling in embryo implantation. Prostaglandins & other lipid mediators. 2005;77:84–102. doi: 10.1016/j.prostaglandins.2004.09.013. [DOI] [PubMed] [Google Scholar]
  50. Yang ZM, Das SK, Wang J, Sugimoto Y, Ichikawa A, Dey SK. Potential sites of prostaglandin actions in the periimplantation mouse uterus: differential expression and regulation of prostaglandin receptor genes. Biology of reproduction. 1997;56:368–379. doi: 10.1095/biolreprod56.2.368. [DOI] [PubMed] [Google Scholar]
  51. Yee GM, Kennedy TG. Role of cyclic adenosine 3',5'-monophosphate in mediating the effect of prostaglandin E2 on decidualization in vitro. Biology of reproduction. 1991;45:163–171. doi: 10.1095/biolreprod45.1.163. [DOI] [PubMed] [Google Scholar]
  52. Yee GM, Kennedy TG. Prostaglandin E2, cAMP and cAMP-dependent protein kinase isozymes during decidualization of rat endometrial stromal cells in vitro. Prostaglandins. 1993;46:117–138. doi: 10.1016/0090-6980(93)90038-9. [DOI] [PubMed] [Google Scholar]

RESOURCES