Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2011 Aug;193(15):3702–3709. doi: 10.1128/JB.00284-11

Physiological Roles of the cyAbrB Transcriptional Regulator Pair Sll0822 and Sll0359 in Synechocystis sp. strain PCC 6803 ▿ †

Yuki Yamauchi 1, Yuki Kaniya 1, Yasuko Kaneko 1,2, Yukako Hihara 1,2,*
PMCID: PMC3147526  PMID: 21642457

Abstract

All known cyanobacterial genomes possess multiple copies of genes encoding AbrB-like transcriptional regulators, known as cyAbrBs, which are distinct from those conserved among other bacterial species. In this study, we addressed the physiological roles of Sll0822 and Sll0359, the two cyAbrBs in Synechocystis sp. strain PCC 6803, under nonstress conditions (20 μmol of photons m−2 s−1 in ambient CO2). When the sll0822 gene was disrupted, the expression levels of nitrogen-related genes such as urtA, amt1, and glnB significantly decreased compared with those in the wild-type cells. Possibly due to the increase of the cellular carbon/nitrogen ratio in the sll0822-disrupted cells, a decrease in pigment contents, downregulation of carbon-uptake related genes, and aberrant accumulation of glycogen took place. Moreover, the mutant exhibited the decrease in the expression level of cytokinesis-related genes such as ftsZ and ftsQ, resulting in the defect in cell division and significant increase in cell size. The pleiotrophic phenotype of the mutant was efficiently suppressed by the introduction of Sll0822 and also partially suppressed by the introduction of Sll0359. When His-tagged cyAbrBs were purified from overexpression strains, Sll0359 and Sll0822 were copurified with each other. The cyAbrBs in Synechocystis sp. strain PCC 6803 seem to interact with each other and regulate carbon and nitrogen metabolism as well as the cell division process under nonstress conditions.

INTRODUCTION

All known cyanobacterial genomes possess multiple copies of genes encoding putative transcriptional regulators having an AbrB-type DNA binding domain. cyAbrBs are structurally different from AbrB-type regulators widely conserved among other bacterial species (4, 25) in that they have a DNA binding domain in the C-terminal region instead of in the usual N-terminal region (9). To date, several research groups have reported the identification of cyAbrBs as binding factors to the upstream region of their target genes. By DNA affinity precipitation assay, Onizuka et al. (17) have identified binding of a cyAbrB to the upstream region of the rbc operon encoding the ribulose-1,5-bisphosphate carboxylase/oxygenase in Synechococcus sp. strain PCC 7002. Similarly, by DNA affinity assay, Oliveira and Lindblad (16) have isolated a cyAbrB as a binding factor to the upstream region of the hox operon encoding the bidirectional NiFe hydrogenase in Synechocystis sp. strain PCC 6803. Shalev-Malul et al. (22) have identified specific binding of a cyAbrB to the intergenic region between aoaA and aoaC encoding biosynthetic enzymes for the hepatotoxin cylindrospermopsin in Aphanizomenon ovalisporum. Furthermore, cyAbrBs have been reported to bind to the upstream regions of nitrogen-regulated genes (9), of sbtA encoding a Na+/HCO3− symporter in Synechocystis sp. strain PCC 6803 (10), of hypC involved in the maturation of hydrogenase (1), of ftsZ encoding a key cell division protein (7), and of sodB encoding iron superoxide dismutase (2) in Nostoc sp. strain PCC 7120. It seems that cyAbrBs are involved in the regulation of many cellular processes in various cyanobacterial species.

Sll0822 in Synechocystis sp. strain PCC 6803 is so far the best-characterized member of the cyAbrB family. We have previously insertionally disrupted the sll0822 gene in order to examine its physiological role (9) and found that the growth rate and the content of photosynthetic pigments of the mutant (Δsll0822) were low under any condition, but the low pigment content could be partially recovered by nitrate supplementation of the medium. DNA microarray and RNA gel blot analyses revealed that the levels of expression of nitrogen-regulated genes such as urtA, amt1, glnB, sigE, and the nrt operon were significantly lowered in a Δsll0822 strain although the induction of these genes upon nitrogen depletion was still observed to some extent. Sll0822 seems to work in parallel with the global nitrogen regulator NtcA to achieve flexible regulation of the nitrogen uptake system. On the other hand, by incubating the same Δsll0822 mutant under high CO2 conditions (5% CO2), Lieman-Hurwitz et al. (10) found that Ci uptake-related genes normally repressed under high CO2 are actively transcribed in the mutant. Consequently, the mutant exhibits an elevated apparent photosynthetic affinity to Ci typically observed in the wild-type (WT) cells only under low-CO2 conditions. These mutant phenotypes suggest that Sll0822 is a crucial regulator for uptake of nitrogen and carbon sources and plays an important role in modulating cellular metabolism.

One important question to be addressed is why multiple copies of the cyAbrB genes exist in every cyanobacterial genome. In most cases, multiple copies in a single organism belong to two distinct clades, namely, clades A and B or marine clades A and B (9). We along with other groups have tried unsuccessfully to obtain completely segregated disruption mutants of clade A cyAbrBs in Synechocystis sp. strain PCC 6803 (9, 16) and in Nostoc sp. strain PCC 7120 (1, 7). This suggests that clade A members are important for cell viability and that their functions cannot be supplied by the remaining clade B members.

In Synechocystis sp. strain PCC 6803, sll0359 and sll0822 belong to clades A and B, respectively. We have observed that the Δsll0822 mutant and the partially segregated sll0359 mutant are similar in that both exhibit a lower growth rate and pigment contents than WT cells (9). This indicates that both Sll0822 and Sll0359 are required for normal cell growth and that their function is not redundant. Lieman-Hurwitz et al. (10) reported that Sll0359, Sll0822, and LexA were isolated together as binding factors to the sbtA promoter. It is possible that Sll0822 and Sll0359 have a regulatory interaction in vivo although the mechanism of transcriptional regulation achieved by them is totally unknown.

In this study, we examined the effect of introduction of Sll0822 or Sll0359 in either the WT or Δsll0822 mutant background in order to clarify the physiological role of the pair of cyAbrBs. The analyses of the mutant background strains revealed that the cyAbrBs work cooperatively to regulate carbon and nitrogen metabolism as well as the cell division process under normal growth conditions. Moreover, copurification experiments indicated direct interaction of Sll0822 and Sll0359 in vivo.

MATERIALS AND METHODS

Strains and culture conditions.

A glucose-tolerant WT strain of Synechocystis sp. strain PCC 6803 was grown at 32°C in BG-11 medium containing 20 mM HEPES-NaOH, pH 7.0, under continuous illumination at 20 μmol of photons m−2 s−1 with bubbling of air. The Δsll0822 mutant, the WT strain expressing His-tagged Sll0822 (WT/His-sll0822), and WT/His-sll0359 were grown under the same conditions, except that 20 μg/ml kanamycin (Km) was added to the medium. In the case of the Δsll0822 His-sll0822 and Δsll0822 His-sll0359 strains, 20 μg/ml Km and 25 μg/ml chloramphenicol (Cm) were added. Cell density was estimated by the optical density at 730 nm (OD730) using a spectrophotometer (model UV-160A; Shimadzu). It should be noted that the correspondence of turbidity and cell number was not the same for different strains. Since WT and Δsll0822 strains differ in cell size, equal OD730 values do not mean equal cell numbers. We determined cell counts by hemocytometer and found that 1 ml of WT culture at an OD730 of 1.0 contains 1.3 ×108 cells, whereas a Δsll0822 strain culture of the same turbidity contains only 3.8 × 107 cells.

Generation of the cyAbrB-expressing strains.

The PCR amplified sll0822 and sll0359 coding sequences were cloned into pET28a vector (Novagen) at the NdeI/BamHI and NdeI/EcoRI sites, respectively. Then, the sll0822 and sll0359 sequences were excised by digestion with XbaI/BamHI and XbaI/EcoRI, respectively, to introduce a His tag at the N-terminal end of the proteins and ligated into pTKP2031V that had been digested with NdeI/HpaI. The vector pTKP2031V, kindly provided by M. Ikeuchi (The University of Tokyo, Japan), is a recombinational plasmid containing a Km resistance cassette and the psbA2 (slr1311) promoter flanked by a part of the coding regions of slr2030 and slr2031 as a platform for homologous recombination. The resulting constructs, pTKP0822 and pTKP0359, were transformed into WT cells to yield the WT/His-sll0822 and WT/His-sll0359 strains, respectively.

In the Δsll0822 strain, a Km resistance cassette was inserted into the coding region of sll0822 at the StyI site (9). In order to transform the Km-resistant Δsll0822 strain, the Km resistance cassette in the pTKP0822 and pTKP0359 constructs was removed by digestion with XbaI and replaced by the Cm resistance cassette. The resulting pTCP0822 and pTCP0359 constructs were transformed into the Δsll0822 strain to yield the Δsll0822 His-sll0822 and Δsll0822 His-sll0359 strains, respectively.

Immunoblot analysis.

Cell cultures at mid-logarithmic phase were harvested by centrifugation. After resuspension in breakage buffer (20 mM Tris-HCl, pH 8.0, 100 mM NaCl), aliquots of cells corresponding to 1 ml of culture at an OD730 of 0.5 were taken, mixed with small amounts of glass beads (diameter 0.1 mm; AsOne BZ-01), and disrupted using a Pellet Pestle Motor (Kontes) twice for 1 min, with each disruption step followed by cooling on ice for 1 min. After addition of SDS sample buffer (62.5 mM Tris-HCl, pH 6.8, 4% SDS, 20% glycerol, 0.01% bromophenol blue), samples were centrifuged at 700 × g for 3 min to remove glass beads and cell debris. Aliquots of supernatants corresponding to 1 ml of culture at an OD730 of 0.05 and an OD730 of 0.1 per lane were loaded onto 15% polyacrylamide gel for the detection of Sll0822 and Sll0359, respectively. After SDS gel electrophoresis and electroblotting onto polyvinylidene difluoride (PVDF) membranes (Immobilon-P; Millipore), samples were probed with a rabbit polyclonal antibody raised against His-Sll0822 or His-Sll0359 recombinant protein. Goat anti-rabbit IgG conjugated to alkaline phosphatase was used as a secondary antibody. The results of the immunoblot analysis were digitized by a scanner, and the band intensity was quantified with Scion Image software (Scion Corporation).

Determination of pigment content.

In vivo absorption spectra of whole cells suspended in BG-11 medium were measured at room temperature using a spectrophotometer (model 557; Hitachi) with an end-on photomultiplier. Chlorophyll content was calculated from the peak heights of absorption spectra using the equations of Arnon et al. (3).

Optical and electron microscopy.

Optical microscopy was performed with a microscope (Eclipse TE2000-U; Nikon) that was equipped with a high-definition image capture camera (DS-5 M; Nikon).

Electron microscopy was performed as described previously (15). In short, cells were pelleted by centrifugation at 1,900 × g for 3 min and then fixed in 2% glutaraldehyde in 0.05 M potassium phosphate buffer, pH 6.8, at room temperature for 2 h and at 4°C overnight. After cells were rinsed in potassium phosphate buffer, they were postfixed in 2% OsO4 in potassium phosphate buffer for 2 h at room temperature, dehydrated in an acetone series, and embedded in Spurr's resin. Ultrathin sections (approximately 90 nm in thickness, estimated from the silver-gold interference color) were cut with a diamond knife on a Sorvall MT2-B ultramicrotome (Sorvall). After samples were stained with uranyl acetate and lead citrate, sections were observed with a Hitachi H-7500 transmission electron microscope (Hitachi) at an accelerating voltage of 100 kV.

Determination of sugar content.

Aliquots of cells corresponding to 1 ml of culture at an OD730 of 1.5 were harvested. The total sugar content of each sample was determined by the method described previously (18). In short, cells were suspended in sulfuric acid solution and boiled for 40 min. Glucose produced by acid hydrolysis was quantified using o-toluidine, following protocols by Sigma Diagnostics (procedure 635; Sigma).

RNA gel blot analysis.

Isolation of RNA by the hot phenol method and RNA gel blot analyses, using a digoxigenin (DIG) RNA labeling and detection kit (Roche), were performed as previously described (14). To generate RNA probes by in vitro transcription, template DNA fragments were prepared by PCR using the following primer pairs: urtA-F (5′-ATGACTAACCCTTTTGGA-3′) and SP6-urtA-R (5′-ATTTAGGTGACACTATAGAATACAGCAACCAATCCACCGCC-3′), amt1-F (5′-GCCCATTTCCAGAAGGAT-3′) and T7-amt1-R (5′-TAATACGACTCACTATAGGGCGAGCCAGGAGGTAAAAGTAG-3′), PglnB-F (5′-AGAGGAAAAGTTTTTCGA-3′) and T7-glnB-R (5′-TAATACGACTCACTATAGGGCGATTAAATAGCTTCGGTATC-3′), sbtA-F (5′-AACGTACGTCACCATCTAGTCCCCA-3′) and SP6-sbtA-R (5′- ATTTAGGTGACACTATAGAATACAGAGCAGCCCA-3′), ftsZ-F (5′-GATTCCCAGGCATTAACT-3′) and T7-ftsZ-R (5′-TAATACGACTCACTATAGGGCGACCGGGGATGATGATAAT-3′), and ftsQ-F (5′-ATGACGGATTTAGTTGTG-3′) and SP6-ftsQ-R (5′-ATTTAGGTGACACTATAGAATACTTAGGGTTTGTTGACGGC-3′). The underlining indicates the T7 polymerase recognition sequence (TAATACGACTCACTATAGGGCGA) or the SP6 polymerase recognition sequence (ATTTAGGTGACACTATAGAATAC) added to the reverse primers in order to use the PCR products directly as templates for in vitro transcription reactions.

Purification of His-tagged cyAbrBs from cyAbrB-expressing strains.

The WT/His-sll0822 or WT/His-sll0359 strain grown in 1.5 liters of BG-11 medium to an OD730 of 0.5 was harvested by centrifugation and resuspended in 4.5 ml of 20 mM phosphate buffer, pH 7.4, containing 0.5 M NaCl and 10 mM imidazole. The cell suspension was divided into five aliquots, each mixed with 3.6 g of zircon beads (diameter 0.1 mm; BioSpec Products) in a 2-ml tube and disrupted with a Mini-Bead Beater (BioSpec) for three pulses of 50 s at 4°C. After removal of the beads and centrifugation at 17,400 × g for 10 min, the supernatant was collected to one tube and filtered through a 0.2-μm-pore-size filter (DISMIC-25cs; Advantec). Then, the filtrate was applied to HiTrap Chelating HP column (Amersham Biosciences) equilibrated with 20 mM phosphate buffer, pH 7.4, containing 0.5 M NaCl and 10 mM imidazole, washed with the same buffer containing 0.5 M NaCl and 60 mM imidazole, and eluted with the same buffer containing 0.5 M NaCl and 300 mM imidazole. Protein composition of each eluate fraction was examined by SDS-PAGE, followed by staining with CBB R-250.

MALDI-TOF MS analysis.

The His-tagged cyAbrB-enriched fraction obtained by nickel affinity chromatography was subjected to 15% SDS-PAGE. Coomassie brilliant blue (CBB)-stained proteins were excised manually from the gels, destained, alkylated, and digested by trypsin as described in Horiuchi et al (8). Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) spectra were acquired with an Autoflex III instrument (Bruker). Protein identification from MALDI-TOF MS spectra was achieved using the MASCOT search engine (Matrix Science).

RESULTS

The accumulation levels of cyAbrBs in cyAbrB-expressing strains.

Sll0822 or Sll0359 having an N-terminal His tag was expressed from a neutral site of the genome (the upstream region of slr2031) of WT or Δsll0822 cells under the control of the strong psbA2 promoter. Figure 1 shows the expression level of Sll0822 and Sll0359 proteins in WT, a WT background Sll0822-expressing strain (WT/His-sll0822), WT background Sll0359-expressing strain (WT/His-sll0359), a Δsll0822 strain, a Sll0822-expressing strain in a Δsll0822 mutant background (Δsll0822 His-sll0822), and a Sll0359-expressing strain in a Δsll0822 mutant background (Δsll0822 His-sll0359). Anti His-Sll0822 antibody detected Sll0822 as a 17.0-kDa band in the WT background but not in Δsll0822 mutant background strains (Fig. 1A). In Sll0822-expressing strains, His-Sll0822 was detected as a 19.0-kDa band. The intensity of the 17.0-kDa band in the WT/His-sll0822 strain was about half of that in the WT, indicating that expression of His-Sll0822 decreases the expression of the endogenous Sll0822. Densitometric analysis of immunoblots revealed that the combined accumulation level of Sll0822 and His-Sll0822 in the WT/His-sll0822 strain was 130% of the Sll0822 level in WT cells. In the Δsll0822 His-sll0822 strain, the accumulation level of His-Sll0822 was 60% of the Sll0822 level in WT cells.

Fig. 1.

Fig. 1.

Expression levels of cyAbrBs in the WT, cyAbrB-expressing WT strains (WT/His-sll0822 and WT/His-sll0359), a Δsll0822 strain, and Δsll0822 mutant background cyAbrB-expressing strains (Δsll0822 His-sll0822 and Δsll0822 His-sll0359 strains) examined by immunoblot analysis. (A) Anti-His-Sll0822 antibody was used to detect Sll0822 and His-Sll0822 in crude extracts of cells corresponding to 1 ml of culture at an OD730 of 0.05. (B) Anti-His-Sll0359 antibody was used to detect Sll0359 and His-Sll0359 in crude extracts of cells corresponding to 1 ml of culture at an OD730 of 0.1. A total of 150 ng of purified cyAbrBs (His-Sll0822 and His-Sll0359) was also loaded. Numerals shown below the figure indicate relative abundance of each cyAbrB calculated from quantified band intensities.

Anti-His-Sll0359 antibody detected Sll0359 and His-Sll0359 as 17.6-kDa and 19.6-kDa bands, respectively (Fig. 1B). This antibody did not cross-react with Sll0822 but recognized His-Sll0822 in WT/His-sll0822 and Δsll0822 His-sll0822 strains as a 19.0-kDa band. The antibody seems to recognize the His tag of His-Sll0822, judging from the fact that it no longer detected Sll0822 protein after treatment with thrombin to remove the His tag (see Fig. S1 in the supplemental material). In Δsll0822 and Δsll0822 His-sll0359 strains, the intensity of the 17.6-kDa band increased to 170% and 150% of that in WT, respectively. This indicates that disruption of sll0822 causes the increase of the endogenous Sll0359. In the WT/His-sll0359 and Δsll0822 His-sll0359 strains, the combined accumulation level of Sll0359 and His-Sll0359 was 190% and 260% of the Sll0359 level in WT cells, respectively. Although the psbA2 promoter is inducible under high-light conditions, incubation of cyAbrB-expressing strains under high-light conditions (200 μmol of photons m−2 s−1) did not cause the further accumulation of His-tagged cyAbrBs (see Fig. S2).

Effects of cyAbrBs on growth, pigment contents, and cell morphology.

Figure 2 shows the growth properties of cyAbrB-expressing strains under normal growth conditions (20 μmol of photons m−2 s−1 in ambient CO2). WT background strains showed similar doubling times of ca. 15 h, irrespective of the expression level of cyAbrBs. Since we could not observe any phenotypic differences among WT background strains, here only the results of the mutant background strains are shown. The Δsll0822 strain exhibited a significantly longer doubling time of 35 h. The growth retardation caused by disruption of sll0822 was almost completely suppressed by introduction of Sll0822 (Δsll0822 His-sll0822 strain) and partially suppressed by introduction of Sll0359 (Δsll0822 His-sll0359 strain). Doubling times during the first 24 h are shown in Table 1.

Fig. 2.

Fig. 2.

Growth properties of WT, the Δsll0822 mutant, and strains expressing cyAbrBs under normal growth conditions (20 μmol of photons m−2 s−1 in ambient CO2). Graphs show growth of the WT (white circles), WT/His-sll0822 (white triangles), WT/His-sll0359 (white squares), the Δsll0822 strain (black circles), the Δsll0822 His-sll0822 (black triangles) strain, and the Δsll0822 His-sll0359 strain (black squares). Data and error bars were calculated from the results of three independent experiments.

Table 1.

Effects of cyAbrBs on the growth rate and the cellular concentration of photosynthetic pigments and glycogena

Strain Doubling time (h) Cellular concn (μg/ml/OD730) of:
Chlorophyll Phycocyanin Glycogen
WT 15.2 ± 1.4 5.49 ± 0.03 42.2 ± 0.6 14.9 ± 1.1
Δsll0822 strain 34.9 ± 3.8 4.35 ± 0.12 30.9 ± 1.4 31.3 ± 3.8
Δsll0822 His-sll0822 strain 16.0 ± 0.8 5.01 ± 0.08 36.3 ± 1.3 16.9 ± 1.9
Δsll0822 His-sll0359 strain 23.8 ± 1.4 4.39 ± 0.19 34.3 ± 0.3 15.6 ± 1.6
a

Cells were grown under normal growth conditions (20 μmol of photons m−2 s−1 in ambient CO2). All values shown are the average of at least three independent measurements.

Chlorophyll and phycocyanin contents per culture volume were calculated from the cellular absorption spectra. The pigment contents divided by the turbidity (mg/ml/OD730), i.e., the relative pigment concentrations of the cells, were lowered to 70 to 80% of that of WT by disruption of Sll0822 (Table 1). The decrease in relative pigment concentration was partially suppressed by the introduction of Sll0822 (Δsll0822 His-sll0822 strain) or Sll0359 (Δsll0822 His-sll0359 strain).

We examined the impact of cyAbrBs on cell morphology by differential interference contrast microscopy (Fig. 3). Unexpectedly, disruption of sll0822 resulted in a significant increase in cell sizes; that is, the diameter of Δsll0822 cells was 1.7 times that of WT cells (Table 2). Furthermore, we noticed that the proportion of dividing cells was notably higher in the Δsll0822 strain than in the WT. When the number of single cells and dividing cells was counted in mid-logarithmic phase cultures, the percentage of dividing cells was around 71% in the Δsll0822 strain as opposed to 32% in the WT (Table 2). Increases in doubling time, cell size, and the proportion of dividing cells suggest that the Δsll0822 strain has a defect in cell division. These phenotypes could be suppressed by introduction of Sll0822 or Sll0359 (Tables 1 and 2, Δsll0822 His-sll0822 and Δsll0822 His-sll0359 strains), indicating that cyAbrBs are indispensable for normal cell division.

Fig. 3.

Fig. 3.

Cell size of WT, Δsll0822 mutant, and cyAbrB-expressing strains examined by differential interference contrast microscopy. Before observation, cultures at mid-logarithmic phase were concentrated by centrifugation at 1,900 × g for 3 min. Scale bar, 5 μm.

Table 2.

Effects of cyAbrBs on cell size and cell divisiona

Strain Cell diam (μm) Percentage of dividing cells (%)b
WT 2.21 ± 0.18 32
Δsll0822 strain 3.82 ± 0.19 71
Δsll0822 His-sll0822 strain 3.13 ± 0.17 32
Δsll0822 His-sll0359 strain 3.26 ± 0.17 56
a

Cells were grown to mid-logarithmic phase under normal growth conditions (20 μmol of photons m−2 s−1 in ambient CO2). The diameters of 50 randomly chosen cells were measured, and at least 75 randomly chosen cells were categorized into single and dividing cells for each strain.

b

The percentage of dividing cells was calculated by dividing the number of dividing cells by the sum of single and dividing cells.

To examine the effect of the lack of Sll0822 on cell morphology in more detail, we examined the ultrastructure of WT and Δsll0822 cells by transmission electron microscopy (Fig. 4). In ultrathin section electron micrographs of both strains, convoluted thylakoid membranes were observed along the cell periphery. It is notable that in Δsll0822 cells the spaces between the thylakoid membranes were filled with numerous glycogen granules. Consistent with this, the relative sugar concentration of Δsll0822 cells was twice that of WT cells (Table 1). Considering that the cellular volume of the Δsll0822 strain was about five times that of the WT, the amount of sugar per cell that accumulated in the Δsll0822 was 10 times greater than that in the WT. The increase in cellular sugar concentration in the Δsll0822 strain was efficiently suppressed by introduction of either Sll0822 (Δsll0822 His-sll0822 strain) or Sll0359 (Δsll0822 His-sll0359 strain) (Table 1).

Fig. 4.

Fig. 4.

Ultrathin-section electron micrographs of WT and Δsll0822 cells. Letters C, G, L, and P indicate carboxysomes, glycogen granules, lipid droplets, and residual holes of polyphosphate bodies, respectively. Magnified images of one cell from the upper panels are shown in the lower panels. Scale bar, 1 μm.

Effects of cyAbrBs on transcript levels of nitrogen-, carbon-, and cytokinesis-related genes.

Sll0822 has been reported to be involved in transcriptional regulation of nitrogen-regulated genes (9) and Ci uptake-related genes (10). We thus examined the effect of expression of Sll0822 or Sll0359 on transcript levels of these target genes by RNA gel blot analysis (Fig. 5). Transcript levels of urtA encoding a subunit of the ATP-binding cassette (ABC)-type urea transporter (24), amt1 encoding a monocomponent ammonium permease (13), glnB encoding nitrogen regulatory protein PII (5), and sbtA encoding a Na+/HCO3− symporter (23) were hardly accumulated in the Δsll0822 strain, whereas complete and partial recovery of transcript levels was observed by introduction of Sll0822 (Δsll0822 His-sll0822 strain) and Sll0359 (Δsll0822 His-sll0359 strain), respectively.

Fig. 5.

Fig. 5.

Gene expression in the WT, Δsll0822 strain, and cyAbrB-expressing strains examined by RNA gel blot analysis. The amounts of total RNA loaded per lane were as follows: 2 μg for urtA, amt1, glnB, sbtA, and ftsZ and 6 μg for ftsQ. For comparison within each RNA blot, total RNA was stained with methylene blue.

Recently, a cyAbrB belonging to clade A, CalA (Alr0946), has been shown to bind to the upstream region of ftsZ in Nostoc sp. strain PCC 7120 (7). FtsZ is a key cytokinetic component that initiates cell division by formation of a septal Z-ring (12). As we had observed that the Δsll0822 strain has a defect in cell division, we suspected that this might be a consequence of aberrant expression of the ftsZ gene. We therefore performed RNA gel blot analysis and found that transcript levels of ftsZ (sll1633) as well as ftsQ (sll1632) located upstream of ftsZ were considerably lower in the Δsll0822 strain and somewhat recovered in the Δsll0822 His-sll0822 strain (Fig. 5). Although ftsZ is located adjacent to ftsQ in the genome, these genes are not likely to be cotranscribed, judging from the lengths of their transcripts. FtsQ is one of the cytokinetic components assembling at the Z-ring (6), and an FtsQ-depleted mutant showed giant morphology in Synechocystis sp. strain PCC 6803 (11). It is plausible that Sll0822 plays a role in the transcriptional regulation of cell division-related genes as well as of genes for nitrogen and carbon metabolism.

Copurification of Sll0822 and Sll0359 from cyAbrB-expressing strains.

In order to isolate proteins interacting with cyAbrBs, His-tagged cyAbrBs were purified from overexpression strains by nickel affinity column chromatography. The eluates were separated by SDS-PAGE and stained with Coomassie brilliant blue (CBB). When His-Sll0822 was purified from the WT/His-sll0822 strain, a minor band of a copurified protein was detected below the His-Sll0822 band (Fig. 6 A). This protein was excised from the gel, digested with trypsin, analyzed by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), and identified as Sll0359. When His-Sll0359 was purified from the WT/His-sll0359 strain, two adjacent bands were detected below the His-Sll0359 band (Fig. 6B). The upper band was identified as Sll0359 by MALDI-TOF MS, whereas identification of the lower band was unsuccessful due to the small amount of the protein. Subsequent tandem mass spectrometry (MS/MS) analysis determined the amino acid sequence of a tryptic digest (m/z = 2316.037) as FYNALMDAQGIDLDSSASGQGRGGR, which corresponds to a partial sequence of Sll0822. The results of these copurification experiments suggest direct interaction of Sll0822 and Sll0359 within Synechocystis cells.

Fig. 6.

Fig. 6.

Copurification of Sll0822 and Sll0359 from cyAbrB-expressing strains. (A) His-Sll0822 and the copurified protein from the WT/His-sll0822 strain. (B) His-Sll0359 and copurified proteins from the WT/His-sll0359 strain. Black and white arrowheads indicate Sll0359 and Sll0822, respectively.

DISCUSSION

Effects of introduction of cyAbrBs.

Immunoblot analysis revealed that the expression level of Sll0822 affects the amount of the endogenous cyAbrBs (Fig. 1). By introduction of His-Sll0822, the amount of endogenous Sll0822 was greatly reduced. This observation together with the fact Sll0822 can bind to its own promoter region (9) suggests negative autoregulation of Sll0822. On the other hand, the amount of Sll0359 protein (Fig. 1), as well as its transcript level (9), increased significantly upon disruption of sll0822. This induction may be a secondary effect since binding of Sll0822 to the promoter region of sll0359 has not been detected (9). The fact that introduction of His-Sll0822 did not affect the amount of Sll0359 (Fig. 1) also implies that direct regulation of Sll0359 by Sll0822 is not likely. In contrast to Sll0822, Sll0359 did not seem to affect the accumulation level of the endogenous cyAbrBs; i.e., the amount of neither Sll0822 nor Sll0359 was changed by introduction of His-Sll0359 (Fig. 1).

Expression of cyAbrBs in the WT background resulted in no significant phenotype in this study. This may be due to the low overexpression level in the case of the WT/His-sll0822 strain (130% of WT level). However, 190% overexpression compared to the WT level was attained in the WT/His-sll0359 strain. Another possible explanation is that cyAbrBs are already abundantly accumulated in WT cells. Unlike other transcriptional regulators, cyAbrBs can be detected as prominent spots in two-dimensional gel electrophoresis of the soluble fraction of Synechocystis sp. strain PCC 6803 (21). We previously reported that the amount of Sll0822 is unchanged under different nitrogen (9) and CO2 conditions (10). It is likely that the activities of cyAbrBs are not modulated by transcriptional or translational regulation but by posttranslational modification (22).

Newly identified phenotypes of the Δsll0822 mutant.

We have previously reported a defect in activation of nitrogen-regulated genes as a characteristic of the Δsll0822 strain (9). In this study, several other important characteristics of the mutant were identified. The microscopic analyses revealed that the diameter of Δsll0822 cells was 1.7 times as large as that of WT cells and that the proportion of dividing cells was notably higher in the mutant culture (Fig. 3 and Table 2). Furthermore, expression levels of genes encoding the cytokinetic components, ftsZ and ftsQ, were shown to be lower in the Δsll0822 strain (Fig. 5). There is a possibility that expression levels of other cytokinesis-related genes are also lower in the mutant. In fact, DNA microarray analysis has previously found that the induction rate of slr0646 and slr0804 encoding class C penicillin-binding proteins (PBPs) was 0.24 ± 0.15 and 0.62 ± 0.16, respectively, upon disruption of Sll0822 (9). Class C PBPs are known to be important for maturation or recycling of the peptidoglycan layer during cell septation (20). It has recently been reported that a double mutant of slr0646 and slr0804 cannot complete septation, thus preventing the separation of daughter cells (11). The failure in upregulation of multiple cytokinesis-related genes may result in a lower growth rate and larger cell size of the Δsll0822 strain than of the WT.

The expression level of sbtA encoding a Na+/HCO3− symporter was lowered in the Δsll0822 mutant (Fig. 5). Previously, Sll0822 has been shown to bind to the promoter region of sbtA to work as a repressor under 5% CO2 conditions. On the other hand, under ambient CO2 conditions, Sll0822 did not bind to the sbtA promoter despite its presence in the cells (10). Thus, under ambient CO2 conditions, the presence or absence of Sll0822 should not affect the expression level of sbtA. However, a decrease in the sbtA transcript level by disruption of Sll0822 was actually observed at ambient CO2 in this study as well as in the previous study (10). We suppose that this decrease in the sbtA transcript level might be due to Sll0822-independent regulation aiding the adjustment of the cellular carbon/nitrogen (C/N) ratio. In the Δsll0822 mutant, failure of the upregulation of genes involved in nitrogen uptake (Fig. 5) may result in constitutive nitrogen deficiency and a high C/N ratio within cells. This notion is strongly supported by the observations that glycogen granules highly accumulated in Δsll0822 cells (Fig. 4) and that the total amount of sugars within cells was 10 times higher in the Δsll0822 strain than in the WT. Under such circumstances, uptake of the carbon source must be downregulated to avoid a further increase of the cellular C/N ratio. These mutant phenotypes suggest the importance of Sll0822 in the maintenance of an appropriate C/N ratio within cells.

The defects in transcriptional regulation caused growth retardation and low pigment contents in the Δsll0822 mutant (Fig. 2 and Table 1). Previously, we had observed that the growth of the Δsll0822 mutant was always slower than that of WT under given light conditions. Supplementation of normal BG-11 medium with a 4-fold excess of nitrate (final concentration, 70.6 mM) did not improve the growth of the mutant. However, pigment contents of the mutant, especially the phycocyanin content, significantly recovered when additional nitrate was supplied (9). The explanation for these observations seems to be that growth retardation is caused by a defect in cell division, whereas low pigment content results from low nitrate uptake.

The relationship between the two cyAbrBs.

The expression of cyAbrBs in the Δsll0822 background provided important data to address the relationship between Sll0822 and Sll0359. The phenotypes of the Δsll0822 mutant, such as growth retardation, low pigment content, high sugar content, defect in cell division, and aberrant gene expression profile, could be suppressed not only by introduction of Sll0822 but also, to some extent, by introduction of Sll0359 (Fig. 2, 3, and 5 and Tables 1 and 2). The extent of suppression by Sll0359 was not always the same. For example, in the Δsll0822 His-sll0359 strain, the transcript levels of nitrogen-related genes were almost the same as in the WT, whereas transcript levels of ftsZ and ftsQ were as low as in the Δsll0822 mutant (Fig. 5). This difference may reflect the extent of the contribution of Sll0359 to regulation of each gene; that is, Sll0359 is most likely involved in activation of nitrogen-related genes together with Sll0822 but may not contribute to the activation of ftsZ and ftsQ.

Interaction of Sll0822 and Sll0359 in vivo was suggested by the copurification of these proteins from the overexpression strains (Fig. 6). When His-Sll0822 was purified from the WT/His-sll0822 strain, a small amount of Sll0359 was copurified. Sll0822 was not copurified in this experiment although most Sll0822 has been shown to exist in a dimeric form in vivo (9, 10). This noncopurification may be due to the decreased amount of the endogenous Sll0822 in the WT/His-sll0822 strain (Fig. 1). In the case of purification of His-Sll0359 from the WT/His-sll0359 strain, in which the amounts of endogenous Sll0359 and Sll0822 are similar (Fig. 1), Sll0359 and a small amount of Sll0822 were detected as copurified proteins (Fig. 6). A bidirectional interaction between Sll0822 and Sll0359 has previously been detected by yeast two-hybrid assay (19). There is thus a possibility that most of these cyAbrBs exist as homodimers in vivo while a smaller amount forms heterodimers that have DNA-binding properties different from those of the homodimers.

Conclusion.

Both Sll0822 and Sll0359 are abundant within cells and may to some extent interact with each other. Sll0822 negatively regulates its own expression while expression of Sll0359 seems to be independent of Sll0822. The cyAbrBs cooperatively activate nitrogen-related genes such as urtA, amt1, and glnB. Without this activation, uptake of nitrogen seems to be inhibited, resulting in an increase in the cellular C/N ratio. The high C/N ratio causes a decrease in pigment content, downregulation of Ci uptake-related genes, and aberrant accumulation of glycogen. Another important role of Sll0822 is the activation of cytokinesis-related genes, such as ftsZ and ftsQ. Without Sll0822, the expression level of cytokinesis-related genes decreases, leading to a defect in cell division and generation of giant cells. Sll0359 may also participate in the regulation of cytokinesis since overexpression of Sll0359 partially suppresses the defect in cell division of the Δsll0822 mutant. In summary, cyAbrBs in Synechocystis sp. strain PCC 6803 interact with each other and regulate the carbon and nitrogen metabolism as well as the cell division process under normal growth conditions. How the relationship of these cyAbrBs changes under different environmental conditions should be further investigated.

Supplementary Material

[Supplemental material]

ACKNOWLEDGMENTS

This work was supported by a Grant-in-Aid for Young Scientists from of the Japan Society for the Promotion of Science (to Y.H.).

We thank Masahiko Ikeuchi (The University of Tokyo, Japan) for providing the plasmid vector pTKP2031V, Takashi Osanai (RIKEN Plant Science Center, Japan) for providing the protocol for determination of sugar content, and Tomohisa Niimi (Comprehensive Analysis Center for Science, Saitama University, Japan) for MALDI-TOF MS analysis.

Footnotes

†

Supplemental material for this article may be found at http://jb.asm.org/.

▿

Published ahead of print on 3 June 2011.

REFERENCES

  • 1. Agervald A., Zhang X., Stensjö K., Devine E., Lindblad P. 2010. CalA, a cyanobacterial AbrB protein, interacts with the upstream region of hypC and acts as a repressor of its transcription in the cyanobacterium Nostoc sp. strain PCC 7120. Appl. Environ. Microbiol. 76:880–890 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Agervald A., et al. 2010. The CyAbrB transcription factor CalA regulates the iron superoxide dismutase in Nostoc sp. strain PCC 7120. Environ. Microbiol. 12:2826–2837 [DOI] [PubMed] [Google Scholar]
  • 3. Arnon D. I., McSwain B. D., Tsujimoto H. Y., Wada K. 1974. Photochemical activity and components of membrane preparations from blue-green algae. I. Coexistence of two photosystems in relation to chlorophyll a and removal of phycocyanin. Biochim. Biophys. Acta 357:231–245 [DOI] [PubMed] [Google Scholar]
  • 4. Coles M., et al. 2005. AbrB-like transcription factors assume a swapped hairpin fold that is evolutionarily related to double-psi beta barrels. Structure 13:919–928 [DOI] [PubMed] [Google Scholar]
  • 5. Forchhammer K. 2004. Global carbon/nitrogen control by PII signal transduction in cyanobacteria: from signals to targets. FEMS Microbiol. Rev. 28:319–333 [DOI] [PubMed] [Google Scholar]
  • 6. Harry E., Monahan L., Thompson L. 2006. Bacterial cell division: the mechanism and its precison. Int. Rev. Cytol. 253:27–94 [DOI] [PubMed] [Google Scholar]
  • 7. He D., Xu X. 2010. CalA, a cyAbrB protein, binds to the upstream region of ftsZ and is down-regulated in heterocysts in Anabaena sp. PCC 7120. Arch. Microbiol. 192:461–469 [DOI] [PubMed] [Google Scholar]
  • 8. Horiuchi M., et al. 2010. The PedR transcriptional regulator interacts with thioredoxin to connect photosynthesis with gene expression in cyanobacteria. Biochem. J. 431:135–140 [DOI] [PubMed] [Google Scholar]
  • 9. Ishii A., Hihara Y. 2008. An AbrB-like transcriptional regulator, Sll0822, is essential for the activation of nitrogen-regulated genes in Synechocystis sp. PCC 6803. Plant Physiol. 148:660–670 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Lieman-Hurwitz J., et al. 2009. A cyanobacterial AbrB-like protein affects the apparent photosynthetic affinity for CO2 by modulating low-CO2-induced gene expression. Environ. Microbiol. 11:927–936 [DOI] [PubMed] [Google Scholar]
  • 11. Marbouty M., Mazouni K., Saguez C., Cassier-Chauvat C., Chauvat F. 2009. Characterization of the Synechocystis strain PCC 6803 penicillin-binding proteins and cytokinetic proteins FtsQ and FtsW and their network of interactions with ZipN. J. Bacteriol. 191:5123–5133 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Mazouni K., Domain F., Cassier-Chauvat C., Chauvat F. 2004. Molecular analysis of the key cytokinetic components of cyanobacteria: FtsZ, ZipN and MinCDE. Mol. Microbiol. 52:1145–1158 [DOI] [PubMed] [Google Scholar]
  • 13. Montesinos M. L., Muro-Pastor A. M., Herrero A., Flores E. 1998. Ammonium/methylammonium permeases of a cyanobacterium. Identification and analysis of three nitrogen-regulated amt genes in Synechocystis sp. PCC 6803. J. Biol. Chem. 273:31463–31470 [DOI] [PubMed] [Google Scholar]
  • 14. Muramatsu M., Hihara Y. 2003. Transcriptional regulation of genes encoding subunits of photosystem I during acclimation to high-light conditions in Synechocystis sp. PCC 6803. Planta 216:446–453 [DOI] [PubMed] [Google Scholar]
  • 15. Nitta K., Nagayama K., Danev R., Kaneko Y. 2009. Visualization of BrdU-labelled DNA in cyanobacterial cells by Hilbert differential contrast transmission electron microscopy. J. Microsc. 234:118–123 [DOI] [PubMed] [Google Scholar]
  • 16. Oliveira P., Lindblad P. 2008. An AbrB-like protein regulates the expression of the bidirectional hydrogenase in Synechocystis sp. strain PCC 6803. J. Bacteriol. 190:1011–1019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Onizuka T., et al. 2002. CO2 response element and corresponding trans-acting factor of the promoter for ribulose-1,5-bisphosphate carboxylase/oxygenase genes in Synechococcus sp. PCC7002 found by an improved electrophoretic mobility shift assay. Plant Cell Physiol. 43:660–667 [DOI] [PubMed] [Google Scholar]
  • 18. Osanai T., Sato S., Tabata S., Tanaka K. 2005. Identification of PamA as a PII-binding membrane protein important in nitrogen-related and sugar-catabolic gene expression in Synechocystis sp. PCC 6803. J. Biol. Chem. 280:34684–34690 [DOI] [PubMed] [Google Scholar]
  • 19. Sato S., et al. 2007. A large-scale protein-protein interaction analysis in Synechocystis sp. PCC6803. DNA Res. 14:207–216 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Sauvage E., Kerff F., Terrak M., Ayala J. A., Charlier P. 2008. The penicillin-binding proteins: structure and role in peptidoglycan biosynthesis. FEMS Microbiol. Rev. 32:234–258 [DOI] [PubMed] [Google Scholar]
  • 21. Sazuka T., Yamaguchi M., Ohara O. 1999. Cyano2Dbase updated: linkage of 234 protein spots to corresponding genes through N-terminal microsequencing. Electrophoresis 20:2160–2171 [DOI] [PubMed] [Google Scholar]
  • 22. Shalev-Malul G., et al. 2008. An AbrB-like protein might be involved in the regulation of cylindrospermopsin production by Aphanizomenon ovalisporum. Environ. Microbiol. 10:988–999 [DOI] [PubMed] [Google Scholar]
  • 23. Shibata M., et al. 2002. Genes essential to sodium-dependent bicarbonate transport in cyanobacteria: function and phylogenetic analysis. J. Biol. Chem. 277:18658–18664 [DOI] [PubMed] [Google Scholar]
  • 24. Valladares A., Montesinos M. L., Herrero A., Flores E. 2002. An ABC-type, high-affinity urea permease identified in cyanobacteria. Mol. Microbiol. 43:703–715 [DOI] [PubMed] [Google Scholar]
  • 25. Vaughn J. L., Feher V., Naylor S., Strauch M. A., Cavanagh J. 2000. Novel DNA binding domain and genetic regulation model of Bacillus subtilis transition state regulator abrB. Nat. Struct. Biol. 7:1139–1146 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]
supp_193_15_3702__1.pdf (224.6KB, pdf)
supp_193_15_3702__2.pdf (200.3KB, pdf)

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES