Skip to main content
PLOS One logoLink to PLOS One
. 2011 Jul 27;6(7):e22326. doi: 10.1371/journal.pone.0022326

Identification of Reproduction-Specific Genes Associated with Maturation and Estrogen Exposure in a Marine Bivalve Mytilus edulis

Corina M Ciocan 1,#, Elena Cubero-Leon 1,#, Christophe Minier 2, Jeanette M Rotchell 1,*,¤
Editor: Vincent Laudet3
PMCID: PMC3144882  PMID: 21818309

Abstract

Background

While it is established that vertebrate-like steroids, particularly estrogens (estradiol, estrone) and androgens (testosterone), are present in various tissues of molluscs, it is still unclear what role these play in reproductive endocrinology in such organisms. This is despite the significant commercial shellfishery interest in several bivalve species and their decline.

Methodology/Principal Findings

Using suppression subtraction hybridisation of mussel gonad samples at two stages (early and mature) of gametogenesis and (in parallel) following controlled laboratory estrogen exposure, we isolate several differentially regulated genes including testis-specific kinases, vitelline lysin and envelope sequences.

Conclusions

The differentially expressed mRNAs isolated provide evidence that mussels may be impacted by exogenous estrogen exposure.

Introduction

Bivalve molluscs, such as Mytilus sp., are currently used as sentinel organisms to monitor exposure to a variety of chemical contaminants in international programmes such as “Mussel Watch” [1][3]. Their sessile nature, wide geographical distribution, large populations and large filtering rates make them excellent indicator species for environmental toxicology applications [4]. It is apparent that molluscs take up and bioaccumulate potentially endocrine disrupting chemicals [5], [6] and they are sensitive to endocrine disruption at environmentally relevant concentrations [7][10].

In vertebrate reproductive endocrinology it is well recognised that the sex steroids, namely estrogens, androgens, progestins, mineralcorticoids, and glucocorticoids or glucorticoid hormones, play a key role via their binding to steroid receptors. Sex steroid hormones and their role in supporting molluscan reproduction are still unclear. It is established that vertebrate-like steroids, particularly estrogens (estradiol E2, estrone E1), androgens (testosterone), and progestins are present in various tissues of molluscs [11][14]. A number of enzymatic activities and regulatory, including non-genomic, pathways in molluscs have also been characterised [11], [15][16]. The occurrence of sex steroids is therefore not in doubt, yet their source (endogenous or exogenous) [17], [18], and role in molluscs is less clear. It is also important to distinguish between the presence of estrogens and an endogenous role. For example, while there are reports of putative hydroxysteroid dehydrogenase and cholesterol esterase-like unpublished sequences for Haliotis diversicolor (ADV02385) and Biomphalaria glabrata (LIBEST_021038, www.ncbi.nlm.nih.gov/), there is no report of side-chain cleavage activities in any bivalve mollusc in the literature, to our knowledge, and this reaction is the first step to make an estrogen in vertebrates.

Historically, the role of estrogens in the hormonal regulation of the reproduction in bivalves was suggested to be similar to that which they fulfil in the vertebrate endocrine system. Studies have shown that injection of E2 directly into the gonads of Crassostrea gigas causes a significant increase in oocyte diameter and egg yolk protein vitellin (Vn) content in the female oyster ovary [19]. Also, in scallop, Patinopecten yessoensis and P. magellanicus, direct injection of E2 into gonads resulted in an increase of Vn in the ovary and serotonin (5-HT)-induced gamete release [20], [21]. Estrogens are thought to bring about the induction of the 5-HT receptor on the oocyte membrane and in turn trigger spawning [22]. The levels of E2 in bivalves have also been shown to vary along the year; the profile is synchronised with variations of oocyte diameter and gonad index [23]. Subsequently, E2 is considered to exhibit a seasonal change associated with the reproductive cycle and to be involved in the regulation of several reproductive processes in bivalves such as vitellogenesis [23].

The role and metabolism of E2 in bivalves is however debated. For instance, exposure of M. edulis and Anodonta cygnea, either waterborne or injected E2, failed to induce the production of Vn-like proteins in the hemolymph and gonads [24]. Also, functional studies using the invertebrates Aplysia californica, Octopus vulgaris, Thais clavigera, Marisa cornuarietis and C. gigas have shown that the ER does not bind E2 or is unresponsive [25][28]. Puinean et al (2006) also reported an absence of ER mRNA induction in M. edulis (at the mature stage of gametogenesis) following E2 aqueous exposure [29]. Possible explanations for the lack of induction in bivalves have been suggested [6], [25], [27], [29]. The role of estrogens and their functional mechanism of action in bivalves are therefore far from clear.

The bivalve response to exogenous estrogens has been the focus of recent research. Significant natural variation was observed in M. edulis ER mRNA expression, with significantly lower values during January, February and July compared with other times of the year [8]. M. edulis exposed to E2 and the synthetic estrogens ethinyl estradiol (EE2) and estradiol benzoate (EB) for 10 days also displayed a significant increase in ER mRNA expression provided mussels were exposed to estrogens at the early stage of gametogenesis [8]. In contrast, mature mussels exposed to estrogens displayed no statistically significant change in ER mRNA expression [8], [29]. Gonad VTG mRNA expression also showed up-regulation in estrogen exposed mussels at the early stages of development [8]. In a parallel study, serotonin receptor and cyclooxygenase mRNA expression were also observed modulated by E2 exposure in M. edulis [9]. Combined, these data suggest that estrogens may have an impact on reproduction processes in bivalves.

Building on these observations, the aim of this study was to adopt an exploratory approach to identify novel genes differentially expressed in the maturation process and the estrogen response in the marine bivalve, M. edulis.

Results

SSH Analysis

The 206 putative mRNA sequences were compared with sequences in the NCBI GenBank database using the blastx and blastn algorithms. Forty seven (22%) of the sequences, with a small number of duplicates, from the forward (up-regulated genes) and reverse (down-regulated genes) libraries could be matched to genes from different organisms, mainly invertebrate species (Tables 1 and 2). The remaining sequenced clones showed similarity to unidentified hypothetical or novel proteins or showed no similarity with the sequences deposited in the database. In some of these latter cases, there was high similarity to sequences identified in other mussel EST libraries: sixteen from the E2-exposed enriched library were highly similar (blastn E = 3.0−115 to 1.0−100) to sequences identified in SSH libraries that were constructed from mussels treated with an inactivated cocktail of Vibrio (AM880859) or exposed to a variety of environmental stressors (ES389965.1).

Table 1. Differentially expressed (subtracted) mRNAs identified in M. edulis testis at two stages of gonadal development.

Clone accession no. Category & gene identity Length (bp) Homolog species/Accession no. E-value
HQ690234 aSenescence-associated protein 155 Brugia malayi XP_001900327.1 5.0E −10
AJ492924.1 aHistone 2A 301 M. edulis AJ492924.1 1.0E −108
AY484747.1 a16S ribosomal protein 931 M. edulis AY484747.1 0
FM995162.1 aVitelline coat lysin M7 precursor 635 M. edulis BAA03551.1 3.0E −123
HQ678182 aSialic acid binding lectin 397 Helix pomatia ABF00124.1 4.0E −15
HQ678180 bTestis-specific serine/threonine kinase 1 (TSTK1) 815 Strongylocentrotus purpuratus XP_787865.1 4.0E −70
HQ678181 bTestis-specific A-kinase-anchoring-protein 182 Gallus gallus XP_002162537.1 9.0E −6
HQ67816 bHistone H2A isoform 2 332 Haliotis discus discus ACJ12611.1 1.0E −53
HQ678184 bBeta-tubulin 511 C. gigas AAU93877.1 9.0E −81
AB257133 bER 111 M. edulis BAF34366.2 1.0E −12
HQ678183 bBindin precursor 5 repeat variant (acrosomal protein) 392 C. gigas ABQ18234.1 7.0E −14
HQ678185 bPhosphodiesterase 1 533 S. purpuratus NP_001091918.1 5.0E −62
AY130198.1 bCytochrome c oxidase subunit III 254 M. edulis AAV68300.1 2.0E −31
a

Down-regulated in early developing testes relative to mature testes.

b

Up-regulated in early developing testes relative to mature testes.

Table 2. Differentially expressed (subtracted) mRNAs identified in M. edulis testis following E2 exposure.

Clone Accession No. Category & gene identity (BlastX) Length (bp) Homolog species/Accession no. E-value
HQ664951 aComplement C1q-like protein 111 Ailuropoda melanoleuca XP_002918680.1 7.0E −5
HQ690237 aAlpha tubulin 297 C. gigas BAD80736.1 2.0E −51
HQ690238 aBeta tubulin 501 Rattus norvegicus NP_954525.1 2.0E −94
HQ690235 aRibosomal protein L7 240 C. gigas AJ557884.1 3.0E −30
HQ690239 aBromodomain adjacent to zinc finger domain, 1A 369 G. gallus XP_426440.2 7.0E −24
HQ690240 aElongation factor 1 gamma 162 Saccoglossus kowalevskii NP_001171816.1 1.0E −13
HQ664949 aVitelline envelope zona pellucida domain 9 900 Haliotis rufescens ABE72949.1 1.0E −26
HQ664950 aC1q domain containing protein 141 Argopecten irradians ADD17343 7.0E −5
HQ664948 aRWD domain containing protein 4A 240 Caligus rogercresseyi ACO11028.1 3.0E −17
HQ664952 aHemaglutinin/amoebocyte aggregation factor precursor 240 Salmo salar ACI68653.1 1.0E −10
YP_073337 aCytochrome c oxidase subunit II 448 M. edulis YP_073337.1 4.0E −56
YP_073338.1 aNADH dehydrogenase subunit 1 647 M. edulis YP_073338.1 4.0E −61
HQ690236 aTriosephosphate isomerase TIM 156 Metapenaeus ensis AAP79983.1 3.0E −13
AAV68423 bCytochrome c oxidase subunit 1 534 M. edulis AAV68411.1 8.0E −90
AAV68416 bCytochrome b 302 M. edulis AAV68404.1 6.0E −28
HQ690243 bFerritin-like protein 492 Pinctada fucata AAQ12076.1 2.0E −78
HQ690241 bSenescence-associated protein 318 Trichoplax adhaerens XP_002118266.1 6.0E −49
HQ690244 bSpectrin beta chain 293 Harpegnathos saltator EFN75523.1 1.0E −10
a

Down-regulated in control testes relative to E2-exposed testes.

b

Up-regulated in control testes relative to E2-exposed testes.

Validation of Differential mRNA Expressions

Six target mRNAs were selected for qPCR validation of the SSH differential expression results (Fig. 1A–F). Both vitelline coat lysin precursor mRNA (Fig. 1A) and sialic acid binding lectin (Fig. 1B) were statistically significantly differentially regulated according to testis stage of maturity, up-regulated as the testis mature. Conversely, testis-specific serine/threonine kinase 1 (TSTK1)(Fig. 1C) and ER (Fig. 1D) mRNA expressions measured using qPCR are statistically significantly down-regulated in mature testis. C1q domain containing protein, identified as down-regulated in control mussels compared with E2-exposed mussels by SSH, was confirmed as such using qPCR (Fig. 1E). Cytochrome b mRNA expression was statistically significantly down-regulated in E2-exposed mussels relative to control samples, again confirming the SSH result (Fig. 1F).

Figure 1. Real-time quantitative RT-PCR validation of differential screening results of M. edulis developing gonad versus mature gonad samples (1A–1E) and M. edulis experimentally-exposed to E2 (1F–1H).

Figure 1

Data plotted as mean±SEM, n = 15 samples. * = p<0.05; ** = p<0.01.

Two further target mRNAs highlighted by SSH were employed in a reverse analysis using qPCR (Fig. 1G–H). RWD domain containing protein 4A, highlighted by SSH as down-regulated in control mussel testis samples relative to E2-exposed samples (Table 2), was identified using qPCR as down-regulated in early developing testis samples relative to mature samples (Fig. 1G). TSTK1 highlighted by SSH as up-regulated in early developing stages of mussel testis samples relative to mature samples (Table 1), was identified using qPCR as down-regulated in E2-exposed testis samples relative to control samples (Fig. 1H).

Discussion

Using the SSH approach we generated libraries enriched for genes that vary between early developing and mature mussels, as well as control and E2 experimentally exposed individuals. These libraries were produced from mussel testis and, because of the limited genomic resources over three quarters of the sequences could not be identified, or could only be matched to other ESTs of unknown function. This success rate of identification (22%) is comparable to similar studies using molluscs (6–12% [30], [31]). The sequence and species with the highest identity using BLAST analysis are cited in the Tables, yet this can give arbitrary results and accordingly the GenBank accession numbers for each sequence isolated are also cited to facilitate further characterisation.

In the subtractions reported here four separate libraries were constructed using: a) cDNA from immature males as driver (reverse subtraction 1), b) cDNA from mature males as driver (forward subtraction 1), c) cDNA from untreated immature males as driver (reverse subtraction 2) and d) cDNA from E2-treated immature males as driver (forward subtraction 2). A number of transcripts of interest were selected for additional characterization by qPCR and are discussed below.

mRNA Transcripts Differentially Regulated in Testis at Two Stages of Gametogenesis

In the developing testis tissue samples (Fig. 2B) sequences associated with sperm development, cell signalling, cell cycle and electron transport were isolated (Table 1) and would be consistent with an early stage of gametogenesis in which there is supporting cell initiation tubule formation and cell proliferation occurring. Two sperm-associated kinases were identified that may have roles similar to testes-specific kinases reported in the scallop, A. purpuratus (ES469344, [30]). The sperm-associated kinases differ with scallop, however, in that the mussel homolog is up-regulated in immature/early developing gonad, yet the scallop homolog is down-regulated at this stage of gametogenesis. Interestingly, the testis-specific serine/threonine kinase 1 activity, naturally up-regulated in early developing mussels (Fig. 1C) was statistically significantly down-regulated following experimental exposure to E2 (Fig. 1H).

Figure 2. Sections of testis at different stages of the mussel gametogenic cycle.

Figure 2

A, resting stage, characterized by the presence of connective tissue, narrow tubules, few residual germ cells undergoing cytolysis. B, early gametogenesis stage, characterized externally by flat and colourless shape, and microscopically by visible presence of connective tissue, some growing follicles (less than 30% of examined area), few spermatozoa in the centre of some follicles. C, mature stage, characterized externally by thick, milk-coloured aspect, and microscopically by 90–95% of examined area covered by follicles, some fully grown, packed with spermatozoa, very little surrounding connective tissue. Scale bars: 100 µm.

Histones, tubulin, and cytochrome c oxidase have also previously been isolated in bivalve testes though their maturation-specific levels were not reported. Up-regulation of ER in early stages of development is consistent with previous work using mussel [8]. The observed up-regulation of acrosomal binding protein and putative vitelline coat lysin in the developing testis are likely related to one another. Bivalve acrosomal proteins, including lysin, are released upon binding of sperm to the egg vitelline envelope, lysin then creates a hole for sperm to pass via binding to a vitelline envelope glycoprotein vitelline envelope receptor for lysin (VERL) [32]. In the developing testis the acrosomal binding protein and lysin appear up-regulated (Table 1), yet the VERL is not up-regulated until we analyse the testis at mature stages of gametogenesis (Table 1). In the testis tissues at the mature stage of gametogenesis, a VERL-like sequence was isolated and apparently up-regulated. VERL is currently used as a marker of female sex in mussels [33], and its appearance in male samples observed herein may suggest that approach be reviewed.

The few sequences identified and up-regulated in the mature testis (Fig. 2C) were cell cycle and apoptosis related (Table 1). For instance, senescence-associated protein is likely involved in blocking cell cycle, preventing initiation of maturation. Such sequences may be indicative that the testis are in preparation for a move towards the mature/spawning/spent stage of gametogenesis.

mRNA Transcripts Differentially Regulated in Testis Following E2 Exposure

Several interesting mRNA transcripts were identified and validated as differentially expressed in E2-exposed mussel testis samples (Table 2; Fig. 1E–F and H). Here we limit the discussion to two: vitelline envelope zona pellucida domain protein and the RWD domain containing protein.

Vitelline envelope zona pellucida domain mRNA expression was down-regulated in control compared with E2-exposed mussel testis (Table 2). Vitelline envelope proteins in vertebrates share a common structural motif, the zona pellucida domain [32]. The expression of such proteins has been proposed as a sensitive biomarkers of environmental estrogens in vertebrates for the following reasons: E2 induction has been observed in different teleost species [34]; the observed induction of vitelline envelope mRNA isoforms precedes ER and VTG mRNA induction in E2 injected juvenile Arctic char; and the expression remains high (up to 36 days) [35]. It is also argued that xenoestrogen-induced changes in vitelline envelope would have a higher potential for ecologically adverse effects because it involves critical population parameters in terms of fertilization and mechanical protection of the eggshell [36]. Another advantage of adopting vitelline envelope proteins as a biomarker relates to a report of minimal seasonal variation in eelpout over a yearly cycle [37]. Here, we also observe increased vitelline envelope zona pellucida induction in E2-exposed testis relative to control mussel testis samples, and as such, this may represent a promising biomarker of estrogen pollution in bivalves.

RWD domain containing protein 4 was identified as differentially expressed in this study. A phylogenetic analysis of the sequence (using MEGA 5 software, maximum likelihood) was conducted to further investigate its' identity (Fig. 3). The isolated M. edulis partial RWD sequence clusters with an anemone RWD domain containing protein 4 sequence rather than the vertebrates.. However, Gir2, a related RWD superfamily protein, represents a different branch from all the other RWD sequences, including that isolated from mussel (Fig. 2). RWD domain containing protein 4 was identified as down-regulated in control compared with E2-exposed mussel testis (Table 2). In a parallel analysis using qPCR, the RWD domain containing protein 4 mRNA expression was statistically significantly up-regulated in mature testis compared to early developing testis samples (Fig. 1G). The M. edulis RWD domain containing protein 4 mRNA expression is thus up-regulated naturally as part of the maturation status, and apparently susceptible to exogenous induction following experimental exposure of early stage mussels to E2. Currently there is no information available in the literature regarding RWD domain proteins other than for RWDD1 isoform in rats [38]. The RWD domain containing protein 1 counterpart in rat is referred to as small androgen receptor (AR) interactin protein (data from RDG-Rat Genome Database). RWDD1 enhances transactivation activity of AR in mice thymus, and as such, RWDD1 is considered an AR co-regulator [38]. Further work is required to determine if the M. edulis RWD domain containing protein, differentially expressed in mature gonads, represents any such component of a non-genomic nuclear receptor pathway.

Figure 3. Phylogenetic analysis of the M. edulis partial Rwd sequence with published RWD domain containing protein 4 sequences from different species: human (H. sapiens NP_057036), rat (Rattus norvegicus EDL78909), frog (Rana catesbeiana ACO52001), ant (C. floridanus EFN74794), fruit fly (Drosophila pseudoobscura XP_001356904), anemone (Nematostella vectensis XP_001639511), nematode (Ascaris suum ADY48558) as well as a related protein family member Gir2 (from M. anisopliae EFZ00157 and Saccharomyces.cerevisiae NP_010436), and an unrelated protein ras (from M. galloprovincialis ABC46896).

Figure 3

In conclusion, several differentially regulated genes, including testis-specific kinases, vitelline lysin and envelope sequences, have been isolated from mussel testis. The differentially expressed mRNAs, isolated from testis at two stages of maturation and following experimental estrogen exposure, provide evidence that mussels may be impacted by exogenous estrogen exposure.

Methods

Sample Collection and Histological Analysis

For all the analyses, mussels were collected at low tide near Brighton Pier, U.K. (50°49′ longitude and 0°8′ latitude) on April 2007 and February 2008, kept in seawater and immediately brought to the laboratory. Mussels were dissected and a piece of gonad (approximately 0.5 cm2) was fixed in 4% formaldehyde prior to histology processing, a second and third piece from the same individual mussel was used for the molecular and chemical analyses using methods described previously [8], [29]. Histological analysis of the gonads was performed as described previously [8]. The gonads of male mussels synchronized at early gametogenesis stages (Fig. 2B) and mature stages (Fig. 2C) were kept in RNAlater™ (Qiagen Ltd., Crawley, U.K.) for further analysis using suppression subtractive hybridization (SSH).

Experimental E2 Exposure

Mussels collected in February 2008 (size 4.43±0.34 cm; synchronized at early gametogenesis) were placed in aquaria with 60 l of artificial seawater (InstantOcean, Sarrebourg, France) at a light regime of 12 hrs light/12 hrs dark. Following acclimatization (4 d), the mussels were exposed for 10 d to a nominal concentration of 50 ng/l of E2 under semistatic conditions or kept as a non-exposed control as described previously [8], [30]. The E2 concentrations in the aquaria water (control and exposed) were analysed and are described previously [8]. Male gonads were immersed in RNAlater™ (Qiagen Ltd., Crawley, U.K.) and selected for SSH analysis.

SSH

The SSH procedure was used to isolate and enrich for genes differentially-expressed between 1. mussels at the early stages of gonad development versus mature stage, as well as 2. mussels exposed experimentally to E2 while at the early stages of gonad development versus control mussels at the same stage of early gonad development. Total RNA was extracted from each mussel using Nucleospin RNA II (Macherey Nagel, U.K.) according to the manufacturer's protocol. For each group, equal amounts of RNA were pooled from each mussel (8 mussels in each group). cDNA was synthesised using SuperSMART PCR cDNA Synthesis reagents (Clontech, France). The forward- and reverse-subtracted libraries were produced using PCR-Select cDNA Subtraction reagents (Clontech, France) according to the manufacturer's protocol. The differential PCR products generated by SSH were inserted in a pCRR2.1 linearized vector and the constructs were transformed into competent TOP10 E.coli (Invitrogen). Sixty randomly selected colonies from each subtracted library were inoculated in LB broth and screened by PCR for inserts using vector-based primers. A total of 40 clones per library were randomly selected for sequencing (GATC Biotech U.K.) directly from the PCR product. Sequence identities were obtained by BLAST searches against the NCBI nucleic acid and protein databases. Sequence reads with E-value<10−5 were filtered out.

Quantitative Real-Time PCR Analysis of Target mRNA Expression in M. edulis Testis

Six target mRNAs, identified using SSH, were selected for further investigation using real-time quantitative RT-PCR. In order to increase the statistical power of the analysis 15 individual samples (all males) were analyzed from each group. In brief, total RNA was isolated from gonadal tissue using RNeasy reagents (Qiagen, U.K.) and treated with RNA-free DNase I (Qiagen, U.K.) to remove genomic DNA. RNA concentrations were measured with the Quant-iT RNA assay kit (Invitrogen, U.K.) using a Qubit fluorometer (Invitrogen, U.K.). Reverse transcription of 1 µg of total RNA samples was carried out using Transcriptor First Strand cDNA synthesis reagents (Roche Applied Science, U.K.). Mussel species (M. edulis) was confirmed by PCR amplification of the Glu gene [39]. Real-time PCR reactions were performed in duplicate, in a final volume of 25 µl containing 12.5 µl of qPCR Fast Start SYBR Green Master Rox (Roche Applied Science, U.K.), 5 µl of diluted cDNA (1/60) and 3.75 µM primers (Table 3). A control lacking cDNA template was included in qPCR analysis to determine the specificity of target cDNA amplification. Amplification was detected with a Mx3005P real time PCR system (Stratagene, U.K.). For each target mRNA, melting curve, gel picture and sequences were analysed in order to verify the specificity of the amplified products and the absence of primer dimers. The amplification efficiency of each primer pair was calculated using a dilution series of cDNA. A normalization factor, calculated using geNorm software [40] and based on the expression levels of the best performing reference transcripts in the gonadal samples, was used for accurate normalization of real-time RT-PCR data. The most stable reference mRNAs used for normalization in the developing and mature gonadal samples were 18S rRNA (L33448), elongation factor 1-alpha (AF063420), and alpha-tubulin (DQ174100). For the E2-exposed samples the most stable reference transcripts used for normalization were 18S rRNA, 28S rRNA (Z29550) and elongation factor 1-alpha.

Table 3. Primer sequences used for expression analysis of selected differentially expressed target mRNAs in mussel testis tissue and reference transcripts.

Target/Reference mRNA Forward primer 5′-3′ Reverse primer 5′-3′
Vitelline coat lysin TATCATCAAGACAGAAAGCAGACAG CCATATGGTAAACTGCGTTTTAGTC
Sialic acid binding lectin AATATCAGTTCAACGAAGCCTACAC AATCCTACCACTTTGCTTACTTGTG
Testis-specific serine kinase 1 (TSTK1) ATAGACCGACTTACCGTGCTGT CTGTGCTGAAAATCTTTTGGTG
ER GGAACACAAAGAAAAGAAAGGAAG ACAAATGTGTTCTGGATGGTG
C1q domain GGAACCCTTGCTGTAAACACGC AGGTCTAAAGCAGCCAAGCCAG
Cytochrome b CCAGTGGAACCTTATATCR TTTCAAATCTACAGGACGGC
RWD domain containing protein 4 AAGAGCTGGAAGTCCCCCATTC GTCCGCTGTCCATGAAATCTCC
18S rRNA GTGCTCTTGACTGAGTGTCTCG CGAGGTCCTATTCCATTATTCC
28S rRNA AGCCACTGCTTGCAGTTCTC ACTCGCGCACATGTTAGACTC
Elongation factor 1-alpha CACCACGAGTCTCTCCCAGA GCTGTCACCACAGACCATTCC
Alpha-tubulin TTGCAACCATCAAGACCAAG TGCAGACGGGCTCTCTGT

Statistical Analysis

All statistical analyses were carried out using SPSS Inc. Chicago, U.S.A. (version 17.0). All data was tested for normality and homogeneity of variances. For data normally distributed, independent t-tests were performed to compare the means. For not normally distributed data non-parametric Mann-Whitney U comparison tests were performed to compare the means. Statistical significance was accepted at p<0.05.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: This work was funded by the European Regional Development Fund in the framework of the INTERREG IV A France (Channel) - England programme (DIESE project number 4040). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Goldberg ED. The Mussel Watch concept. Environ Monit Assess. 1986;91:91–103. doi: 10.1007/BF00398031. [DOI] [PubMed] [Google Scholar]
  • 2.Andral B, Stanisiere JY, Sauzade D, Damier E, Thebault H, et al. Monitoring chemical contamination levels in the Mediterranean based on the use of mussel caging. Mar Pollut Bull. 2004;49:704–712. doi: 10.1016/j.marpolbul.2004.05.008. [DOI] [PubMed] [Google Scholar]
  • 3.Viarengo A, Lowe D, Bolognesi C, Fabbri E, Koehler A. The use of biomarkers in biomonitoring: a 2-tier approach assessing the level of pollutant-induced stress syndrome in sentinel organisms. Comp Biochem Physiol C. 2007;146:281–300. doi: 10.1016/j.cbpc.2007.04.011. [DOI] [PubMed] [Google Scholar]
  • 4.Rittschof D, McClellan-Green P. Molluscs as multidisciplinary models in environmental toxicology. Mar Pollut Bull. 2005;50:369–373. doi: 10.1016/j.marpolbul.2005.02.008. [DOI] [PubMed] [Google Scholar]
  • 5.Morcillo Y, Porte C. Evidence of endocrine disruption in clams - Ruditapes decussata - transplanted to a tributyltin-polluted environment. Environ Pollut. 2000;107:47–52. doi: 10.1016/s0269-7491(99)00133-5. [DOI] [PubMed] [Google Scholar]
  • 6.Labadie P, Peck M, Minier C, Hill EM. Identification of the steroid fatty acid ester conjugates formed in vivo in Mytilus edulis as a result of exposure to estrogens. Steroids. 2007;72:41–49. doi: 10.1016/j.steroids.2006.10.003. [DOI] [PubMed] [Google Scholar]
  • 7.Langston WJ, Burt GR, Chesman BS. Feminisation of male clams Scrobicularia plana from estuaries in Southwest UK and its induction by endocrine disrupting chemicals. Mar Ecol Prog Ser. 2007;333:173–184. [Google Scholar]
  • 8.Ciocan CM, Cubero-Leon E, Puinean AM, Hill EM, Minier C, et al. Effects of estrogen exposure in mussels, Mytilus edulis, at different stages of gametogenesis. Env Pollut. 2010;158:2977–2984. doi: 10.1016/j.envpol.2010.05.025. [DOI] [PubMed] [Google Scholar]
  • 9.Cubero-Leon E, Ciocan CM, Hill EM, Osada M, Kishida M, et al. Estrogens disrupt serotonin receptor and cyclooxygenase mRNA expression in the gonads of mussels (Mytilus edulis). Aquat Toxicol. 2010;98:178–187. doi: 10.1016/j.aquatox.2010.02.007. [DOI] [PubMed] [Google Scholar]
  • 10.Gagné F, Bouchard B, André C, Farcy E, Fournier M. Evidence of feminization in wild Elliptio complanata mussels in the receiving waters downstream of a municipal effluent outfall. Comp Biochem Physiol C. 2011;153:99–106. doi: 10.1016/j.cbpc.2010.09.002. [DOI] [PubMed] [Google Scholar]
  • 11.De Longcamp D, Lubet P, Drosdowsky M. The in vitro biosynthesis of steroids by the gonad of the mussel (Mytilus edulis). Gen Comp Endocrinol. 1974;22:116–127. doi: 10.1016/0016-6480(74)90093-8. [DOI] [PubMed] [Google Scholar]
  • 12.Reis-Henriques MA, Le Guellec D, Remy-Martin JP, Adessi GL. Studies of endogenous steroids from the marine mollusc Mytilus edulis L. by gas chromatography and mass spectrometry. Comp Biochem Physiol (B) 1990;95:303–309. [Google Scholar]
  • 13.Hines GA, Bryan PJ, Wasson KM, McClintock JB, Watts SA. Sex steroid metabolism in the Antarctic pteropod Clione antarctica (Mollusca: Gastropoda). Invert Biol. 1996;115:113–119. [Google Scholar]
  • 14.Zhu W, Mantione K, Jones D, Salamon E, Cho JJ, et al. The presence of 17-beta estradiol in Mytilus edulis gonadal tissues: evidence for estradiol isoforms. Neuroendocrinol Lett. 2003;24:137–140. [PubMed] [Google Scholar]
  • 15.Le Curieux-Belfond O, Moslemi S, Mathieu M, Seralini GE. Androgen metabolism in oyster Crassostrea gigas: evidence for 17 beta-HSD activities and characterization of an aromatase-like activity inhibited by pharmacological compounds and a marine pollutant. J Steroid Biochem Mol Biol. 2001;78:359–366. doi: 10.1016/s0960-0760(01)00109-1. [DOI] [PubMed] [Google Scholar]
  • 16.Janer G, Porte C. Sex steroids and potential mechanisms of non-genomic endocrine disruption in invertebrates. Ecotoxicol. 2007;16:145–160. doi: 10.1007/s10646-006-0110-4. [DOI] [PubMed] [Google Scholar]
  • 17.Le Curieux-Belfond O, Fievet B, Seralini GE, Mathieu M. Short-term bioaccumulation, circulation and metabolism of estradiol 17-beta in the oyster Crassostrea gigas. J Exp Mar Biol Ecol. 2005;325:125–133. [Google Scholar]
  • 18.Peck M, Labadie P, Miner C, Hill EM. Profiles of environmental and endogenous estrogens in the zebra mussel Dreissena polymorpha. Chemosphere. 2007;69:1–8. doi: 10.1016/j.chemosphere.2007.04.082. [DOI] [PubMed] [Google Scholar]
  • 19.Li Q, Osada M, Suzuki T, Mori K. Changes in vitellin during oogenesis and effect of estradiol on vitellogenesis in the Pacific oyster Crassostrea gigas. Invert Reprod Dev. 1998;33:87–93. [Google Scholar]
  • 20.Osada M, Takamura T, Sato H, Mori K. Vitellogenin synthesis in the ovary of scallop Patinopecten yessoensis: control by estradiol-17β and the central nervous system. J Exp Zool. 2003;299A:172–179. doi: 10.1002/jez.a.10276. [DOI] [PubMed] [Google Scholar]
  • 21.Wang C, Croll RP. Effects of sex steroids on in vitro gamete release in sea scallop Placopecten magellanicus. Invert Reprod Dev. 2003;44:89–100. [Google Scholar]
  • 22.Osada M, Nakata A, Matsumoto T, Mori K. Pharmacological characterization of serotonin receptor in the oocyte membrane of bivalve molluscs and its formation during oogenesis. J Exp Zool. 1998;28:124–131. [Google Scholar]
  • 23.Osada M, Tawarayama H, Mori K. Estrogen synthesis in relation to gonadal development of Japanese scallop, Patinopecten yessoensis: gonadal profile and immunolocalization of P450 aromatase and estrogen. Comp Biochem Physiol B. 2004;139:123–128. doi: 10.1016/j.cbpc.2004.07.002. [DOI] [PubMed] [Google Scholar]
  • 24.Riffeser M, Hock B. Vitellogenin levels in mussel hemolymph – a suitable biomarker for the exposure to estrogens? Comp Biochem Physiol (C) 2002;132:75–84. doi: 10.1016/s1532-0456(02)00048-0. [DOI] [PubMed] [Google Scholar]
  • 25.Thornton JW, Need E, Crews D. Resurrecting the ancestral steroid receptor: ancient origin of estrogen signalling. Science. 2003;301:1714–1717. doi: 10.1126/science.1086185. [DOI] [PubMed] [Google Scholar]
  • 26.Kajiwara M, Kuraku S, Kurokawa T, Kato S, Hirose H, et al. Tissue preferential expression of estrogen receptor gene in the marine snail, Thais clavigera. Gen Comp Endocrinol. 2006;148:315–326. doi: 10.1016/j.ygcen.2006.03.016. [DOI] [PubMed] [Google Scholar]
  • 27.Bannister R, Beresford N, May D, Routledge EJ, Jobling S, et al. Novel estrogen receptor-related transcripts in Marisa cornuarietis; a freshwater snail with reported sensitivity to estrogenic chemicals. Environ Sci Technol. 2007;41:2643–2650. doi: 10.1021/es062565m. [DOI] [PubMed] [Google Scholar]
  • 28.Matsumoto T, Nakamura AM, Mori K, Akiyama I, Hirose H, et al. Oyster estrogen receptor: cDNA cloning and immunolocalisation. Gen Comp Endocrinol. 2007;151:195–201. doi: 10.1016/j.ygcen.2007.01.016. [DOI] [PubMed] [Google Scholar]
  • 29.Puinean AM, Labadie P, Hill EM, Osada M, Kishida M, Nakao R, Novillo A, Callard IP, Rotchell JM. Laboratory exposure to 17-beta estradiol fails to induce vitellogenin and estrogen receptor gene expression in the marine invertebrate, Mytilus edulis. Aquat Toxicol. 2006;79:376–383. doi: 10.1016/j.aquatox.2006.07.006. [DOI] [PubMed] [Google Scholar]
  • 30.Boutet I, Moraga D, Marinovic L, Obreque J, Chavez-Crooker P. Characterisation of reproduction-specific genes in a marine bivalve mollusc: influence of maturation stage and sex on mRNA expression. Gene. 2008;407:130–138. doi: 10.1016/j.gene.2007.10.005. [DOI] [PubMed] [Google Scholar]
  • 31.Craft JA, Gilbert JA, Temperton B, Dempsey KE, Ashelford K, et al. Pyrosequencing of Mytilus galloprovincialis cDNAs: Tissue specific expression patterns. PLoS ONE. 2010;5:e8875. doi: 10.1371/journal.pone.0008875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Aagaard JE, Vacquier VD, MacCoss MJ, Swanson WJ. ZP domain proteins in the abalone egg coat include a paralog of VERL under positive selection that binds lysine and 18-kDa sperm. Mol Biol Evol. 2010;27:193–203. doi: 10.1093/molbev/msp221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Sedik WF, Dempsey KE, Meng X, Craft JA. Temporal expression of sex-specific genes in the mantle of the common mussel (Mytilus edulis). Mar Biol. 2010;157:639–646. [Google Scholar]
  • 34.Hyllner SJ, Silversand C, Haux C. Formation of vitelline envelope precedes the active uptake of vitellogenin during oocyte development in rainbow trout, Oncorhynchus mykiss. Mol Reprod Dev. 1994;39:166–175. doi: 10.1002/mrd.1080390208. [DOI] [PubMed] [Google Scholar]
  • 35.Westerlund L, Hyllner SJ, Schopen A, Olsson PE. Expression of three vitelline envelope protein genes in Arctic char. Gen Comp Endocrinol. 2001;122:78–87. doi: 10.1006/gcen.2001.7614. [DOI] [PubMed] [Google Scholar]
  • 36.Arukwe A, Knudsen FR, Goksoyr A. Fish zona radiata (eggshell) protein: a sensitive biomarker for environmental estrogens. Environ Health Perspect. 1997;105:418–422. doi: 10.1289/ehp.97105418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Larsson DG, Mayer I, Hyllner SJ, Forlin L. Seasonal variations of vitelline envelope. proteins, vitellogenin and sex steroids in male and female eelpout (Zoarces viviparous). Gen Comp Endocrinol. 2002;125:184–196. doi: 10.1006/gcen.2001.7740. [DOI] [PubMed] [Google Scholar]
  • 38.Kang N, Duan L, Tang L, Liu S, Li C, et al. Identification and characterization of a novel thymus aging related protein Rwdd1. Cell Mol Immunol. 2008;5:279–285. doi: 10.1038/cmi.2008.34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Inoue K, Waite JH, Matsuoka M, Odo S, Harayama S. Interspecific variations in adhesive protein sequences of Mytilus edulis, M. galloprovincialis, and M. trossulus. Biol Bull. 1995;189:370–375. doi: 10.2307/1542155. [DOI] [PubMed] [Google Scholar]
  • 40.Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3(7) doi: 10.1186/gb-2002-3-7-research0034. Article Number 0034.1. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES