Abstract
The number and diversity of genes potentially complicate genetic approaches to the rapid detection of transmissible extended-spectrum β-lactamase genes. We developed a robust multiplexed real-time PCR assay based on targets identified in a prior survey and used this to detect relevant genes in 617 consecutive clinical isolates of extended-spectrum β-lactamase (ESBL)-producing Enterobacteriaceae.
TEXT
Emergence of multiple antibiotic resistances in the Enterobacteriaceae is a global problem (8), and early identification is important for control within the nosocomial setting (6–10). Foremost among the causes are extended-spectrum β-lactamases (ESBLs), encoded by a variety of transmissible genes, among which the blaCTX-M group has relatively recently become dominant (1, 13). A previous study of isolates from the western area of metropolitan Sydney, Australia, showed that ESBL genes in Escherichia coli and Klebsiella pneumoniae were mostly of the blaCTX-M type, with rare cases of blaSHV ESBL genes (17) and blaVEB in a single Proteus mirabilis isolate (16). Using these data, we developed a multiplexed assay to test whether it was feasible to correctly assign an ESBL phenotype to a larger collection of isolates from the same region on the basis of a limited set of gene targets.
We developed a real-time multiplex fluorescent probe-based PCR assay to identify blaCTX-M-1 group, blaCTX-M-9 group, blaSHV-5/blaSHV-12, and blaVEB genes. All primer and probesets were first validated as singleplex reactions before being employed in a multiplex reaction. Published sequences were downloaded from GenBank and group-specific conserved regions identified using Clustal W (Lasergene DNASTAR, Madison, WI). Oligonucleotide primers and probes (Table 1) for these and other locally common or emergent genes that might result in misidentification as an ESBL (5) were designed using Primer3 (http://biotools.umassmed.edu/bioapps/primer3_www.cgi). Five colonies picked from pure culture on Brilliance ESBL or 5% horse blood agar (both from Oxoid, Australia) were emulsified in 500 μl of DNase/RNase-free double-distilled water (95°C, 30 min), and 3.5 μl was used as the template in each assay, in a total volume of 25 μl. The final concentrations of reagents in the PCR were 1× ImmoMix (Bioline, London, United Kingdom), 200 nM (each) primers, and 50 nM (each) probes. A 5-min 95°C step was followed by 25 cycles of 94°C for 20 s, 56°C for 35 s, and 72°C for 35 s, using a SmartCycler II (Cepheid, Sunnyvale, CA), but this protocol should easily adapt to any real-time PCR platform. A sample was defined as positive when the cycle threshold (CT) was exceeded in less than 25 cycles. The CT was set at 10 fluorescence units for both CTX-M targets and five fluorescence units for SHV-5/12 and VEB targets, after initial calibration.
Table 1.
Primer and probe sequences
| Primer or probe | Sequence (5′-3′)a | Source or reference |
|---|---|---|
| CTX-M Gp1.F | GGAATCTGACGCTGGGTAAA | This work |
| CTX-M Gp1.R | GGTTGAGGCTGGGTGAAGTA | This work |
| CTX-M Gp1.Pr | 6-FAM-ACTATGGCACCACCAACGAT-BHQ-1 | This work |
| CTX-M Gp9.F | GGTGATGAACGCTTTCCAAT | This work |
| CTX-M Gp9.R | TCAATTTGTTCATGGCGGTA | This work |
| CTX-M Gp9.Pr | HEX-CAGAGTGAAACGCAAAAGCA-BHQ-1 | This work |
| SHV-5/12.F | AGCTGCTGCAGTGGATGGT | This work |
| SHV-5/12.R | CAATGCGCTCTGCTTTGTTA | This work |
| SHV-5/12.Pr | Tx Red-ACCGGAGCTAGCAAGCGG-BHQ-2 | This work |
| VEB.F | CAAATGCACAAGGATTGGAA | This work |
| VEB.R | ATTCCGGAAGTCCCTGTTTT | This work |
| VEB.Pr | Cy5-AAATTGGGCAACCCCAAC-BHQ-2 | This work |
| imp-BE1 | CAYGGTTTGGTGGTTCTTGTAA | 4 |
| imp-BE2 | CCTTTAACVGCCTGYTCTYMT | 4 |
| Vim-F | GATGGTGTTTGGTCGCATA | 3 |
| Vim-R | CGAATGCGCAGCACCAG | 3 |
| NDM.F | CTTCCAACGGTTTGATCGTC | This work |
| NDM.R | ATTGGCATAAGTCGCAATCC | This work |
| CITMF | TGGCCAGAACTGACAGGCAAA | 12 |
| CITMR | TTTCTCCTGAACGTGGCTGGC | 12 |
| DHAMF | AACTTTCACAGGTGTGCTGGGT | 12 |
| DHAMR | CCGTACGCATACTGGCTTTGC | 12 |
6-FAM, 6-carboxyfluorescein; HEX, hexachlorofluorescein; Tx Red, Texas Red; BHQ, Black Hole Quencher.
The assay was tested on a set of reference strains (Table 2) and then on 632 consecutive clinical isolates of Enterobacteriaceae suspected of having an ESBL, as indicated by an MIC of >1 μg/ml for cefotaxime (CTX), ceftazidime (CAZ), and/or aztreonam (ATZ) in the BD Phoenix automated microbiology system (NMIC/ID 80 panels; BD Diagnostics) (Table 3). Of these, 617 (97.6%) were confirmed as having an ESBL phenotype using the ESBL screening/confirmatory test (ESBL test) in accordance with CLSI guidelines (2), and all 617 carried one or more of the ESBL gene targets (Table 4).
Table 2.
Control isolates used in assay optimization
| ID | Strain | Resistance gene(s)a | Identified target(s)b | Source or referencec |
|---|---|---|---|---|
| JIE 251 | E. coli | blaCTX-M-3 | CTX-M-1 group | 17 |
| JIE 059 | E. coli | blaCTX-M-9 | CTX-M-9 group | 17 |
| JIE 088 | E. coli | blaCTX-M-14 | CTX-M-9 group | 17 |
| JIE 236 | E. coli | blaCTX-M-15 | CTX-M-1 group | 17 |
| JIE 298 | E. coli | blaCTX-M-24 | CTX-M-9 group | 17 |
| JIE 058 | E. coli | blaCTX-M-27 | CTX-M-9 group | 17 |
| JIE 137 | K. pneumoniae | blaCTX-M-62 | CTX-M-1 group | 17 |
| PA 185 | P. aeruginosa | blaSHV-5 | SHV-5/12 | 17 |
| JIE 008 | K. pneumoniae | blaSHV-12 | SHV-5/12 | 17 |
| JIE 273 | P. mirabilis | blaVEB-6 | VEB | 16 |
| JIE 084 | E. coli | blaCTX-M-9, blaCTX-M-14 | CTX-M-9 group | 17 |
| JIE162 | K. pneumoniae | blaCTX-M-15, blaSHV-12 | CTX-M-1; SHV-5/12 | 17 |
| JIE1385 | E. coli | blaCTX-M-14, blaCMY-2 | CTX-M-9 group | 17 |
| ATCC 25922 | E. coli | − | ATCC | |
| ATCC 13883 | K. pneumoniae | − | ATCC | |
| ATCC 12453 | P. mirabilis | − | ATCC | |
| ATCC 13047 | E. cloacae | − | ATCC | |
| ATCC 700603 | K. pneumoniae | blaSHV-18 | − | ATCC |
| JIE142 | K. pneumoniae | blaSHV-11 | − | Thomas and Olma |
| JIE181 | K. pneumoniae | blaSHV-28 | − | Thomas and Olma |
| JIE203 | K. pneumoniae | blaSHV-109 | − | Thomas and Olma |
| N6994 | P. aeruginosa | blaIMP-1 | − | Bell and Turnidge |
| WCH 1824 | K. pneumoniae | blaIMP-4 | − | Bell and Turnidge |
| JIP 144 | P. aeruginosa | blaIMP-7 | − | Bell and Turnidge |
| N12281 | E. cloacae | blaIMP-8 | − | Bell and Turnidge |
| NS249 | S. marcescens | blaIMP-11 | − | Bell and Turnidge |
| 08-26640 | P. aeruginosa | blaVIM-1 | − | Bell and Turnidge |
| 08-037308 | P. aeruginosa | blaVIM-2 | − | Bell and Turnidge |
| N12636 | P. aeruginosa | blaVIM-3 | − | Bell and Turnidge |
| RMH078 | P. aeruginosa | blaVIM-4 | − | Peleg and Wiese; 11 |
| JIP152 | P. aeruginosa | blaSPM-1 | − | Thomas and Olma |
| N15348 | A. baumannii | blaSIM-1 | − | Bell and Turnidge |
| WCH 2677 | P. aeruginosa | blaAIM-1 | − | Bell and Turnidge |
| 09K280459L | E. coli | blaNDM-1 | − | Taylor; 14 |
| KPN2303 | K. pneumoniae | blaKPC-2 | − | Quinn; 15 |
| JIE602 | E. coli | blaCMY-2 | − | Thomas and Olma |
| JIE203 | K. pneumoniae | blaDHA-1 | − | Thomas and Olma |
| J53 | E. coli | blaFOX | − | Ingram |
| 08-251-2244 | K. pneumoniae | blaACT/MIR-1 | − | Thomas and Olma |
| AHC01 | A. hydrophila | blaMOX/CMY-1 | − | Thomas and Olma |
| JIE094 | H. alvei | blaACC-1 | − | Thomas and Olma |
All listed genes in control strains were sequenced previously or as part of this study.
−, negative by PCR (negative controls).
ATCC, American Type Culture Collection; Bell and Turnidge, Jan Bell and John Turnidge, Women's and Children's Hospital, Adelaide, Australia; Taylor, Peter Taylor, Prince of Wales Hospital, Sydney, Australia; Thomas and Olma, Lee Thomas and Tom Olma, Westmead Hospital, Sydney, Australia; Peleg and Wiese, Anton Peleg and Peter Wiese, Royal Melbourne Hospital, Melbourne, Australia; Ingram, Paul Ingram, Sir Charles Gairdner Hospital, Perth, Australia; Quinn, J. Quinn, Chicago Infectious Disease Research Institute, Chicago, IL.
Table 3.
Selected antibiotic resistances by ESBL type
| Group and isolate | No. of isolates (% of group) | No. (%) of isolates resistant toa: |
|||||||
|---|---|---|---|---|---|---|---|---|---|
| CAZ (≥2 μg/ml) | CTX (≥2 μg/ml) | FOX (≥16 μg/ml) | FEP (≥4 μg/ml) | GEN (≥8 μg/ml) | TOB (≥8 μg/ml) | AMK (≥32 μg/ml) | CIP (≥4 μg/ml) | ||
| CTX-M-1 | 387/617 (62.7) | ||||||||
| E. coli | 249 (64.3) | 249 (100) | 249 (100) | 61 (24.5) | 209 (83.9) | 162 (65.1) | 187 (75.1) | 0 | 230 (92.4) |
| K. pneumoniae | 121 (31.3) | 121 (100) | 121 (100) | 52 (43.0) | 97 (80) | 100 (82.6) | 112 (92.6) | 0 | 84 (69.4) |
| E. cloacae | 11 (2.8) | 11 (100) | 11 (100) | 10 (91) | 10 (91) | 11 (100) | 11 (100) | 0 | 8 (73) |
| P. mirabilis | 4 (1) | 4 (100) | 4 (100) | 0 | 0 | 2 (50) | 0 | 0 | 0 |
| Citrobacter sp. | 1 (0.3) | 1 (100) | 1 (100) | 1 (100) | 1 (100) | 1 (100) | 1 (100) | 0 | 0 |
| Salmonella sp. | 1 (0.3) | 1 (100) | 1 (100) | 1 (100) | 1 (100) | 0 | 0 | 0 | 0 |
| Total | 387 (100) | 387 (100) | 387 (100) | 125 (32.3) | 318 (82.2) | 265 (68.5) | 311 (80.4) | 0 | 322 (83.2) |
| CTX-M-9 | 148/617 (24.0) | ||||||||
| E. coli | 95 (64.5) | 9 (9) | 95 (100) | 12 (13) | 49 (51.5) | 48 (53) | 41 (43) | 0 | 61 (64) |
| K. pneumoniae | 48 (32.7) | 5 (10) | 48 (100) | 37 (77) | 25 (53) | 48 (100) | 48 (100) | 6 (12.5) | 32 (67) |
| E. cloacae | 3 (2) | 3 (100) | 3 (100) | 3 (100) | 1 (33.3) | 1 (33) | 1 (33) | 0 | 2 (67) |
| C. koseri | 1 (0.7) | 1 (100) | 1 (100) | 1 (100) | 1 (100) | 1 (100) | 1 (100) | 0 | 1 (100) |
| Salmonella sp. | 1 (0.7) | 0 | 1 (100) | 1 (100) | 0 | 1 (100) | 1 (100) | 0 | 0 |
| Total | 148 (100) | 18 (12.2) | 148 (100) | 54 (36.5) | 76 (51.4) | 99 (66.7) | 92 (62.2) | 6 (4) | 96 (64.9) |
| SHV-5/12 | 80/617 (13.0) | ||||||||
| E. coli | 3 (4) | 3 (100) | 3 (100) | 2 (67) | 1 (33.3) | 2 (67) | 2 (67) | 0 | 1 (33) |
| K. pneumoniae | 31 (39) | 28 (90) | 31 (100) | 22 (71) | 23 (75) | 9 (30) | 9 (30) | 1 (3.2) | 19 (61) |
| E. cloacae | 34 (42) | 34 (100) | 34 (100) | 34 (100) | 8 (23) | 32 (94) | 32 (94) | 0 | 11 (32) |
| K. oxytoca | 3 (4) | 3 (100) | 3 (100) | 0 | 0 | 3 (100) | 3 (100) | 0 | 0 |
| Citrobacter sp. | 9 (11) | 9 (100) | 8 (73) | 9 (100) | 4 (44.4) | 8 (73) | 8 (73) | 0 | 5 (45) |
| Total | 80 (100) | 77 (96) | 79 (99) | 67 (84) | 36 (45) | 54 (68) | 54 (68) | 1 (1.3) | 36 (45) |
| VEB | 2/617 (0.3) | ||||||||
| P. mirabilis | 2 (100) | 2 (100) | 2 (100) | 2 (100) | 2 (100) | 2 (100) | 2 (100) | 2 (100) | 0 |
| Total in all groups | 617 | ||||||||
CAZ, ceftazidime; CTX, cefotaxime; GEN, gentamicin; TOB, tobramycin; FOX, cefoxitin; CIP, ciprofloxacin; AMK, amikacin; FEP, cefepime.
Table 4.
Summary of results
| Characteristic | No. (%) of isolates |
|---|---|
| Candidate ESBL isolates | 632 |
| Confirmed by CLSI ESBL test | 617a |
| CTX-M-1 group | 387 (62.7) |
| CTX-M-9 group | 148 (24.0) |
| SHV-5 and/or SHV-12 group | 80 (13.0) |
| VEB group | 2 (0.3) |
| Multiple genes | 34 (5.5) |
| Multiple ESBL genes | 19 |
| (blaCTX-M-1 + blaCTX-M-9) E. coli | 3 |
| (blaCTX-M-1 + blaCTX-M-9) K. pneumoniae | 3 |
| (blaCTX-M-1 + blaSHV-5/12) E. coli | 4 |
| (blaCTX-M-1 + blaSHV-5/12) K. pneumoniae | 1 |
| (blaCTX-M-9 + blaSHV-5/12) K. pneumoniae | 5 |
| (blaCTX-M-9 + blaSHV-5/12) E. cloacae | 3 |
| ESBL + AmpCb | 11 |
| (DHA-1 + CTX-M-1) K. pneumoniae | 6 |
| (DHA-1 + SHV-5/12) K. pneumoniae | 1 |
| (CMY-2 + CTX-M-1) E. coli | 3 |
| (CMY-2 + SHV-5/12) K. pneumoniae | 1 |
| ESBL + MBLc | 4 |
| (IMP-4 + CTX-M-1) E. coli | 2 |
| (IMP-4 + SHV-5/12) K. pneumoniae | 1 |
| (IMP-4 + SHV-5/12) E. cloacae | 1 |
Numbers and percentages below this point refer to the 617 isolates confirmed with ESBLs by the CLSI test, all of which were subjected to PCR testing.
ESBL with AmpC in same isolate.
ESBL with MBL in same isolate.
Our previous smaller study of E. coli and K. pneumoniae isolates (n = 81) in 2006 revealed that genes from the blaCTX-M-1 group (mostly blaCTX-M-15) were almost twice as common as those from the blaCTX-M-9 group (mostly blaCTX-M-14), with blaSHV-12 found in a small minority (17). This much larger survey, 4 years later, suggests a similarly marked dominance of genes from the blaCTX-M-1 group, being around 2.5-fold more common than those from the blaCTX-M-9 group, in both E. coli and K. pneumoniae. We detected blaCTX-M-1 group genes (in 387/617 [62.7%] isolates), blaCTX-M-9 group genes (in 148/617 [24.0%] isolates), blaSHV-type ESBL genes (blaSHV-5/blaSHV-12, in 80/617 [13.0%] isolates), and blaVEB-type ESBL genes (in 2/617 [0.3%] isolates). The majority of ESBL producers were E. coli isolates, which carried 64.3% of blaCTX-M-1 and 64.5% of blaCTX-M-9 group genes. A blaSHV-type gene was much more commonly responsible for the ESBL phenotype in K. pneumoniae and Enterobacter cloacae isolates (39% and 42%, respectively) than in E. coli isolates (4%). A blaVEB gene was previously reported in one Proteus mirabilis isolate from 2007 (16) and does not appear to have spread more widely, being found in only two further P. mirabilis isolates here.
In line with results from our previous survey (17), multiple ESBL genes were rare. Five of the 387 isolates with blaCTX-M-1-like genes (1.3%) and eight of the 148 isolates with blaCTX-M-9-like genes (6%) also carried blaSHV-5 or blaSHV-12. Isolates with a cefoxitin (FOX) MIC of ≥16 μg/ml were screened for the most common plasmid-borne metallo-β-lactamase (MBL) and AmpC β-lactamase genes in this region (Table 1). We found that 11 of the 617 ESBL isolates (1.8%) also carried a blaDHA-1 or blaCMY-2- like plasmid AmpC gene and four (0.6%) also carried the locally circulating MBL gene blaIMP-4 (Table 3).
Gentamicin resistance is a common accompaniment of the ESBL phenotype that varies with the specific gene and has potential implications for antibiotic stewardship. As previously shown (17), gentamicin resistance was more commonly associated with blaCTX-M-1-like genes (34.9% of isolates gentamicin susceptible) than blaCTX-M-9-like genes (54% of isolates gentamicin susceptible) in E. coli. K. pneumoniae isolates with an ESBL gene were also generally gentamicin resistant. The association with gentamicin resistance was even more marked in the presence of a blaSHV-type ESBL, especially in organisms other than K. pneumoniae. Two P. mirabilis isolates with blaVEB were amikacin, gentamicin, and tobramycin resistant (16), although amikacin resistance was otherwise rare overall (9/632, 1.4%). Cefepime and ciprofloxacin were ineffective against most strains tested (Table 3).
This study shows that a limited set of globally well-known (and locally identified) ESBL-associated gene targets can be used to predict phenotype in clinical isolates of Enterobacteriaceae within 2 h, long before phenotypic results are available, and lends itself to automation and high-throughput processing. Apart from the promise of earlier diagnosis of antibiotic-resistant infections, the ability to recognize important transmissible antibiotic resistance a day earlier than would otherwise be possible increases the likelihood that cohorting and isolation approaches to infection control will be effective. The extent to which targets vary from place to place, and over time, remains to be tested. A rational approach is to conduct local surveillance to establish targets and monitor this against phenotypic methods regularly. The relative stability of these targets over 4 years in our laboratory suggests that batched analysis once a year may suffice.
Acknowledgments
Thanks are owed to Lee Thomas and Tom Olma for their technical support and practical assistance.
Footnotes
Published ahead of print on 25 May 2011.
REFERENCES
- 1. Canton R., Coque T. M. 2006. The CTX-M β-lactamase pandemic. Curr. Opin. Microbiol. 9:466–475 [DOI] [PubMed] [Google Scholar]
- 2. CLSI 2010. Performance standards for antimicrobial susceptibility testing; twentieth informational supplement, p. 46–47 CLSI document M100-S20. Supplemental table 2A-S1. Screening and confirmatory tests for ESBLs. CLSI, Wayne, PA [Google Scholar]
- 3. Ellington M. J., Kistler J., Livermore D. M., Woodford N. 2007. Multiplex PCR for rapid detection of genes encoding acquired metallo-β-lactamases. J. Antimicrob. Chemother. 59:321–322 [DOI] [PubMed] [Google Scholar]
- 4. Espedido B. A., Partridge S. R., Iredell J. R. 2008. blaIMP-4 in different genetic contexts in Enterobacteriaceae isolates from Australia. Antimicrob. Agents Chemother. 52:2984–2987 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Espedido B. A., Thomas L. C., Iredell J. R. 2007. Metallo-beta-lactamase or extended-spectrum beta-lactamase: a sheep in wolf's clothing. J. Clin. Microbiol. 45:2034–2036 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Falagas M. E., et al. 2005. Outcome of infections due to pandrug-resistant (PDR) Gram-negative bacteria. BMC Infect. Dis. 5:24–31 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Giske C. G., Monnet D. L., Cars O., Carmeli Y. 2008. Clinical and economic impact of common multidrug-resistance Gram-negative bacilli. Antimicrob. Agents Chemother. 52:813–821 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Lee J. H., Jeong S. H., Cha S.-S., Lee S. H. 2009. New disturbing trend in antimicrobial resistance of Gram-negative pathogens. PLoS Pathog. 5:1–5 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Paterson D. L., et al. 2004. International prospective study of Klebsiella pneumoniae bacteraemia: implications of extended-spectrum β-lactamase production in nosocomial infections. Ann. Intern. Med. 140:26–32 [DOI] [PubMed] [Google Scholar]
- 10. Paterson D. L., Yu V. L. 1999. Editorial response: extended-spectrum β-lactamases: a call for improved detection and control. Clin. Infect. Dis. 29:1419–1422 [DOI] [PubMed] [Google Scholar]
- 11. Peleg A. Y., Bell J. M., Hofmeyr A., Wiese P. 2006. Inter-country transfer of Gram-negative organisms carrying the VIM-4 and OXA-58 carbapenem-hydrolysing enzymes. J. Antimicrob. Chemother. 57:794–795 [DOI] [PubMed] [Google Scholar]
- 12. Perez-Perez F. J., Hanson N. D. 2002. Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR. J. Clin. Microbiol. 40:2153–2162 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Pitout J. D., Laupland K. B. 2008. Extended-spectrum β-lactamase-producing Enterobacteriaceae: an emerging public-health concern. Lancet 8:159–166 [DOI] [PubMed] [Google Scholar]
- 14. Poirel L., Lagrutta E., Taylor P., Pham J., Nordmann P. 2010. Emergence of metallo-β-lactamase NDM-1-producing multidrug-resistant Escherichia coli in Australia. Antimicrob. Agents Chemother. 54:4914–4916 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Villegas M. V., et al. 2006. First detection of the plasmid-mediated class A carbapenemase KPC-2 in clinical isolates of Klebsiella pneumoniae from South America. Antimicrob. Agents Chemother. 50:2880–2882 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Zong Z., Partridge S. R., Iredell J. R. 2008. RmtC 16S rRNA methyltransferase in Australia. Antimicrob. Agents Chemother. 52:794–795 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Zong Z., Partridge S. R., Thomas L., Iredell J. R. 2008. Dominance of blaCTX-M within an Australian extended-spectrum β-lactamase gene pool. Antimicrob. Agents Chemother. 52:4198–4202 [DOI] [PMC free article] [PubMed] [Google Scholar]