Skip to main content
PMC home page
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2011 Aug;55(8):3782–3787. doi: 10.1128/AAC.00306-11

Commonality among Fluoroquinolone-Resistant Sequence Type ST131 Extraintestinal Escherichia coli Isolates from Humans and Companion Animals in Australia▿,†

Joanne L Platell 1,*, Rowland N Cobbold 1, James R Johnson 2, Anke Heisig 3, Peter Heisig 3, Connie Clabots 2, Michael A Kuskowski 2, Darren J Trott 1,4
PMCID: PMC3147636  PMID: 21646486

Abstract

Escherichia coli sequence type 131 (ST131), an emergent multidrug-resistant extraintestinal pathogen, has spread epidemically among humans and was recently isolated from companion animals. To assess for human-companion animal commonality among ST131 isolates, 214 fluoroquinolone-resistant extraintestinal E. coli isolates (205 from humans, 9 from companion animals) from diagnostic laboratories in Australia, provisionally identified as ST131 by PCR, selectively underwent PCR-based O typing and blaCTX-M-15 detection. A subset then underwent multilocus sequence typing (MLST), pulsed-field gel electrophoresis (PFGE) analysis, extended virulence genotyping, antimicrobial susceptibility testing, and fluoroquinolone resistance genotyping. All isolates were O25b positive, except for two O16 isolates and one O157 isolate, which (along with six O25b-positive isolates) were confirmed by MLST to be ST131. Only 12% of isolates (25 human, 1 canine) exhibited blaCTX-M-15. PFGE analysis of 20 randomly selected human and all 9 companion animal isolates showed multiple instances of ≥94% profile similarity across host species; 12 isolates (6 human, 6 companion animal) represented pulsotype 968, the most prevalent ST131 pulsotype in North America (representing 23% of a large ST131 reference collection). Virulence gene and antimicrobial resistance profiles differed minimally, without host species specificity. The analyzed ST131 isolates also exhibited a conserved, host species-independent pattern of chromosomal fluoroquinolone resistance mutations. However, eight (89%) companion animal isolates, versus two (10%) human isolates, possessed the plasmid-borne qnrB gene (P < 0.001). This extensive across-species strain commonality, plus the similarities between Australian and non-Australian ST131 isolates, suggest that ST131 isolates are exchanged between humans and companion animals both within Australia and intercontinentally.

INTRODUCTION

Escherichia coli is a major cause of extraintestinal infection in both humans and companion animals (2, 42). Such isolates exhibit resistance to multiple antimicrobial classes, including fluoroquinolones, with increasing frequency worldwide, thus posing a significant treatment challenge to physicians and veterinarians alike.

The virulent E. coli clonal group sequence type 131 (ST131), which is associated with fluoroquinolone resistance and belongs to phylogenetic group B2, has shown recent and rapid global dissemination. This clonal group is an emerging human pathogen in many parts of the world, including continental Europe (3, 33), the United Kingdom (28), Turkey (52), Korea (30), Canada (36, 38), and the United States (18, 19). Its association with blaCTX-M-15, which encodes the CTX-M-15 extended-spectrum β-lactamase (ESBL), has also influenced the recent pandemic spread of extended-spectrum cephalosporin resistance (3, 4, 18, 28, 29, 34, 44).

Recently, ST131 has also been isolated from sporadic cases of extraintestinal infection in companion animals (13, 22, 24, 40). This supports previous evidence that extraintestinal pathogenic E. coli (ExPEC) from humans and companion animals, particularly strains belonging to group B2, share similar virulence genotypes and phylogenetic origins (25, 31).

In a previous study by our group, fluoroquinolone-resistant (FQr) E. coli from extraintestinal infections in humans and companion animals were collected over a 2-year period in Eastern Australia (39). Clonal group ST131 accounted for 35% of human isolates and 7% of companion animal isolates (39). Here, we sought to further characterize these ST131 isolates for a broad range of molecular and phenotypic traits, both to assess for clonal commonality across host species within Australia and to compare these isolates to a broader international collection.

MATERIALS AND METHODS

Bacterial isolates.

As reported elsewhere (39), a collection of 707 FQr clinical extraintestinal E. coli isolates from humans (n = 582) and companion animals (n = 125) from Eastern Australia (October 2007 to October 2008) underwent PCR-based determination of major E. coli phylogenetic group (A, B1, B2, and D) (5). The 263 group B2 isolates (i.e., 250 human and 13 companion animal [12 canine, 1 feline] isolates) were screened for ST131 status by PCR-based detection of ST131-specific single-nucleotide polymorphisms (SNPs) in mdh and gyrB (23). The 214 (205 human, 9 companion animal) thus-identified ST131 isolates (39), which due to the timing and geography of the cases suggested no link among the animal cases, or between animal versus human cases, underwent further characterization here.

Initial characterization of isolates.

The 214 putative ST131 isolates were screened by PCR for the ST131-associated O25b rfb variant (7) and blaCTX-M-15 (6). Isolates that were not type O25b (n = 3) underwent PCR for 12 additional sepsis-associated rfb variants (O1, O2, O4, O6, O7, O12, O15, O16, O18, O25a, O75, and O157) (6). For confirmation of the ST131 status, nine presumptive ST131 isolates, of which six (three human and three canine ST131 isolates) exhibited the O25b rfb variant and three (all human) exhibited unique non-O25b rfb variants, underwent confirmatory multilocus sequence typing (MLST) according to the Achtman system (http://mlst.ucc.ie/mlst/dbs/Ecoli), using DNA sequence analysis of seven housekeeping genes (50). Approximately 10% of human ST131 isolates (20/205; 9.8%) were randomly selected for comparison with all nine companion animal ST131 isolates (eight canine, one feline) according to multiple additional characteristics, determined as described below.

PFGE.

Genomic DNA of the 29 selected ST131 isolates underwent XbaI pulsed-field gel electrophoresis (PFGE) according to a standardized protocol (41). Dice coefficient-based similarity dendrograms were constructed within BioNumerics (Bio-Rad, Applied Maths) according to the unweighted pair group method with arithmetic means. Isolates were considered to represent the same pulsotype if they exhibited ≥94% profile similarity, which corresponds with a ≤3-band overall difference (45). PFGE profiles were compared both within this collection and to an unpublished PFGE reference library comprising 533 E. coli ST131 isolates, obtained from around the world, but mainly the United States and Canada (23; J. R. Johnson, unpublished data [see also Table 2]).

Table 2.

PFGE analysis of 20 human and 9 companion animal E. coli ST131 isolates compared to a large reference librarya

Pulsotype(s)b Present study (n = 29 ST131 isolates)
 Reference library (n = 533 ST131 isolates)c
No. (%) of isolates No. of human isolates (n = 20) No. of animal isolates (n = 9) Rank order in library No. (%) of isolates No. of human isolates Distribution
 No. of animal isolates
Country No.
968 12 (41) 6 5 dogs, 1 cat 1 121 (23) 110 US 94 11d
Canada 14
India 1
Portugal 1
800 4 (14) 4 0 2 77 (14) 77 US 55 0
Canada 20
India 2
812 3 (10) 3 0 3 29 (5) 28 US 24 1d
Canada 1
Spain 2
Portugal 1
905 1 (3) 0 1 dog 4 18 (3) 18 US 14 0
Canada 4
807 1 (3) 1 0 6 6 (1) 6 US 4 0
Canada 2
838 1 (3) 1 0 15 3 (0.6) 3 US 3 0
920 1 (3) 0 1 dog 25 1 (0.2) 1 US 1 0
915 1 (3) 1 0 38 1 (0.2) 1 France 1 0
975 1 (3) 1 0 39 1 (0.2) 1 US 1 0
796, 976, 1110, and 1153 1 (3) each 3 1 doge NA* NA* NA* NA* NA
Open in a new tab
a

The reference library currently comprises 533 ST131 isolates from diverse locales, hosts, and clinical contexts (J. R. Johnson, unpublished data).

b

Pulsotypes are defined at the 94% Dice coefficient similarity level and are labeled sequentially as they are encountered.

c

US, United States. NA*, not applicable (these pulsotypes are represented in the reference library only by isolates from the present study); NA, not applicable (no animal isolates in pulsotype).

d

The listed reference collection animal isolates were from the United States.

e

The dog isolate was pulsotype 1153.

Virulence genotyping.

The 29 selected ST131 isolates were screened by PCR for 53 ExPEC-associated virulence genes and variants (17, 20, 26, 35, 47). Virulence scores were the numbers of virulence genes detected for each isolate. The virulence genotype similarity between two isolates was calculated as the number of shared virulence genes divided by the combined total number of virulence genes.

Susceptibility testing.

All isolates underwent disk diffusion susceptibility testing to enrofloxacin (9), with fluoroquinolone resistance defined as nonsusceptibility. The 29 selected ST131 isolates underwent disk diffusion susceptibility testing to 18 additional antimicrobial agents (amoxicillin-clavulanic acid, ampicillin, aztreonam, cefepime, cefoxitin, ceftazidime, cephalothin, chloramphenicol, ciprofloxacin, gentamicin, imipenem, nitrofurantoin, piperacillin, streptomycin, piperacillin-tazobactam, tetracycline, and trimethoprim-sulfamethoxazole) and determination of broth microdilution MICs for four fluoroquinolones (enrofloxacin, ciprofloxacin, moxifloxacin, and pradofloxacin, a new veterinary fluoroquinolone) (48). The methods and interpretive criteria used were as specified by the Clinical and Laboratory Standards Institute (8, 9), except for pradofloxacin (resistance breakpoint, 2 μg/ml) (14).

Detection of chromosomal fluoroquinolone resistance mutations.

The quinolone resistance-determining region (QRDR) of gyrA, encoding subunit A of DNA gyrase (primary fluoroquinolone target), was screened for resistance mutations by a rapid pyrosequencing-based method using the primers gyrA-5′-+211 (5′-GGTGACGTAATCGGTAAATATCA-3′) and gyrA-3′-+329-biotin (5′-CCGAAGTTACCCTGACCATCTA-3′). The cycling conditions were as follows: 5 min of denaturation at 94°C; 35 cycles of 94°C for 30s, 61°C for 40 s, and 72°C for 45 s; and then 5 min of elongation at 72°C. The resulting 118-bp PCR fragment was analyzed by using the sequencing primer gyrA-5′-+222-EcoMPC-seq (5′-CGGTAAATACCATCCCCA-3′) on a PSQ MA96 Pyrosequencer according to the manufacturer's instructions (Biotage, Uppsala, Sweden). The corresponding region of parC, encoding subunit A of topoisomerase IV (secondary fluoroquinolone target), was amplified and sequenced as described previously (16). SNPs were defined relative to the wild-type E. coli strain (WT).

Detection of plasmid-mediated resistance genes.

The plasmid-mediated quinolone resistance genes qnrA, qnrB, qnrS, and qepA, which encode three target-protecting proteins and an efflux pump, respectively, were screened for by multiplexing existing and novel single PCRs, with a second PCR screen used to identify isolates containing aac(6′)-Ib. The primers and product sizes are listed in Table 1; controls were as described previously (11). PCR conditions were: 5 min of denaturation at 95°C; 30 cycles of 95°C for 30 s, 57°C for 30 s, and 72°C for 50 s; and then 10 min of elongation at 72°C. All aac(6′)-Ib-positive isolates underwent digestion of the PCR product with FokI and NdeI (New England Biolabs, Ipswich, MA) to identify the aac(6′)-Ib-cr variant, which encodes a bifunctional aminoglycoside-fluoroquinolone modifying enzyme (27).

Table 1.

Primers used to detect plasmid-mediated fluoroquinolone resistance genes

Target gene(s) Primer Sequence (5′–3′)a Product size (bp) Source or reference
aac(6′)-lb and aac(6′)-lb-cr aac6 for ATGACTGAGCATGACCTTGC 519 This study
aac6 rev TTAGGCATCACTGCGTGTTC This study
qnrA qnrA for TCAGCAAGAGGATTTCTCA 626 31
qnrA rev GGCAGCACTATGACTCCCA 31
qnrB qnrB for GGCGAAAAAATTTACAGAAA 525 This study
qnrB rev TCYGAATTGGTCARATCRCA This study
qnrS qnrS for TGCAAGTTTCCAACAATGCC 367 This study
qnrS rev GATCTAAACCGTCGAGTTCG This study
qepA qepA for CTTCCTGCCCGAGTATCGTG 217 51
qepA rev GCAGGTCCAGCAGCGGGTAG 51
Open in a new tab
a

IUPAC code: R = A or G; Y = C or T.

Efflux pump activity testing.

Two methods were used to detect efflux pump activity, including MIC testing in the presence of an efflux pump inhibitor and an organic solvent tolerance test. For efflux pump inhibitor testing, broth microdilution susceptibility to the four studied fluoroquinolones was determined in duplicate in the presence or absence of 64 μg of l-phenylalanyl-arginyl-β-naphthylamide (PAβN; Sigma P 4157)/ml (8, 9). For organic solvent tolerance, overnight cultures (ca. ∼109 CFU/ml) of each isolate underwent four 10-fold serial dilutions. Approximately 1-μl portions of the last three dilutions (ca. 105, 106, and 107 CFU/ml) were spotted onto the surface of an LB agar plate and allowed to dry. Then, 15 ml of an organic solvent (hexane, cyclohexane, and hexane-cyclohexane combinations of 3:1, 1:1, and 1:3) was overlaid on the plate to a depth of 2 to 3 mm. The plates were sealed with petroleum jelly and laboratory film, followed by incubation at 30°C for 48 h. Growth was then recorded for each spot as confluent, visible, or absent. Controls included the E. coli strain pairs AG100-AG102 and WT-MIII (16, 49). Organic solvent tolerance was scored as no growth inhibition in the presence of 100% hexane (+), 3:1 hexane-cyclohexane (++), 1:1 hexane-cyclohexane (+++), 1:3 hexane-cyclohexane (++++), or 100% cyclohexane (+++++). Growth inhibition was defined as a reduction in the initial inoculum of the bacterial concentration by at least two 10-fold serial dilutions in the presence of each respective organic solvent.

Statistical analysis.

A Fisher exact test (two-tailed) was used to compare proportions. The Mann-Whitney U test (also two-tailed) was used to compare continuous variables. To simplify the virulence gene and antimicrobial susceptibility data for comparisons of human versus companion animal isolates, principle coordinates analysis (PCoA) was used. PCoA is a multidimensional scaling method that captures within the first two PCoA axes most of the total variance contained in a multivariable, multispecimen data set.

RESULTS

O types, confirmatory MLST, and screening for blaCTX-M-15.

The O25b rfb variant was detected in 211 (98.6%) of the 214 presumptive ST131 isolates, including 202 (98.5%) of the 205 human and all 9 (100%) companion animal isolates. Of the three non-O25b isolates, two were O16, and one was O157 by O-type PCR. However, seven-locus MLST confirmed the ST131 status of these three non-O25b isolates and all six (three human, three companion animal) randomly selected O25b-positive isolates. Of the 214 total isolates, only 12% (25 human, 1 canine) exhibited blaCTX-M-15.

PFGE analysis.

To assess within-clonal group and cross-species genomic commonality at a more highly resolved level, the 29 selected ST131 isolates underwent XbaI PFGE analysis (Table 2 and see also the supplemental material). Although none of the selected isolates were indistinguishable from one another, 19 (66%) exhibited >94% PFGE profile similarity to another isolate in the group and so could be considered clonal (i.e., from a multiple-isolate pulsotype). Three such multiple-isolate pulsotypes were identified (Table 2). First, 12 (6 human, 5 canine, and 1 feline) isolates (41% of 29) exhibited profiles corresponding with reference pulsotype 968, the most common pulsotype (prevalence, 23%) in an unpublished PFGE profile reference library that comprises 533 E. coli ST131 isolates, mainly from the United States (23) (Table 2). An additional four human isolates matched pulsotype 800 (prevalence in reference library, 14%), and three other human isolates matched pulsotype 812 (prevalence in reference library, 5%, including one animal isolate). Six additional isolates (four human, two canine) exhibited profiles that, although representing unique pulsotypes within the present study, matched other reference library pulsotypes (prevalence in library, <3% each). Notably, for these two canine isolates, the same-pulsotype isolates within the reference library included human isolates (Table 2). The remaining four isolates (three human and one canine) each represented a novel pulsotype, i.e., were <94% similar to any study isolate or reference library isolate (Table 2). Thus, eight of nine companion animal isolates represented human-isolate-matching pulsotypes (Table 2), whereas the sole remaining canine isolate represented a novel, single-isolate pulsotype.

Virulence genotypes.

Of the 53 virulence genes sought, 24 (45%) were detected among the 29 selected ST131 isolates. Aggregate virulence scores ranged from 7 to 19 (median, 12); the virulence genotype similarity ranged from 68 to 100%. Six different virulence genes were present in >90% of the 29 isolates: fimH (type I fimbriae, 100%), fyuA (yersiniabactin receptor, 100%), usp (uropathogenic-specific protein, 100%), ompT (outer membrane protease, 97%) malX (pathogenicity island marker, 93%), and iutA (aerobactin receptor, 93%). In addition, present in >75% of isolates were sat (secreted autotransporter toxin, 86%), the F10 papA allele (P fimbria structural subunit variant, 79%), iha (adhesin-siderophore receptor, 79%), and traT (serum resistance associated, 76%). Furthermore, present in >50% of isolates were kpsMII (group 2 capsule, 66%) and kfiC (K5 group 2 capsule variant, 52%). Human and companion animal isolates did not differ appreciably for the prevalence of any individual virulence gene or, according to a PCoA, for aggregate virulence profile (see the supplemental material).

Susceptibility testing.

Disk diffusion susceptibility testing to 19 antimicrobials showed that the 29 selected ST131 isolates were resistant to a median of 8 (range, 3 to 13) agents each (see the supplemental material). All were resistant to ampicillin, and over half, regardless of the host species, were resistant to piperacillin (90%), cephalothin (79%), streptomycin (72%), trimethoprim-sulfamethoxazole (66%), and tetracycline (59%). Human and companion animal isolates did not differ significantly for resistance prevalence for any of the antimicrobials tested. Fluoroquinolone MICs ranged from 0.5 to 128 μg/ml for enrofloxacin (median, 64 μg/ml) and ciprofloxacin (median, 32 μg/ml), 1 to 32 μg/ml for moxifloxacin (median, 16 μg/ml), and 0.25 to 8 μg/ml for pradofloxacin (median, 4 μg/ml) (see the supplemental material). Human and companion animal isolates did not differ significantly for aggregate resistance profiles according to PCoA or fluoroquinolone MICs (see the supplemental material).

Detection of fluoroquinolone resistance-associated mutations in chromosomal genes.

All but 1 of the 29 selected ST131 isolates had the same combination of four SNPs in the QRDRs of gyrA (i.e., TCG to TTG [S83L] and GAC to AAC [D87N]) and parC (i.e., AGT to ATT [S80I] and an atypical GAA to GTA [E84V]) (see the supplemental material). The sole exception (QUC012) had been classified as FQr based on its intermediate enrofloxacin susceptibility by disk diffusion, and yet it (alone among the 29 isolates) displayed full fluoroquinolone susceptibility by broth microdilution (ciprofloxacin MIC, 0.5 μg/ml) and, of the above mutations, exhibited only gyrA S83L. Notably, the 29 ST131 isolates also all exhibited a silent parC SNP, i.e., CAG instead of CAA (codon 91).

Detection of plasmid-mediated resistance genes.

Among the 29 selected ST131 isolates, only 2 of 20 human isolates, versus 8 of 9 companion animal isolates, contained qnrB (P < 0.001). No isolate contained qnrA, qnrS, or qepA. Three human isolates but no companion animal isolates contained aac(6′)-1b-cr (P > 0.05); one of these human isolates also contained qnrB. The presence of qnrB and/or aac(6′)-1b-cr showed no correlation with fluoroquinolone MIC values (see the supplemental material).

Efflux pump activity.

For all 29 selected ST131 isolates, the MICs of enrofloxacin, moxifloxacin, and pradofloxacin exhibited ≥4-fold reductions in the presence of efflux pump inhibitor PAβN, suggesting active efflux pumps. However, only two isolates (one human, one companion animal) exhibited organic solvent tolerance, and this was only low level (i.e., “+”) (see the supplemental material).

DISCUSSION

This study sought to characterize human and companion animal FQr E. coli ST131 isolates obtained from cases of extraintestinal infection in Australia and to identify the degree of commonality across host species strains. We found that most companion animal ST131 strains showed a high degree of relatedness to Australian (and North American) human ST131 strains on the basis of PFGE profile, virulence gene content, fluoroquinolone resistance-associated chromosomal mutations, and antibiogram analyses, evidence suggesting interspecies transmission, in whichever direction. Australian ST131 isolates are of particular interest since fluoroquinolones are an important antimicrobial class that has been used in humans and pets in Australia for over 20 years (1) but was never authorized for use in Australian livestock (10).

E. coli ST131 isolates from around the world have been reported to closely resemble one another genotypically, suggesting rapid, global dissemination. This has been attributed to multiple factors, including direct human-to-human transmission (12), international travel (37), environmental dissemination (43), fecal carriage in livestock (and spread via raw meats) (46), and carriage by domestic (13, 24) or wild (15) animals. Our findings support the concept that companion animals probably participate in the dissemination of ST131 strains of human relevance.

Interestingly, our findings show that most of the studied companion animal and human ST131 isolates belong to pulsotypes present within an international ST131 strain collection, including a predominantly CTX-M-15-negative pulsotype of high prevalence in North America (pulsotype 968). Pulsotype 968 strains have been isolated previously from a dog (urine) and cohabiting cats (feces) in the United States (24). Notably, all but one of the present companion animal isolates represented a pulsotype that includes human isolates, in this collection and/or the reference library. This cross-species commonality suggests that either (i) ST131 strains are able to cross the human-companion animal species barrier or (ii) humans and companion animals can acquire ST131 strains from a common external source.

The common-source hypothesis is supported by the recent identification of FQr ST131 in poultry meat (32, 46), poultry feces, and extraintestinal infections in chickens (32). These poultry isolates were similar by PFGE profile and virulence gene content to human ST131 isolates from the same locality (32, 46). However, this cannot be extrapolated to the present study, since Australia has a permanent ban on the importation of fresh poultry products, and FQr E. coli have not been detected in Australian poultry (1).

Only 26 (only 12%) of our 214 study isolates (25 human, 1 canine) tested positive for blaCTX-M-15, and the 4 CTX-M-15-positive isolates among the 29 isolates that underwent PFGE analysis represented three distinct pulsotypes. Horizontal acquisition of a CTX-M-15-encoding plasmid appears to have occurred relatively recently within ST131, subsequent to the development of fluoroquinolone resistance in ancestral ST131 clones (18). The low prevalence of blaCTX-M-15 among our study isolates may reflect either the high prevalence of the typically blaCTX-M-15-negative pulsotype 968 (18) or a generally low prevalence of CTX-M-15 among Australian FQr ST131 isolates regardless of clonal background (44).

Strains of E. coli from phylogenetic group B2 have been shown to possess enhanced molecularly inferred virulence capacity compared to those from other E. coli phylogenetic groups but are generally more antimicrobial susceptible (21). Although lacking certain traditional B2-associated virulence traits, ST131 strains still possess numerous virulence genes (23, 34) in addition to multidrug resistance. Our isolates displayed similarly extensive virulence gene profiles regardless of host species, suggesting substantial virulence potential for humans and companion animals alike irrespective of immediate source.

Since ST131 isolates have a known association with fluoroquinolone resistance, we also compared resistance mechanisms between human and companion animal isolates. Animal and human isolates possessed identical chromosomal resistance mutations and similar efflux phenotypes. The identical (and ST131-specific) pattern of gyrA and parC mutations supports the concept of clonal spread. Sequence analysis of the QRDR of parC revealed two distinctive nonsynonymous SNPs and one synonymous SNP, indicative of a specific parC genotype in the ST131 lineage. One of the nonsynonymous parC mutations (GAA to GTA) affecting codon 84 (E84V) is unusual for E. coli but was previously reported in 14 FQr isolates in the United States (18), evidence of its disseminated and lineage-specific nature.

In contrast to the high degree of commonality between human and companion animal ST131 isolates from Australia according to other assessed traits, the companion animal isolates exhibited a significantly higher prevalence of the plasmid-mediated qnrB gene. Since qnr genes have been previously demonstrated in multidrug-resistant E. coli isolates from companion animals in Australia belonging to phylogenetic groups A and D, companion animal FQr E. coli isolates may have a generally higher prevalence of these genes compared to human isolates (14). Given the (mobile) plasmidic nature of qnrB, this minor point of host-specific differentiation may reflect recent acquisition of qnrB after these strains entered the canine population. Interestingly, qnrB was not associated with increased fluoroquinolone MICs, evidence that among these isolates fluoroquinolone resistance is due primarily to chromosomal mutations.

Addition of the efflux pump inhibitor PAβN yielded a ≥4-fold MIC reduction for enrofloxacin, moxifloxacin, and pradofloxacin in all ST131 isolates, perhaps reflecting intrinsic activity of MDR efflux pumps. However, since only two isolates showed even low-level tolerance to organic solvents (and to hexane only), the overall importance of efflux pumps as a resistance mechanism in ST131 cannot be demonstrated. Notably, of the four fluoroquinolones tested, pradofloxacin, an expanded-spectrum fluoroquinolone developed solely for the companion animal market, showed the lowest fluoroquinolone MICs (2 to 8 μg/ml).

In conclusion, we found that fluoroquinolone-resistant E. coli ST131 isolates from humans and companion animals in eastern Australia possess extensive similarities according to genomic backbone, virulence gene content, resistance profile, and chromosomal fluoroquinolone resistance mechanisms. Pets likely play a small but potentially significant role in ST131 transmission dynamics. ST131's high molecularly inferred virulence potential, its broad host range, and its multidrug resistance phenotype make it important for both humans and companion animals. Our findings suggest a need for ongoing surveillance of both human and veterinary antimicrobial-resistant pathogens in order to detect both the spread of existing clonal groups and the emergence of novel lineages.

Supplementary Material

[Supplemental material]
supp_55_8_3782__index.html (1.5KB, html)

ACKNOWLEDGMENTS

This study was supported by an Australian Research Council Linkage project with Bayer Health Care and The University of Queensland. D.J.T. and R.N.C. are principal investigators on this project. J.L.P. has received a portion of her Ph.D. scholarship stipend from this project. P.H. is a scientific adviser for Bayer Health Care. This material also is based in part upon work supported by Office of Research and Development, Medical Research Service, Department of Veterans Affairs (J.R.J.). The study sponsors imposed no commercial influence in study design, interpretation of data, or submission of the manuscript.

We thank Renu Vohra and Brooke Robinson from QML Pathology, Jenny Robson from S&N Pathology, Susan Moss from UQVDL, Marc Marenda from the University of Melbourne VDL, Emma Baggs from IDEXX Laboratories, and Nadine Emrich from the University of Hamburg for providing reference isolates and primers for this study. We especially thank Megan Menard and Brian Johnson at the VA Medical Center, Minneapolis, MN, and Antje Schnasse of the Institute of Biochemistry and Molecular Biology, University of Hamburg, for their technical advice. We also thank Heinz-Georg Wetzstein for critical review of the manuscript.

Footnotes

†

Supplemental material for this article may be found at http://aac.asm.org/.

▿

Published ahead of print on 6 June 2011.

REFERENCES

  • 1. Barton M. D., Pratt R., Hart W. S. 2003. Antibiotic resistance in animals. Commun. Dis. Intell. 27(Suppl.):S121–S126 [PubMed] [Google Scholar]
  • 2. Beutin L. 1999. Escherichia coli as a pathogen in dogs and cats. Vet. Res. 30:285–298 [PubMed] [Google Scholar]
  • 3. Blanco M., et al. 2009. Molecular epidemiology of Escherichia coli producing extended-spectrum β-lactamases in Lugo (Spain): dissemination of clone O25b:H4-ST131 producing CTX-M-15. J. Antimicrob. Chemother. 63:1135–1141 [DOI] [PubMed] [Google Scholar]
  • 4. Cerquetti M., et al. 2010. Ciprofloxacin-resistant, CTX-M-15-producing Escherichia coli ST131 clone in extraintestinal infections in Italy. Clin. Microbiol. Infect. 16:1555–1558 [DOI] [PubMed] [Google Scholar]
  • 5. Clermont O., Bonacorsi S., Bingen E. 2000. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 66:4555–4558 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Clermont O., Johnson J. R., Menard M., Denamur E. 2007. Determination of Escherichia coli O types by allele-specific PCR: application to the O types involved in human septicemia. Diagn. Microbiol. Infect. Dis. 57:129–136 [DOI] [PubMed] [Google Scholar]
  • 7. Clermont O., et al. 2008. The CTX-M-15-producing Escherichia coli diffusing clone belongs to a highly virulent B2 phylogenetic subgroup. J. Antimicrob. Chemother. 61:1024–1028 [DOI] [PubMed] [Google Scholar]
  • 8. Clinical and Laboratory Standards Institute 2010. Performance standards for antimicrobial susceptibility testing: 20th informational supplement M100–S20. Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
  • 9. Clinical and Laboratory Standards Institute 2008. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals, 3rd ed M31–A3 Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
  • 10. Collignon P., Angulo F. J. 2006. Fluoroquinolone-resistant Escherichia coli: food for thought. J. Infect. Dis. 194:8–10 [DOI] [PubMed] [Google Scholar]
  • 11. Emrich N. C., Heisig A., Stubbings W., Labischinski H., Heisig P. 2010. Antibacterial activity of finafloxacin under different pH conditions against isogenic strains of Escherichia coli expressing combinations of defined mechanisms of fluoroquinolone resistance. J. Antimicrob. Chemother. 65:2530–2533 [DOI] [PubMed] [Google Scholar]
  • 12. Ender P. T., et al. 2009. Transmission of an extended-spectrum-beta-lactamase-producing Escherichia coli (sequence type ST131) strain between a father and daughter resulting in septic shock and emphysematous pyelonephritis. J. Clin. Microbiol. 47:3780–3782 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Ewers C., et al. 2010. Emergence of human pandemic O25:H4-ST131 CTX-M-15 extended-spectrum-beta-lactamase-producing Escherichia coli among companion animals. J. Antimicrob. Chemother. 65:651–660 [DOI] [PubMed] [Google Scholar]
  • 14. Gibson J. S., et al. 2010. Identification of qnr and aac(6′)-1b-cr plasmid-mediated fluoroquinolone resistance determinants in multidrug-resistant Enterobacter spp. isolated from extraintestinal infections in companion animals. Vet. Microbiol. 143:329–336 [DOI] [PubMed] [Google Scholar]
  • 15. Guenther S., et al. 2010. Detection of pandemic B2–O25-ST131 Escherichia coli harbouring the CTX-M-9 extended-spectrum beta-lactamase type in a feral urban brown rat (Rattus norvegicus). J. Antimicrob. Chemother. 65:582–584 [DOI] [PubMed] [Google Scholar]
  • 16. Heisig P. 1996. Genetic evidence for a role of parC mutations in development of high-level fluoroquinolone resistance in Escherichia coli. Antimicrob. Agents Chemother. 40:879–885 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Johnson J. R., Gajewski A., Lesse A. J., Russo T. A. 2003. Extraintestinal pathogenic Escherichia coli as a cause of invasive nonurinary infections. J. Clin. Microbiol. 41:5798–5802 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Johnson J. R., Johnston B., Clabots C., Kuskowski M. A., Castanheira M. 2010. Escherichia coli sequence type ST131 as the major cause of serious multidrug-resistant E. coli infections in the United States. Clin. Infect. Dis. 51:286–294 [DOI] [PubMed] [Google Scholar]
  • 19. Johnson J. R., et al. 2009. Escherichia coli sequence type ST131 as an emerging fluoroquinolone-resistant uropathogen among renal transplant recipients. Antimicrob. Agents Chemother. 54:546–550 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Johnson J. R., et al. 2008. Virulence genotypes and phylogenetic background of Escherichia coli serogroup O6 isolates from humans, dogs, and cats. J. Clin. Microbiol. 46:417–422 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Johnson J. R., Kuskowski M. A., Gajewski A., Sahm D. F., Karlowsky J. A. 2004. Virulence characteristics and phylogenetic background of multidrug-resistant and antimicrobial-susceptible clinical isolates of Escherichia coli from across the United States, 2000–2001. J. Infect. Dis. 190:1739–1744 [DOI] [PubMed] [Google Scholar]
  • 22. Johnson J. R., Kuskowski M. A., Owens K., Clabots C., Singer R. S. 2009. Virulence genotypes and phylogenetic background of fluoroquinolone-resistant and susceptible Escherichia coli urine isolates from dogs with urinary tract infection. Vet. Microbiol. 136:108–114 [DOI] [PubMed] [Google Scholar]
  • 23. Johnson J. R., et al. 2009. Epidemic clonal groups of Escherichia coli as a cause of antimicrobial-resistant urinary tract infections in Canada, 2002 to 2004. Antimicrob. Agents Chemother. 53:2733–2739 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Johnson J. R., Miller S., Johnston B., Clabots C., Debroy C. 2009. Sharing of Escherichia coli sequence type ST131 and other multidrug-resistant and urovirulent E. coli strains among dogs and cats within a household. J. Clin. Microbiol. 47:3721–3725 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Johnson J. R., et al. 2000. Evidence of commonality between canine and human extraintestinal pathogenic Escherichia coli strains that express papG allele III. Infect. Immun. 68:3327–3336 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Johnson J. R., et al. 2000. Analysis of the F antigen-specific papA alleles of extraintestinal pathogenic Escherichia coli using a novel multiplex PCR-based assay. Infect. Immun. 68:1587–1599 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Jones G. L., et al. 2008. Prevalence and distribution of plasmid-mediated quinolone resistance genes in clinical isolates of Escherichia coli lacking extended-spectrum beta-lactamases. J. Antimicrob. Chemother. 62:1245–1251 [DOI] [PubMed] [Google Scholar]
  • 28. Lau S. H., et al. 2008. UK epidemic Escherichia coli strains A-E, with CTX-M-15 beta-lactamase, all belong to the international O25:H4-ST131 clone. J. Antimicrob. Chemother. 62:1241–1244 [DOI] [PubMed] [Google Scholar]
  • 29. Lavollay M., et al. 2006. Clonal dissemination of a CTX-M-15 β-lactamase-producing Escherichia coli strain in the Paris area, Tunis, and Bangui. Antimicrob. Agents Chemother. 50:2433–2438 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Lee M. Y., et al. 2010. Dissemination of ST131 and ST393 community-onset, ciprofloxacin-resistant Escherichia coli clones causing urinary tract infections in Korea. J. Infect. 60:146–153 [DOI] [PubMed] [Google Scholar]
  • 31. Maynard C., et al. 2004. Heterogeneity among virulence and antimicrobial resistance gene profiles of extraintestinal Escherichia coli isolates of animal and human origin. J. Clin. Microbiol. 42:5444–5452 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Mora A., et al. 2010. Recent emergence of clonal group O25b:K1:H4–B2-ST131 ibeA strains among Escherichia coli poultry isolates, including CTX-M-9-producing strains, and comparison with clinical human isolates. Appl. Environ. Microbiol. 76:6991–6997 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Naseer U., et al. 2009. Molecular characterization of CTX-M-15-producing clinical isolates of Escherichia coli reveals the spread of multidrug-resistant ST131 (O25:H4) and ST964 (O102:H6) strains in Norway. APMIS 117:526–536 [DOI] [PubMed] [Google Scholar]
  • 34. Nicolas-Chanoine M. H., et al. 2008. Intercontinental emergence of Escherichia coli clone O25:H4-ST131 producing CTX-M-15. J. Antimicrob. Chemother. 61:273–281 [DOI] [PubMed] [Google Scholar]
  • 35. Nowrouzian F., Adlerberth I., Wold A. E. 2001. P fimbriae, capsule and aerobactin characterize colonic resident Escherichia coli. Epidemiol. Infect. 126:11–18 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Peirano G., et al. 2010. High prevalence of ST131 isolates producing CTX-M-15 and CTX-M-14 among extended-spectrum-beta-lactamase-producing Escherichia coli isolates from Canada. Antimicrob. Agents Chemother. 54:1327–1330 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Pitout J. D., Campbell L., Church D. L., Gregson D. B., Laupland K. B. 2009. Molecular characteristics of travel-related extended-spectrum-beta-lactamase-producing Escherichia coli isolates from the Calgary Health Region. Antimicrob. Agents Chemother. 53:2539–2543 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Pitout J. D., Gregson D. B., Campbell L., Laupland K. B. 2009. Molecular characteristics of extended-spectrum-beta-lactamase-producing Escherichia coli isolates causing bacteremia in the Calgary Health Region from 2000 to 2007: emergence of clone ST131 as a cause of community-acquired infections. Antimicrob. Agents Chemother. 53:2846–2851 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Platell J. L., Cobbold R. N., Johnson J. R., Trott D. J. 2010. Clonal group distribution of fluoroquinolone-resistant Escherichia coli among humans and companion animals in Australia. J. Antimicrob. Chemother. 65:1936–1938 [DOI] [PubMed] [Google Scholar]
  • 40. Pomba C., da Fonseca J. D., Baptista B. C., Correia J. D., Martinez-Martinez L. 2009. Detection of the pandemic O25-ST131 human virulent Escherichia coli CTX-M-15-producing clone harboring the qnrB2 and aac(6′)-Ib-cr genes in a dog. Antimicrob. Agents Chemother. 53:327–328 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Ribot E. M., et al. 2006. Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet. Foodborne Pathog. Dis. 3:59–67 [DOI] [PubMed] [Google Scholar]
  • 42. Russo T. A., Johnson J. R. 2003. Medical and economic impact of extraintestinal infections due to Escherichia coli: focus on an increasingly important endemic problem. Microbes Infect. 5:449–456 [DOI] [PubMed] [Google Scholar]
  • 43. Sabate M., et al. 2008. Virulence and antimicrobial resistance profiles among Escherichia coli strains isolated from human and animal wastewater. Res. Microbiol. 159:288–293 [DOI] [PubMed] [Google Scholar]
  • 44. Sidjabat H. E., Derrington P., Nimmo G. R., Paterson D. L. 2010. Escherichia coli ST131 producing CTX-M-15 in Australia. J. Antimicrob. Chemother. 65:1301–1303 [DOI] [PubMed] [Google Scholar]
  • 45. Tenover F., et al. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233–2239 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Vincent C., et al. 2010. Food reservoir for Escherichia coli causing urinary tract infections. Emerg. Infect. Dis. 16:88–95 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Wallace-Gadsden F., Johnson J. R., Wain J., Okeke I. N. 2007. Enteroaggregative Escherichia coli related to uropathogenic clonal group A. Emerg. Infect. Dis. 13:757–760 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Wetzstein H. G. 2005. Comparative mutant prevention concentrations of pradofloxacin and other veterinary fluoroquinolones indicate differing potentials in preventing selection of resistance. Antimicrob. Agents Chemother. 49:4166–4173 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. White D. G., Goldman J. D., Demple B., Levy S. B. 1997. Role of the acrAB locus in organic solvent tolerance mediated by expression of marA, soxS, or robA in Escherichia coli. J. Bacteriol. 179:6122–6126 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Wirth T., et al. 2006. Sex and virulence in Escherichia coli: an evolutionary perspective. Mol. Microbiol. 60:1136–1151 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Yamane K., et al. 2007. New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. 51:3354–3360 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Yumuk Z., Afacan G., Nicolas-Chanoine M. H., Sotto A., Lavigne J. P. 2008. Turkey: a further country concerned by community-acquired Escherichia coli clone O25-ST131 producing CTX-M-15. J. Antimicrob. Chemother. 62:284–288 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]
supp_55_8_3782__index.html (1.5KB, html)
supp_55_8_3782__Supplementary_Tables_ST131_29042011.zip (15.4KB, zip)
supp_55_8_3782__Supplementary_Figures_ST131_25052011.zip (698.6KB, zip)

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES