Production in Escherichia coli of Poly(3-Hydroxybutyrate-co-3-Hydroxyvalerate) with Differing Monomer Compositions from Unrelated Carbon Sources

Quan Chen; Qian Wang; Guoqing Wei; Quanfeng Liang; Qingsheng Qi

doi:10.1128/AEM.00091-11

. 2011 Jul;77(14):4886–4893. doi: 10.1128/AEM.00091-11

Production in Escherichia coli of Poly(3-Hydroxybutyrate-co-3-Hydroxyvalerate) with Differing Monomer Compositions from Unrelated Carbon Sources ^{^▿}

Quan Chen ¹, Qian Wang ², Guoqing Wei ¹, Quanfeng Liang ¹, Qingsheng Qi ^1,^2,^*

PMCID: PMC3147381 PMID: 21652742

Abstract

The industrial production of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV) has been hindered by high cost and a complex control strategy caused by the addition of propionate. In this study, based on analysis of the PHBV biosynthesis process, we developed a PHBV biosynthetic pathway from a single unrelated carbon source via threonine biosynthesis in Escherichia coli. To accomplish this, we (i) overexpressed threonine deaminase, which is the key factor for providing propionyl-coenzyme A (propionyl-CoA), from different host bacteria, (ii) removed the feedback inhibition of threonine by mutating and overexpressing the thrABC operon in E. coli, and (iii) knocked out the competitive pathways of catalytic conversion of propionyl-CoA to 3-hydroxyvaleryl-CoA. Finally, we constructed a series of strains and mutants which were able to produce the PHBV copolymer with differing monomer compositions in a modified M9 medium supplemented with 20 g/liter xylose. The largest 3-hydroxyvalerate fraction obtained in the copolymer was 17.5 mol%.

INTRODUCTION

Polyhydroxyalkanoates (PHAs) are produced by many Eubacteria and some Archaea as carbon and energy storage compounds (36). Since PHAs possess thermoplastic or elastomeric properties and are completely biodegradable, they have been considered as alternatives for common plastics (8). The copolymers of 3-hydroxybutyrate (3HB) and 3-hydroxyvalerate (3HV), named poly(3-hydroxybutyrate-co-3-hydroxyvalerate) or PHBV, are commercially interesting due to several properties, particularly in terms of melting point, crystal growth rate, plasticity, and biodegradability (28, 30).

The biosynthesis of PHBV in bacteria involves two parallel pathways (Fig. 1). One leads to the formation of a C₄ monomer (3-hydroxybutyrate) in the copolymer, and the other leads to the formation of a C₅ monomer (3-hydroxyvalerate) (1, 36). The C₅ monomer is formed through the condensation of acetyl-coenzyme A (acetyl-CoA) and propionyl-CoA by the action of β-ketothiolase. In the normal PHBV production process in bacteria, propionate is added as the direct precursor of propionyl-CoA. Therefore, most attempts aimed at producing PHBV copolymer or increasing the 3HV fraction in the copolymer were based on the strategies of propionate utilization (8, 11, 20, 33). However, during PHBV production, propionate must be fed at relatively low concentrations because of its high toxicity to cells (37). In addition, many bacteria showed poor 3HV yields from substrate propionate (Y_3HV/Prop) (32). The overexpression of propionyl-CoA synthetase (encoded by prpE) in recombinant Salmonella enterica or Escherichia coli improved the 3HV fraction in the copolymer up to 25 mol% (1, 40). Besides the uptake limitation of propionate, the endogenous catabolism of propionyl-CoA is also a limiting factor for producing PHBV with a high 3HV fraction. The methyl citric acid cycle (MCC) and the methylmalonyl-CoA pathway, respectively (Fig. 1), were thought to be the major alternative pathways initiating complete oxidation of propionate through propionyl-CoA in aerobic bacteria (37). Knocking out any one of the routes should increase the 3HV fraction in the copolymer. A methylcitrate synthase mutant strain of Burkholderia sacchari accumulated PHBV copolymer with a higher 3HV fraction than its parent when it was co-fed with propionate (6, 32).

In a previous study, researchers found that PHBV could be produced from propionate-independent substrates by Ralstonia eutropha and recombinant E. coli (10, 38). However, the 3HV fraction in the copolymer is very low. In recombinant E. coli, only a 4% 3HV fraction was obtained in the copolymer even when threonine was added to the medium. Recently, Aldor et al. constructed a novel propionate-independent pathway in a recombinant Salmonella enterica serovar Typhimurium strain (2). A methylmalonyl-CoA mutase and a methylmalonyl-CoA decarboxylase gene from E. coli were cloned in S. enterica, by which the recombinant strain converted succinyl-CoA that derived from the tricarboxylic acid (TCA) cycle to propionyl-CoA. The engineered S. enterica strain was able to accumulate PHBV with a 30 mol% 3HV fraction in the copolymer. However, these processes required the addition of additional expensive amino acids or cyanocobalamin (CN-B₁₂) in the medium.

The only reported wild-type bacteria which can naturally synthesize PHBV from unrelated carbon sources like glucose are various species belonging to the Gram-positive genera Nocardia or Rhodococcus (4, 5, 14). The production of PHBV by the Gram-positive bacteria is not feasible from an economic point of view due to the difficulty of PHBV purification, which is caused by the accumulation of triacylglycerols in these strains (3). Escherichia coli, as the best-known bacteria, is an ideal host for the production of PHA for reasons that include easier purification and the absence of an intracellular depolymerization system, as well as well-understood genetics and biochemistry (25, 26). In addition, high-cell-density cultivation strategies are well established for numerous E. coli strains (23, 31). In this study, we constructed a PHBV biosynthesis pathway from single unrelated carbon sources via the threonine biosynthesis pathway in E. coli DH5α. To improve the 3HV fraction in the copolymer, we (i) overexpressed threonine deaminase, which is the key factor for providing the propionyl-CoA, from different sources, (ii) removed the feedback inhibition by mutating and overexpressing the thrABC operon in E. coli, and (iii) knocked out the competitive pathways of catalytic propionyl-CoA to 3-hydroxyvaleryl-CoA.

MATERIALS AND METHODS

Bacterial strains and plasmids.

The E. coli strains and plasmids used in this study are listed in Table 1. All genetic techniques for DNA manipulation were performed according to the references given except where otherwise stated (29). Plasmid isolation and DNA purification kits were purchased from Omega (Shanghai, China). Restriction enzymes were provided by MBI Fermentas (Vilnius, Lithuania). All designated primers used for PCR are listed in Table 2. PCR was performed using an S1000 Thermal cycler (Bio-Rad, CA) and PrimeSTAR DNA polymerase (Takara). Gene knockout was performed through the one-step inactivation method as described by Datsenko and Wanner (9) with slight modifications (25).

Table 1.

Strains and plasmids

Strain or plasmid	Relevant description	Source or reference
E. coli strains
MG1655	Strain K-12, F⁻ λ⁻	Laboratory stock
DH5α	F⁻endA1 glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Φ80dlacZΔM15 Δ(lacZYA-argF)U169 hsdR17(r_K⁻ m_K⁺) λ⁻	Laboratory stock
QW100	DH5α derivative, ΔprpC	This study
QW101	DH5α derivative, ΔscpC	This study
QW102	DH5α derivative, ΔprpC ΔscpC	This study
QW103	DH5α derivative, ΔprpC ΔscpC Δpta	This study
Plasmids
pBHR68	pBluescript II SK⁻ derivative with phbC and phbAB genes from Ralstonia eutropha	35
pBBR1MCS-2	lacPOZ mobRP4, low-copy-no. cloning vector, Kn^r	19
pBBR-livA_EC	pBBR1MCS-2 derivative with ilvA gene from E. coli	This study
pBBR-livA_BS	pBBR1MCS-2 derivative with ilvA gene from B. subtilis	This study
pBBR-livA_CG	pBBR1MCS-2 derivative with ilvA gene from C. glutamicum	This study
pHB-livA_CG	pBHR68 derivative with ilvA gene from C. glutamicum with trc promoter after phbCAB operon	This study
pCL1920	Low-copy-no. cloning vector, Spc^r	24
pCL-thrABC	pCL1920 derivative with thrA(C1034T ) and thrBC genes from E. coli with a stronger trc promoter	This study

Open in a new tab

Table 2.

Primers for DNA manipulation

Primer	Sequence
pKD-prpC1	5′-`ACCCATGTCATTAAACCGAAAAAATCTGTGGCACTTTCTGTGTAGGCTGGAGCTGCTTC`-3′
pKD-prpC2	5′-`GCGGTCTTCCGGTCCAACATAATTGGCGGAAGGACGGATATGGGAATTAGCCATGGTCC`-3′
prpC-testF	5′-`GCCCGTAGCCAGGTGAAATA`-3′
prpC-testR	5′-`CGGATGTTGTTGATTTGAGC`-3′
pKD-pta1	5′-`GTGGCCGCTTGCCTGGCAGCCATGAACGGCGTAGAAATCGTGTAGGCTGGAGCTGCTTC`-3′
pKD-pta2	5′-`TTACTGCTGCTGTGCAGACTGAATCGCAGTCAGCGCGATATGGGAATTAGCCATGGTCC`-3′
pta testF	5′-`GTGCCGTGGAGCTTTGACCT`-3′
pta testR	5′-`TTACTGCTGCTGTGCAGACT`-3′
pKD-scpC1	5′-`GCCGCTGACGATGTACTTTCTGACGCCGTAGCTGTTTCCGTGTAGGCTGGAGCTGCTTC`-3′
pKD-scpC2	5′-`TTAACCCAGCATCGAGCCGGTTGCAATTAAATTACGGTGATGGGAATTAGCCATGGTCC`-3′
scpC testF	5′-`ATGGAAACTCAGTGGACAAG`-3′
scpC testR	5′-`TTAACCCAGCATCGAGCCGG`-3′
ilvA-EC1	5′-`GGCAAGCTTAAGGAGAAGCGTGATGGCTGACTCGCAACCCCT`-3′
ilvA-EC2	5′-`GCGGAATTCCTAACCCGCCAAAAAGAACC`-3′
ilvA-BS1	5′-`GGCAAGCTTAAGGAGAAGCGTGATGAAACCGTTGCTTAAAGA`-3′
ilvA-BS2	5′-`GCGGAATTCTTAGATTAGCAAATGGAACA`-3′
ilvA-CG1	5′-`GGCAAGCTTAAGGAGAAGCGTGATGAGTGAAACATACGTGTC`-3′
ilvA-CG2	5′-`GCGGAATTCTTAGGTCAAGTATTCGTACT`-3′
thrA1	5′-`ACGCATGCATCGAGTGTTGAAGTTCGGCGGTA`-3′
thrA2	5′-`GATTGCGTAATCAGCACCACGAAAATACGGGCGCGTGACATCG`-3′
thrA3	5′-`CGATGTCACGCGCCCGTATTTTCGTGGTGCTGATTACGCAATC`-3′
thrA4	5′-`CACGCTCGAGTCAGACTCCTAACTTCCATGAG`-3′
thrB-1	5′-`ATTCTCGAGATGGTTAAAGTTTATGCCCCG`-3′
thrC-2	5′-`GCTCCGCGGTTACTGATGATTCATCATCAATT`-3′
ilvA-PHB1	5′-`ATTAAGCTTTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGGAAACAGAATGCATATGAGTGAAACATACGTG`-3′
ilvA-PHB2	5′-`ATTCTCGAGTTAGGTCAAGTATTCGTACTCAGGG`-3′

Open in a new tab

To construct plasmids pBBR-ilvA_EC, pBBR-ilvA_CG, and pBBR-ilvA_BS, the ilvA genes from E. coli, Corynebacterium glutamicum, and Bacillus subtilis were amplified from the respective genome DNA and ligated into the vector pBBR1MCS-2. To construct plasmid pHB-ilvA_CG, a DNA fragment containing the trc promoter and the ilvA gene was amplified with primers ilvA-PHB1 and ilvA-PHB2 using the genomic DNA of C. glutamicum as a template. The PCR product was digested with HindIII/XhoI, cloned into pBHR68, and digested with the same restriction enzymes.

A mutant thrA gene [thrA(C1034T)] of E. coli MG1655 was generated as follows. The point mutant at base 1034 was introduced into primer thrA2 by substitution of A for G and primer thrA3 by substitution of T for C, and then, two PCR fragments were amplified, respectively, from the genomic DNA using primers thrA1/thrA2 and thrA3/thrA4, and the two PCR products were joined by a crossover PCR method (17) using primers thrA1 and thrA4 to generate thrA(C1034T). Finally, the resulting amplicon was digested with NsiI/SacII and ligated into the same site of the pCL1920 vector to obtain pCL-thrA. The thrB gene was amplified along with the thrC gene using primers thrB-1 and thrC-2. Then, the PCR product was digested and subcloned into the SacII/XhoI site of pCL-thrA to generate pCL-thrABC.

Culture media and experimental design.

E. coli was cultivated on Luria-Bertani (10 g/liter NaCl, 5 g/liter yeast extract, and 10 g/liter tryptone) agar plates or in Luria-Bertani broth at 37°C. Ampicillin (100 mg/liter), kanamycin (50 mg/liter), or spectinomycin (50 mg/liter) was added to the medium when necessary.

For PHBV production, modified M9 medium was selected. An amount of 20 g/liter glucose or 20 g/liter xylose was added as the carbon source except where otherwise indicated. The modified M9 medium contained (per liter) 17.1 g Na₂HPO₄·12H₂O, 3 g KH₂PO₄, 1 g NH₄Cl, 0.5 g NaCl, 2 mM MgSO₄, 0.1 mM CaCl₂, and 2 g yeast extract.

Shaken-flask cultivation was carried out in a 250-ml flask containing 50 ml of modified M9 medium in a incubator at 37°C. Isopropyl-β-d-thiogalactopyranoside (IPTG) was added at a final concentration of 0.4 mM when the culture reached an optical density at 600 nm (OD₆₀₀) of 0.8. Propionate, 2-ketobutyrate, or various amino acids were added into the culture when necessary.

Analytical procedures.

Optical density was measured at 600 nm with a spectrophotometer (Thermo Electron, United States).

PHBV copolymer was quantified by gas chromatography (GC). Cells were harvested by centrifugation at 10,000 × g for 3 min. The cell pellets were washed with distilled water and then lyophilized for 24 h. Before GC analysis, 1 ml chloroform, 850 μl methanol, and 150 μl sulfuric acid (98%, wt/wt) were added to the weighed cells. The vials were incubated at 100°C for 1 h. Then, 1 ml water was added to the cool vials. After phage separation, the heavier chloroform phase was transferred to another new vial for GC analysis. The GC detection process was performed according to the method of Matthew S. Wong (40).

For analyzing the extracellular metabolites, 1 ml of culture was centrifuged (10,000 × g for 2 min at 4°C) and the supernatant was then filtered through a 0.22-μm syringe filter for high-performance liquid chromatography (HPLC) analysis. Glucose, xylose, acetate, propionate, and 2-ketobutyrate were measured on a ion exchange column (HPX-87H; Bio-Rad Labs) with a differential refractive index (RI) detector (Shimadzu RID-10A). A 0.5-ml/min mobile phase using 5 mM H₂SO₄ solution was applied to the column. The column was operated at 65°C (18). For analysis of amino acids, the supernatant obtained by centrifugation was pre-column derived as follows. Two-hundred-microliter samples of supernatant, 100 μl phenyl isothiocyanate (PITC) and 100 μl triethylamine (TEA) from a Venusil AA analysis kit were added to a 1.5-ml microcentrifuge tube. Four hundred microliters of n-hexane was added to the tube when it was placed at room temperature for 1 h. After phage separation, the heavier phase (PTC-AA) was measured by HPLC with a UV detector (Shimadzu SPD-10A) according to the directions in the Venusil AA analysis kit.

RESULTS

Production of PHBV in recombinant E. coli.

To investigate the production of PHBV in recombinant E. coli, the plasmid pBHR68, which contains the key PHBV biosynthetic genes, was introduced into E. coli DH5α. The resulting strain was then cultivated in modified M9 medium containing glucose in addition to propionate (Fig. 2 A). When supplied with 1 g/liter propionate in the medium, the recombinant E. coli DH5α/pBHR68 accumulated 29.5% cell dry weight PHBV, with up to a 4.56 mol% 3HV fraction in the copolymer. By determining the metabolites in the cultivation broth, we found that the propionate concentration in the medium was at first decreased and then increased during the late exponential phase of cultivation. Further studies confirmed that the 3HV fraction was mainly accumulated at the initial stage of cultivation (data not shown). This result suggested that the transformation of propionate to propionyl-CoA happened mainly at the initial stages of growth or that, at a late stage, the diversion of propionyl-CoA to the other pathways was more active than the diversion to 3-hydroxyvaleryl-CoA.

Fig. 2. — Production of PHBV from recombinant *E. coli* DH5α/pBHR68 in medium supplemented with 20 g/liter glucose and 1 g/liter propionate (A) or 20 g/liter glucose (B). ■, cell growth (OD₆₀₀); ○, glucose concentration; ▲, propionate concentration. Error bars show standard deviations.

To increase the 3HV fraction in the copolymer, the catalytic pathways of propionyl-CoA must be downregulated. In addition, we also found that recombinant E. coli DH5α/pBHR68 produced PHBV with a small amount of the 3HV fraction, even when it was not supplied with the precursor substrate propionate (Fig. 2B). These data suggest that propionyl-CoA and/or propionate can be generated from glucose through certain metabolic pathways in vivo.

Analysis of the primary propionyl-CoA source in recombinant E. coli.

After exploring possible metabolic pathways leading to the formation of propionyl-CoA from glucose in E. coli (37), we presumed that propionyl-CoA could be derived from amino acids. To determine which amino acid was involved in the biosynthetic pathway, we tried supplementing the medium with several amino acids (Table 3). The addition of threonine in the medium improved the 3HV fraction in the copolymer, while the addition of other amino acids did not. In further studies, 2-ketobutyrate, the deamination product of threonine, was added to the medium and resulted in a significantly increased 3HV fraction, proving that the propionyl-CoA in recombinant E. coli was mainly derived from threonine (Table 3). These results suggested that the production of PHBV from an unrelated carbon source in recombinant E. coli is feasible. In addition, the significant increase of the 3HV fraction in the copolymer by the addition of 2-ketobutyrate to the medium also suggested that the deamination of threonine is the rate-limiting step in the formation of propionyl-CoA in E. coli and that the provision of 2-ketobutyrate in vivo can increase the 3HV fraction in the copolymer.

Table 3.

PHBV accumulation in the presence of different amino acids and 2-ketobutyrate

Supplement^a	PHBV content (wt% ± SD)	3HV fraction (mol% ± SD)
None^b	31.30 ± 2.62	0.35 ± 0.07
Methionine	33.08 ± 2.91	0.27 ± 0.08
Valine	33.97 ± 2.36	0.39 ± 0.06
Leucine	34.02 ± 1.43	0.31 ± 0.11
Isoleucine	33.69 ± 2.17	0.34 ± 0.05
Threonine	33.27 ± 3.23	0.73 ± 0.09
2-Ketobutyrate	32.11 ± 2.56	4.45 ± 0.13

Open in a new tab

Amino acids and 2-ketobutyrate were added at the same final concentration of 4 mM.

No amino acid was supplemented.

Production of PHBV in recombinant E. coli from unrelated carbon sources.

Since threonine deamination is the key process in the formation of propionyl-CoA, the production of PHBV with a high 3HV fraction from unrelated carbon sources needs to overexpress this enzyme. Previous reports suggested that the threonine deaminases from Bacillus subtilis and Corynebacterium glutamicum exhibited enzyme activities that were competitive with the activity of the enzyme from E. coli (7, 41). Therefore, these two enzymes in addition to that from E. coli were selected as the candidates to compare the efficiencies of deamination of threonine. We overexpressed the three ilvA genes independently and introduced these into E. coli organisms harboring the plasmid pBHR68.

The cultivation results showed that overexpression of ilvA from C. glutamicum increased the 3HV fraction in the copolymer from 0.43 mol% to 5.09 mol%; however, overexpression of ilvA from E. coli or B. subtilis only increased the 3HV fractions in the copolymer to 0.99 mol% and 2.39 mol%, respectively (Fig. 3). Furthermore, strains overexpressing ilvA had the same cell concentration, of approximately 6 g/liter, which was higher than that of the control strain (5.4 g/liter). It is possible that E. coli overexpressing ilvA produced more valine, leucine, and isoleucine, which could improve the growth of E. coli. Therefore, ilvA from C. glutamicum was selected for further experiments.

Fig. 3. — Comparison of PHBV production in recombinant *E. coli* DH5α/pBHR68 expressing *ilvA* from different bacteria. Threonine was added to a final concentration of 4 mM. Control, no *ilvA* was overexpressed; *ilvA*_EC, recombinant *E. coli* expressing the *ilvA* from *E. coli*; *ilvA*_BS, recombinant *E. coli* expressing the *ilvA* from *B. subtilis*; *ilvA*_CG, recombinant *E. coli* expressing the *ilvA* from *C. glutamicum.* Error bars show standard deviations. CDW, cell dry weight.

The rapid conversion of threonine to 2-ketobutyrate requires the availability of threonine. To increase the production of threonine in E. coli, we overexpressed the thrABC operon, which contains three genes encoding a subunit of aspartate kinase, a subunit of homoserine kinase, and a threonine synthase. Based on the previous studies, aspartate kinase is inhibited by threonine (21). As such, we mutated base C1034 to T (Ser345Phe) in the thrA gene to prevent threonine feedback inhibitions. By overexpressing the mutated thrABC operon, E. coli DH5α/pCL-thrABC accumulated 1.13 mM threonine when it was cultivated in modified M9 medium supplemented with glucose for 24 h, while E. coli DH5α accumulated a very low level of threonine after the same cultivation time (Fig. 4 A). As shown in Fig. 1, the transportation and phosphorylation of glucose consumes 50% more available phosphoenolpyruvate (PEP) through the phosphoenolpyruvate-sugar phosphotransport system (PTS). In addition, the precursor of propionyl-CoA, threonine, is synthesized from oxaloacetate, which is also PEP derived. Therefore, using glucose as the carbon source, E. coli will produce less threonine and, thus, less propionyl-CoA for PHBV production. Xylose, on the other hand, is transported through the xylFGH transport system, which is ATP dependent (34). Using xylose as the carbon source, E. coli consumes no PEP for xylose transportation and, therefore, provides more threonine and propionyl-CoA for PHBV accumulation. To increase the production of threonine in recombinant E. coli, we used xylose as the carbon source. As expected, the accumulation of threonine reached 2.66 mM at 24 h when xylose was used as the carbon source. Furthermore, E. coli DH5α/pCL-thrABC/pBHR68 was able to produce 38.1 weight percent (wt%) PHBV with a 1.12 mol% 3HV fraction from glucose, while this strain produced 36.3 wt% PHBV with a 2.12 mol% 3HV fraction from xylose (Fig. 4B). Therefore, the following experiments were performed using xylose as the carbon source.

Fig. 4. — Performance of *E. coli* expressing mutated *thrABC* operon. (A) Threonine accumulation profiles in *E. coli* cultivated as follows: ■, *E. coli* DH5α supplemented with glucose as carbon source; ▲, *E. coli* DH5α supplemented with xylose as carbon source; ○, *E. coli* DH5α/pCL-thrABC supplemented with glucose as carbon source; ☆, *E. coli* DH5α/pCL-thrABC supplemented with xylose as carbon source. (B) PHBV accumulation after 48 h of incubation as follows: G0, *E. coli* DH5α/pBHR68 supplemented with glucose as carbon source; X0, *E. coli* DH5α/pBHR68 supplemented with xylose as carbon source; GT, *E. coli* DH5α/pBHR68/pCL-thrABC supplemented with glucose as carbon source; XT, *E. coli* DH5α/pBHR68/pCL-thrABC supplemented with xylose as carbon source. Error bars show standard deviations.

Blockage of endogenous propionyl-CoA catabolism.

Propionyl-CoA is the most important precursor responsible for the formation of the 3HV fraction in the copolymer. To provide a large pool of propionyl-CoA for 3HV fraction biosynthesis, metabolic pathways that divert the propionyl-CoA to many other end products need to be inhibited (Fig. 1). The methylcitrate cycle (MCC) pathway was considered the major pathway that allowed E. coli to use propionate as the sole carbon and energy source (16, 22). The prpC gene, which encodes a methylcitrate synthase, catalyzes the conversion of propionyl-CoA to methylcitrate. Therefore, we deleted prpC to increase the propionyl-CoA supply. However, the deletion of this gene did not significantly improve the 3HV fraction in the copolymer (Fig. 5). Mutant QW100 that harbors the necessary genes only accumulated PHBV with a 6.88 mol% 3HV fraction from xylose, which is similar to the amount in wild-type E. coli harboring the necessary genes. Next, we tried deleting another gene, scpC.

Fig. 5. — PHBV production of *E. coli* DH5α and its mutants harboring pHB-ilvA_CG and pCL-thrABC with xylose as carbon source. See Table 1 for genotypes. DH5α, *E. coli* DH5α/pHB-ilvA_CG/pCL-thrABC; QW100, *E. coli* QW100/pHB-ilvA_CG/pCL-thrABC; QW101, *E. coli* QW101/pHB-ilvA_CG/pCL-thrABC; QW102, *E. coli* QW102/pHB-ilvA_CG/pCL-thrABC; QW103, *E. coli* QW103/pHB-ilvA_CG/pCL-thrABC. Error bars show standard deviations.

Propionyl-CoA:succinyl-CoA transferase, encoded by scpC, catalyzes the reaction converting propionyl-CoA into succinyl-CoA, which is an intermediate of the central metabolism (2, 13). The deletion of scpC improved the 3HV fraction in the copolymer significantly. Mutant QW101/pHB-ilvA_CG/pCL-thrABC accumulated the PHBV copolymer with up to a 9.98 mol% 3HV fraction (Fig. 5).The double deletion of scpC and prpC allowed the mutant strain QW102 with the same plasmids to accumulate PHBV copolymer to a 16.78 mol% 3HV fraction. Phosphate acetyltransferase (encoded by pta) catalyzes both acetyl-CoA and propionyl-CoA to acetate and propionate, respectively (15). This process was thought to be responsible for propionate accumulation in the late stage of cell growth. To reduce the propionate formation, pta was deleted in mutant QW102. As expected, no propionate was detected in the culture at the late stage of growth. However, the deletion of pta did not significantly increase the 3HV content in the copolymer. Mutant QW103/pHB-ilvA_CG/pCL-thrABC produced PHBV copolymer with a 17.5 mol% 3HV fraction.

DISCUSSION

The physical and mechanical properties of PHBV depend on the 3HV content in the copolymer (2). Therefore, to obtain bioplastics suitable for actual applications, it is important to be able to produce PHBV with the desired 3HV composition. Previous efforts have focused on manipulation of the PHBV copolymer compositions by the addition of external cosubstrates (8, 33, 40). However, due to the prohibitively high price of propionate, which is the direct precursor of propionyl-CoA, the production of PHBV by this strategy was more expensive than that of the homopolymer PHB. Therefore, a more economical alternative is to produce PHBV from an inexpensive, unrelated carbon source. Based on analysis of the PHBV production pathways, we found it possible to produce PHBV with a high 3HV fraction from unrelated carbon sources through the threonine biosynthetic pathway.

An early study of PHBV production in recombinant E. coli through the threonine pathway yielded a very low 3HV fraction in the polymer unless exogenous amino acid was fed (10). As an alternative, a new pathway for PHBV production has been established in recombinant Salmonella enterica serovar Typhimurium by expressing the pathway that converts succinyl-CoA to propionyl-CoA (2). However, expensive cyanocobalamin (CN-B₁₂) has to be supplemented in the medium to provide the precursor for coenzyme B₁₂. In this study, we engineered E. coli to produce PHBV with up to a 17.5 mol% 3HV fraction from an unrelated carbon source via the threonine biosynthetic pathway without adding any cofactors. Coincidentally, a recent study also indicated that propionyl-CoA could be accumulated through the threonine biosynthetic pathway (39). In this study, the authors attempted to increase the concentration of threonine, the key intermediate of propionyl-CoA, in E. coli. However, based on our experimental data, the limiting step of propionyl-CoA formation was threonine deamination.

The overexpression of ilvA effectively draws carbon flux toward the synthesis of 2-ketobutyrate under aerobic conditions (27). Therefore, we first overexpressed native ilvA from E. coli (ilvA_EC). The overexpression of ilvA_EC resulted in PHBV production with a 2-fold increase in the 3HV fraction in the copolymer. To further improve the deamination efficiency, we overexpressed the threonine deaminases from other bacteria and found that overexpression of ilvA from C. glutamicum (ilvA_CG) could improve the 3HV fraction in the copolymer >10-fold, from 0.43 mol% to 5.09 mol%.

A large intracellular pool of propionyl-CoA may lead to a significantly higher 3HV fraction in the copolymer. To inhibit the endogenous propionyl-CoA catabolism, we deleted the metabolic pathways diverted to the MCC cycle and/or the TCA cycle (Fig. 1). Unexpectedly, deletion of the prpC gene did not significantly increase the 3HV fraction, while deletion of the scpC gene significantly increased the 3HV fraction in the copolymer. This result suggested that the metabolic flux from propionyl-CoA to the methylmalonyl-CoA pathway was much higher than that to the MCC cycle in E. coli. Previous studies have shown that prpC mutants from many other bacteria produced PHBV copolymers with a higher 3HV fraction in the presence of propionate (6, 32). The prpC mutant of Salmonella enterica serovar Typhimurium accumulated PHBV with up to a 30 mol% 3HV fraction (2). These results suggested that the metabolic pathway from propionyl-CoA to MCC is more active in these bacteria. To confirm our result, we also cultivated the E. coli mutants QW100/pBHR68 and QW101/pBHR68 in the presence of propionate. We observed the production of a markedly increased 3HV fraction of PHBV, 19.08%, by QW101/pBHR68 compared with that from QW100/pBHR68, 6.63%. This further indicated that propionyl-CoA in E. coli preferentially diverts to the TCA cycle rather than to the MCC cycle.

Through the metabolic engineering of E. coli, we constructed a series of strains and mutants that were able to produce PHBV copolymers with differing monomer compositions from single unrelated carbon sources. The highest 3HV fraction in the copolymer, 17.5 mol%, was obtained with the mutant QW103/pHB-ilvA/pCL-thrABC, which produced 11.1% of PHBV per gram of total cell dry weight, which reached 3.04 g/liter. Overall, the PHBV production via this strategy not only provided PHBV copolymer with different properties at low cost but also avoided a complex control strategy when propionate was co-fed. Further improvement of these host strains should lead to practical application of this technology.

ACKNOWLEDGMENTS

This research was financially supported by a grant from the National Natural Science Foundation of China (no. 30870022) and a grant from the National Basic Research Program of China (no. 2011CB707405).

Footnotes

^†

These two authors contributed equally.

^▿

Published ahead of print on 7 June 2011.

REFERENCES

1. Aldor I., Keasling J. D. 2001. Metabolic engineering of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) composition in recombinant Salmonella enterica serovar Typhimurium. Biotechnol. Bioeng. 76: 108–114 [DOI] [PubMed] [Google Scholar]
2. Aldor I. S., Kim S. W., Prather K. L., Keasling J. D. 2002. Metabolic engineering of a novel propionate-independent pathway for the production of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) in recombinant Salmonella enterica serovar Typhimurium. Appl. Environ. Microbiol. 68: 3848–3854 [DOI] [PMC free article] [PubMed] [Google Scholar]
3. Alvarez H. M., Kalscheuer R., Steinbüchel A. 2000. Accumulation and mobilization of storage lipids by Rhodococcus opacus PD630 and Rhodococcus ruber NCIMB 40126. Appl. Microbiol. Biotechnol. 54: 218–223 [DOI] [PubMed] [Google Scholar]
4. Alvarez H. M., Kalscheuer R., Steinbüchel A. 1997. Accumulation of storage lipids in species of Rhodococcus and Nocardia and effect of inhibitors and polyethylene glycol. Lipid Fett 99: 239–246 [Google Scholar]
5. Anderson J. A., Williams R. D., Dawes A. E., Ewing F. D. 1995. Biosynthesis of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) in Rhodococcus ruber. National Research Council of Canada, Ottawa, ON, Canada [Google Scholar]
6. Brämer C. O., Silva L. F., Gomez J. G., Priefert H., Steinbüchel A. 2002. Identification of the 2-methylcitrate pathway involved in the catabolism of propionate in the polyhydroxyalkanoate-producing strain Burkholderia sacchari IPT101(T) and analysis of a mutant accumulating a copolyester with higher 3-hydroxyvalerate content. Appl. Environ. Microbiol. 68: 271–279 [DOI] [PMC free article] [PubMed] [Google Scholar]
7. Cann A. F., Liao J. C. 2008. Production of 2-methyl-1-butanol in engineered Escherichia coli. Appl. Microbiol. Biotechnol. 81: 89–98 [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Choi J. I., Lee S. Y. 1999. High-level production of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) by fed-batch culture of recombinant Escherichia coli. Appl. Environ. Microbiol. 65: 4363–4368 [DOI] [PMC free article] [PubMed] [Google Scholar]
9. Datsenko K. A., Wanner B. L. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97: 6640–6645 [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Eschenlauer A. C., Stoup S. K., Srienc F., Somers D. A. 1996. Production of heteropolymeric polyhydroxyalkanoate in Escherichia coli from a single carbon source. Int. J. Biol. Macromol. 19: 121–130 [DOI] [PubMed] [Google Scholar]
11. Fidler S., Dennis D. 1992. Polyhydroxyalkanoate production in recombinant Escherichia coli. FEMS Microbiol. Rev. 9: 231–235 [DOI] [PubMed] [Google Scholar]
12. Reference deleted.
13. Haller T., Buckel T., Retey J., Gerlt J. A. 2000. Discovering new enzymes and metabolic pathways: conversion of succinate to propionate by Escherichia coli. Biochemistry 39: 4622–4629 [DOI] [PubMed] [Google Scholar]
14. Haywood G. W., Anderson A. J., Williams D. R., Dawes E. A., Ewing D. F. 1991. Accumulation of a poly(hydroxyalkanoate) copolymer containing primarily 3-hydroxyvalerate from simple carbohydrate substrates by Rhodococcus sp. NCIMB 40126. Int. J. Biol. Macromol. 13: 83–88 [DOI] [PubMed] [Google Scholar]
15. Heßlinger C., Fairhurst S. A., Sawers G. 1998. Novel keto acid formate-lyase and propionate kinase enzymes are components of an anaerobic pathway in Escherichia coli that degrades L-threonine to propionate. Mol. Microbiol. 27: 477–492 [DOI] [PubMed] [Google Scholar]
16. Horswill A. R., Escalante-Semerena J. C. 1997. Propionate catabolism in Salmonella typhimurium LT2: two divergently transcribed units comprise the prp locus at 8.5 centisomes, prpR encodes a member of the sigma-54 family of activators, and the prpBCDE genes constitute an operon. J. Bacteriol. 179: 928–940 [DOI] [PMC free article] [PubMed] [Google Scholar]
17. Horton R. M., Hunt H. D., Ho S. N., Pullen J. K., Pease L. R. 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77: 61–68 [DOI] [PubMed] [Google Scholar]
18. Kang Z., Gao C., Wang Q., Liu H., Qi Q. 2010. A novel strategy for succinate and polyhydroxybutyrate co-production in Escherichia coli. Bioresour. Technol. 101: 7675–7678 [DOI] [PubMed] [Google Scholar]
19. Kovach M. E., et al. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166: 175–176 [DOI] [PubMed] [Google Scholar]
20. Law K. H., et al. 2004. Construction of recombinant Escherichia coli strains for production of poly-(3-hydroxybutyrate-co-3-hydroxyvalerate). Appl. Biochem. Biotechnol. 113-116: 361–372 [PubMed] [Google Scholar]
21. Lee K. H., Park J. H., Kim T. Y., Kim H. U., Lee S. Y. 2007. Systems metabolic engineering of Escherichia coli for L-threonine production. Mol. Syst. Biol. 3: 149. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Lee S. K., Newman J. D., Keasling J. D. 2005. Catabolite repression of the propionate catabolic genes in Escherichia coli and Salmonella enterica: evidence for involvement of the cyclic AMP receptor protein. J. Bacteriol. 187: 2793–2800 [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Lee S. Y. 1996. High cell-density culture of Escherichia coli. Trends Biotechnol. 14: 98–105 [DOI] [PubMed] [Google Scholar]
24. Lerner C. G., Inouye M. 1990. Low copy number plasmids for regulated low-level expression of cloned genes in Escherichia coli with blue/white insert screening capability. Nucleic Acids Res. 18: 4631. [DOI] [PMC free article] [PubMed] [Google Scholar]
25. Li R., Chen Q., Wang P. G., Qi Q. 2007. A novel-designed Escherichia coli for the production of various polyhydroxyalkanoates from inexpensive substrate mixture. Appl. Microbiol. Biotechnol. 75: 1103–1109 [DOI] [PubMed] [Google Scholar]
26. Li R., Zhang H., Qi Q. 2007. The production of polyhydroxyalkanoates in recombinant Escherichia coli. Bioresour. Technol. 98: 2313–2320 [DOI] [PubMed] [Google Scholar]
27. Morbach S., Sahm H., Eggeling L. 1996. l-Isoleucine production with Corynebacterium glutamicum: further flux increase and limitation of export. Appl. Environ. Microbiol. 62: 4345–4351 [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Ren Q., Sierro N., Kellerhals M., Kessler B., Witholt B. 2000. Properties of engineered poly-3-hydroxyalkanoates produced in recombinant Escherichia coli strains. Appl. Environ. Microbiol. 66: 1311–1320 [DOI] [PMC free article] [PubMed] [Google Scholar]
29. Sambrook J., Russell D. W. 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]
30. Shang L., Yim S. C., Park H. G., Chang H. N. 2004. Sequential feeding of glucose and valerate in a fed-batch culture of Ralstonia eutropha for production of poly(hydroxybutyrate-co-hydroxyvalerate) with high 3-hydroxyvalerate fraction. Biotechnol. Prog. 20: 140–144 [DOI] [PubMed] [Google Scholar]
31. Shiloach J., Fass R. 2005. Growing E. coli to high cell density—a historical perspective on method development. Biotechnol. Adv. 23: 345–357 [DOI] [PubMed] [Google Scholar]
32. Silva L. F., Gomez J. G., Oliveira M. S., Torres B. B. 2000. Propionic acid metabolism and poly-3-hydroxybutyrate-co-3-hydroxyvalerate (P3HB-co-3HV) production by Burkholderia sp. J. Biotechnol. 76: 165–174 [DOI] [PubMed] [Google Scholar]
33. Slater S., Gallaher T., Dennis D. 1992. Production of poly-(3-hydroxybutyrate-co-3-hydroxyvalerate) in a recombinant Escherichia coli strain. Appl. Environ. Microbiol. 58: 1089–1094 [DOI] [PMC free article] [PubMed] [Google Scholar]
34. Song S., Park C. 1997. Organization and regulation of the D-xylose operons in Escherichia coli K-12: XylR acts as a transcriptional activator. J. Bacteriol. 179: 7025. [DOI] [PMC free article] [PubMed] [Google Scholar]
35. Spiekermann P., Rehm B. H. A., Kalscheuer R., Baumeister D., Steinbüchel A. 1999. A sensitive, viable-colony staining method using Nile red for direct screening of bacteria that accumulate polyhydroxyalkanoic acids and other lipid storage compounds. Arch. Microbiol. 171: 73–80 [DOI] [PubMed] [Google Scholar]
36. Steinbuchel A., et al. 1995. Considerations on the structure and biochemistry of bacterial polyhydroxyalkanoic acid inclusions. Can. J. Microbiol. 41 (Suppl. 1): 94–105 [DOI] [PubMed] [Google Scholar]
37. Steinbüchel A., Lütke-Eversloh T. 2003. Metabolic engineering and pathway construction for biotechnological production of relevant polyhydroxyalkanoates in microorganisms. Biochem. Eng. J. 16: 81–96 [Google Scholar]
38. Steinbüchel A., Pieper U. 1992. Production of a copolyester of 3-hydroxybutyric acid and 3-hydroxyvaleric acid from single unrelated carbon sources by a mutant of Alcaligenes eutrophus. Appl. Microbiol. Biotechnol. 37: 1–6 [Google Scholar]
39. Tseng H. C., Harwell C. L., Martin C. H., Prather K. L. 2010. Biosynthesis of chiral 3-hydroxyvalerate from single propionate-unrelated carbon sources in metabolically engineered E. coli. Microb. Cell Fact. 9: 96. [DOI] [PMC free article] [PubMed] [Google Scholar]
40. Wong M. S., Causey T. B., Mantzaris N., Bennett G. N., San K. Y. 2008. Engineering poly(3-hydroxybutyrate-co-3-hydroxyvalerate) copolymer composition in E. coli. Biotechnol. Bioeng. 99: 919–928 [DOI] [PubMed] [Google Scholar]
41. Zhang K., Li H., Cho K. M., Liao J. C. 2010. Expanding metabolism for total biosynthesis of the nonnatural amino acid L-homoalanine. Proc. Natl. Acad. Sci. U. S. A. 107: 6234–6239 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B1] 1. Aldor I., Keasling J. D. 2001. Metabolic engineering of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) composition in recombinant Salmonella enterica serovar Typhimurium. Biotechnol. Bioeng. 76: 108–114 [DOI] [PubMed] [Google Scholar]

[B2] 2. Aldor I. S., Kim S. W., Prather K. L., Keasling J. D. 2002. Metabolic engineering of a novel propionate-independent pathway for the production of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) in recombinant Salmonella enterica serovar Typhimurium. Appl. Environ. Microbiol. 68: 3848–3854 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B3] 3. Alvarez H. M., Kalscheuer R., Steinbüchel A. 2000. Accumulation and mobilization of storage lipids by Rhodococcus opacus PD630 and Rhodococcus ruber NCIMB 40126. Appl. Microbiol. Biotechnol. 54: 218–223 [DOI] [PubMed] [Google Scholar]

[B4] 4. Alvarez H. M., Kalscheuer R., Steinbüchel A. 1997. Accumulation of storage lipids in species of Rhodococcus and Nocardia and effect of inhibitors and polyethylene glycol. Lipid Fett 99: 239–246 [Google Scholar]

[B5] 5. Anderson J. A., Williams R. D., Dawes A. E., Ewing F. D. 1995. Biosynthesis of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) in Rhodococcus ruber. National Research Council of Canada, Ottawa, ON, Canada [Google Scholar]

[B6] 6. Brämer C. O., Silva L. F., Gomez J. G., Priefert H., Steinbüchel A. 2002. Identification of the 2-methylcitrate pathway involved in the catabolism of propionate in the polyhydroxyalkanoate-producing strain Burkholderia sacchari IPT101(T) and analysis of a mutant accumulating a copolyester with higher 3-hydroxyvalerate content. Appl. Environ. Microbiol. 68: 271–279 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B7] 7. Cann A. F., Liao J. C. 2008. Production of 2-methyl-1-butanol in engineered Escherichia coli. Appl. Microbiol. Biotechnol. 81: 89–98 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B8] 8. Choi J. I., Lee S. Y. 1999. High-level production of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) by fed-batch culture of recombinant Escherichia coli. Appl. Environ. Microbiol. 65: 4363–4368 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B9] 9. Datsenko K. A., Wanner B. L. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97: 6640–6645 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B10] 10. Eschenlauer A. C., Stoup S. K., Srienc F., Somers D. A. 1996. Production of heteropolymeric polyhydroxyalkanoate in Escherichia coli from a single carbon source. Int. J. Biol. Macromol. 19: 121–130 [DOI] [PubMed] [Google Scholar]

[B11] 11. Fidler S., Dennis D. 1992. Polyhydroxyalkanoate production in recombinant Escherichia coli. FEMS Microbiol. Rev. 9: 231–235 [DOI] [PubMed] [Google Scholar]

[B12] 12. Reference deleted.

[B13] 13. Haller T., Buckel T., Retey J., Gerlt J. A. 2000. Discovering new enzymes and metabolic pathways: conversion of succinate to propionate by Escherichia coli. Biochemistry 39: 4622–4629 [DOI] [PubMed] [Google Scholar]

[B14] 14. Haywood G. W., Anderson A. J., Williams D. R., Dawes E. A., Ewing D. F. 1991. Accumulation of a poly(hydroxyalkanoate) copolymer containing primarily 3-hydroxyvalerate from simple carbohydrate substrates by Rhodococcus sp. NCIMB 40126. Int. J. Biol. Macromol. 13: 83–88 [DOI] [PubMed] [Google Scholar]

[B15] 15. Heßlinger C., Fairhurst S. A., Sawers G. 1998. Novel keto acid formate-lyase and propionate kinase enzymes are components of an anaerobic pathway in Escherichia coli that degrades L-threonine to propionate. Mol. Microbiol. 27: 477–492 [DOI] [PubMed] [Google Scholar]

[B16] 16. Horswill A. R., Escalante-Semerena J. C. 1997. Propionate catabolism in Salmonella typhimurium LT2: two divergently transcribed units comprise the prp locus at 8.5 centisomes, prpR encodes a member of the sigma-54 family of activators, and the prpBCDE genes constitute an operon. J. Bacteriol. 179: 928–940 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B17] 17. Horton R. M., Hunt H. D., Ho S. N., Pullen J. K., Pease L. R. 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77: 61–68 [DOI] [PubMed] [Google Scholar]

[B18] 18. Kang Z., Gao C., Wang Q., Liu H., Qi Q. 2010. A novel strategy for succinate and polyhydroxybutyrate co-production in Escherichia coli. Bioresour. Technol. 101: 7675–7678 [DOI] [PubMed] [Google Scholar]

[B19] 19. Kovach M. E., et al. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes. Gene 166: 175–176 [DOI] [PubMed] [Google Scholar]

[B20] 20. Law K. H., et al. 2004. Construction of recombinant Escherichia coli strains for production of poly-(3-hydroxybutyrate-co-3-hydroxyvalerate). Appl. Biochem. Biotechnol. 113-116: 361–372 [PubMed] [Google Scholar]

[B21] 21. Lee K. H., Park J. H., Kim T. Y., Kim H. U., Lee S. Y. 2007. Systems metabolic engineering of Escherichia coli for L-threonine production. Mol. Syst. Biol. 3: 149. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B22] 22. Lee S. K., Newman J. D., Keasling J. D. 2005. Catabolite repression of the propionate catabolic genes in Escherichia coli and Salmonella enterica: evidence for involvement of the cyclic AMP receptor protein. J. Bacteriol. 187: 2793–2800 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23. Lee S. Y. 1996. High cell-density culture of Escherichia coli. Trends Biotechnol. 14: 98–105 [DOI] [PubMed] [Google Scholar]

[B24] 24. Lerner C. G., Inouye M. 1990. Low copy number plasmids for regulated low-level expression of cloned genes in Escherichia coli with blue/white insert screening capability. Nucleic Acids Res. 18: 4631. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B25] 25. Li R., Chen Q., Wang P. G., Qi Q. 2007. A novel-designed Escherichia coli for the production of various polyhydroxyalkanoates from inexpensive substrate mixture. Appl. Microbiol. Biotechnol. 75: 1103–1109 [DOI] [PubMed] [Google Scholar]

[B26] 26. Li R., Zhang H., Qi Q. 2007. The production of polyhydroxyalkanoates in recombinant Escherichia coli. Bioresour. Technol. 98: 2313–2320 [DOI] [PubMed] [Google Scholar]

[B27] 27. Morbach S., Sahm H., Eggeling L. 1996. l-Isoleucine production with Corynebacterium glutamicum: further flux increase and limitation of export. Appl. Environ. Microbiol. 62: 4345–4351 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28. Ren Q., Sierro N., Kellerhals M., Kessler B., Witholt B. 2000. Properties of engineered poly-3-hydroxyalkanoates produced in recombinant Escherichia coli strains. Appl. Environ. Microbiol. 66: 1311–1320 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B29] 29. Sambrook J., Russell D. W. 2001. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY [Google Scholar]

[B30] 30. Shang L., Yim S. C., Park H. G., Chang H. N. 2004. Sequential feeding of glucose and valerate in a fed-batch culture of Ralstonia eutropha for production of poly(hydroxybutyrate-co-hydroxyvalerate) with high 3-hydroxyvalerate fraction. Biotechnol. Prog. 20: 140–144 [DOI] [PubMed] [Google Scholar]

[B31] 31. Shiloach J., Fass R. 2005. Growing E. coli to high cell density—a historical perspective on method development. Biotechnol. Adv. 23: 345–357 [DOI] [PubMed] [Google Scholar]

[B32] 32. Silva L. F., Gomez J. G., Oliveira M. S., Torres B. B. 2000. Propionic acid metabolism and poly-3-hydroxybutyrate-co-3-hydroxyvalerate (P3HB-co-3HV) production by Burkholderia sp. J. Biotechnol. 76: 165–174 [DOI] [PubMed] [Google Scholar]

[B33] 33. Slater S., Gallaher T., Dennis D. 1992. Production of poly-(3-hydroxybutyrate-co-3-hydroxyvalerate) in a recombinant Escherichia coli strain. Appl. Environ. Microbiol. 58: 1089–1094 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B34] 34. Song S., Park C. 1997. Organization and regulation of the D-xylose operons in Escherichia coli K-12: XylR acts as a transcriptional activator. J. Bacteriol. 179: 7025. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B35] 35. Spiekermann P., Rehm B. H. A., Kalscheuer R., Baumeister D., Steinbüchel A. 1999. A sensitive, viable-colony staining method using Nile red for direct screening of bacteria that accumulate polyhydroxyalkanoic acids and other lipid storage compounds. Arch. Microbiol. 171: 73–80 [DOI] [PubMed] [Google Scholar]

[B36] 36. Steinbuchel A., et al. 1995. Considerations on the structure and biochemistry of bacterial polyhydroxyalkanoic acid inclusions. Can. J. Microbiol. 41 (Suppl. 1): 94–105 [DOI] [PubMed] [Google Scholar]

[B37] 37. Steinbüchel A., Lütke-Eversloh T. 2003. Metabolic engineering and pathway construction for biotechnological production of relevant polyhydroxyalkanoates in microorganisms. Biochem. Eng. J. 16: 81–96 [Google Scholar]

[B38] 38. Steinbüchel A., Pieper U. 1992. Production of a copolyester of 3-hydroxybutyric acid and 3-hydroxyvaleric acid from single unrelated carbon sources by a mutant of Alcaligenes eutrophus. Appl. Microbiol. Biotechnol. 37: 1–6 [Google Scholar]

[B39] 39. Tseng H. C., Harwell C. L., Martin C. H., Prather K. L. 2010. Biosynthesis of chiral 3-hydroxyvalerate from single propionate-unrelated carbon sources in metabolically engineered E. coli. Microb. Cell Fact. 9: 96. [DOI] [PMC free article] [PubMed] [Google Scholar]

[B40] 40. Wong M. S., Causey T. B., Mantzaris N., Bennett G. N., San K. Y. 2008. Engineering poly(3-hydroxybutyrate-co-3-hydroxyvalerate) copolymer composition in E. coli. Biotechnol. Bioeng. 99: 919–928 [DOI] [PubMed] [Google Scholar]

[B41] 41. Zhang K., Li H., Cho K. M., Liao J. C. 2010. Expanding metabolism for total biosynthesis of the nonnatural amino acid L-homoalanine. Proc. Natl. Acad. Sci. U. S. A. 107: 6234–6239 [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

Production in Escherichia coli of Poly(3-Hydroxybutyrate-co-3-Hydroxyvalerate) with Differing Monomer Compositions from Unrelated Carbon Sources ^{^▿}

Quan Chen

Qian Wang

Guoqing Wei

Quanfeng Liang

Qingsheng Qi

Abstract

INTRODUCTION

Fig. 1.