Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Aug 15.
Published in final edited form as: J Immunol. 2011 Jul 8;187(4):1912–1918. doi: 10.4049/jimmunol.1001806

Processing of human protryptase in mast cells involves cathepsins L, B and C1

Quang T Le *, Gregorio Gomez *, Wei Zhao †, Jiang Hu *, Han-Zhang Xia *, Yoshihiro Fukuoka *, Nobuhiko Katunuma ‡, Lawrence B Schwartz *,2
PMCID: PMC3150348  NIHMSID: NIHMS302031  PMID: 21742978

Abstract

Human β-tryptase is stored in secretory granules of human mast cells as a heparin-stabilized tetramer. β-Protryptase in solution can be directly processed to the mature enzyme by cathepsin (CTS) L and CTSB, and sequentially processed by autocatalysis at R−3 followed by CTSC proteolysis. However, it is uncertain which cathepsin is involved in protryptase processing inside human mast cells, because murine BMMC from CTSC-deficient mice convert protryptase (proMMCP-6) is to mature MMCP-6. This suggests that other proteases are important for processing human β-protryptase. In the current study, reduction of either CTSB or CTSL activity inside HMC-1 cells by shRNA silencing or cathepsin-specific pharmacologic inhibitors substantially reduced mature β-tryptase formation. Similar reductions of tryptase levels in primary skin-derived mast cells were observed with these pharmacologic inhibitors. In contrast, protryptase processing was minimally reduced by shRNA silencing of CTSC. A putative pharmacologic inhibitor of CTSC markedly reduced tryptase levels, suggesting an off-target effect. Skin mast cells contain substantially greater amounts of CTSL and CTSB than HMC-1 cells, the opposite being found for CTSC. Both CTSL and CTSB co-localize to the secretory granule compartment of skin mast cells. Thus, CTSL and CTSB are central to the processing of protryptase(s) in human mast cells, and are potential targets for attenuating production of mature tryptase in vivo.

Introduction

β-Tryptase (EC 3.4.21.59), a serine protease, is the major protein component of the secretory granules of human mast cells (1, 2). Processing of β-protryptase to mature enzymatically-active β-tryptase occurs in solution by the autocatalytic-cathepsin (CTS) C processing pathway. Experiments with HMC-1 cells, a human mast cell leukemia cell line, in which Gly-Phe-CHN2, an inhibitor of CTSC, attenuates the formation of β-tryptase activity (3, 4) appeared to support the biological relevance of this processing pathway. However, mast cells from mice that are CTSC deficient express mature mouse mast cell protease-6 (mMCP-6), a murine tryptase, albeit at cellular levels about 75% lower than mast cells from wild-type mice (5), indicating the presence of alternative protryptase processing pathway(s), at least in mice and possibly in humans. In fact, the direct removal of the propeptides from both α and β protryptases by CTSL and CTSB may play a biologically important role in mast cells based on the identification of these enzymes in HMC-1 cells and the demonstration in solution of their protryptase processing activities (6). Together with CTSC, CTSL and CTSB account for nearly all of the protryptase processing activity in HMC-1 cells.

Even though cathepsins are classically considered as acidic proteases involved in the degradation of proteins in lysosomes, there is ample precedent for their subcellular localization to other compartments where they are involved in cell-specific processing. By removing dipeptides, CTSC removes two amino acid propeptides from several protease zymogens in the secretory granules of several cell types, including progranzymes A, B and K in cytotoxic T lymphocytes and natural killer cells (7–10), proCTSG (11), proelastase and proproteinase-3 in neutrophils (12) and prochymases in murine mast cells (5). Also in murine mast cells, CTSE has been localized to secretory granules where it binds to heparin proteoglycan and processes mast cell procarboxypeptidase (13). The current manuscript demonstrates that cathepsins B and L co-localize to the secretory granules of primary human skin-derived mast cells and are required for optimal processing of protryptase to active mature tryptase inside human mast cells.

Materials and Methods

Materials

Anti-tryptase mAbs for Western blottin: G3 (which detects pro and mature forms of α and β tryptases, or total tryptase) and G5 (which detects mature forms of α and β tryptases (14), B12 for ELISA capture (which captures total tryptase), G4-biotin for total tryptase ELISA detection and G5-biotin for mature tryptase ELISA detection were used as described (3, 15). Western blot bands were detected with IRDye-conjugated anti-mouse IgG (Odyssey Infrared Imaging System, LiCor Biotechnology, Lincoln, NE). The human mast cell leukemia cell line HMC-1 was provided by Dr. G. Gleich and Dr. J. Butterfield (Mayo Clinic, Rochester, MN) (16). CLIK-148 (CTSL inhibitor), CLIK-060 (CTSS inhibitor) and CA-074 (CTSB inhibitor) (17, 18) were provided by Professor Nobuhiko Katunuma. Primer synthesis and DNA sequencing were performed by the Virginia Commonwealth University Nucleic Acids Core Laboratory (Richmond, VA). Human recombinant stem cell factor (SCF) was provided by Swedish Orphan Biovitrum (Stockholm, Sweden).

Human skin mast cells

Skin-derived mast cells were obtained as described (19). Briefly, cells were dispersed from fresh surgical skin using collagenase and hyaluronidase, partially purified by Percoll density-dependent sedimentation, and placed into culture in serum-free AIM-V medium containing 100 ng/ml rh stem cell factor (a gift from Amgen, Thousand Oaks, CA). Mast cells were studied after 6 wk of culture, by which time they were >99% pure and >97% viable.

Skin mast cells (106 cells/ml) were activated with 1 μg/ml of anti-FcεRIα IgG mAb (22E7) as described (19). After the activation period, cells and medium were separated by centrifugation. The cells were lysed with 1% Triton X-100 and percent degranulation was calculated from the β-hexosaminidase activity detected in the releasates and retentates by measuring the cleavage of p-nitrophenyl N-acetyl-β-D-glucosaminide as described (2). Absorbance values were read at 405 nm with a SpectraMax 384 Plus UV-VIS plate reader (Molecular Devices Corporation, Chicago, IL). Lactate dehydrogenase (LDH) activity, a cytoplasmic marker, was measured to assess cell damage (LDH-Cytotoxicity Assay Kit, BioVision Inc., Mountain View, CA). Percent release values were calculated using the following formula: ((supernatant release/(supernatant release + lysate release)) × 100. Net percent release was calculated by subtracting spontaneous release from both the numerator and denominator.

Inhibition of CTSL, CTSB and CTSC activity in cultured HMC-1 cells and human skin mast cells

HMC-1 and human skin mast cell were cultured starting at 5 × 105 and 1 × 105 cells/ml, respectively. CLIK-148, CA-074 Me, GF-CHN2 (1 to 10 μM) or the corresponding diluent alone (0.01 to 0.025% DMSO) was added at day 0, and cells were cultured up 4 d for HMC-1 and 6 d for human skin mast cells. Every 2 d the cells were harvested, washed and counted, and then frozen at −70°C. To maintain the effect of inhibitors, the old medium was replaced every 2 d with fresh medium containing the inhibitor. To analyze protease activities, cells were thawed, sonicated on ice and assayed.

Cathepsins C, L and B short hairpin (sh) RNA

DNA oligonucleotides encoding shRNA sequences targeting CTSL and CTSC with loop sequences 5′-CGAA-3′ were cloned into pLenti6/BLOCK-iT-DEST vector. The specific shRNA sequences were as follows: CTSL-98 (L98) (5′-CACCGGCGATGCACAACAGATTACGAATAATCTGTTGTGCATCGCC-3′), CTSL-662 (L662) (5′CACCGTGACACCGGCTTTGTGGACCGAAGTCCACAAAGCCGGTGTCA-3′), and CTSC-417 5′-CACCGGGATATATGATTTGCCACATCGAAATGTGGCAAATCATATATCCC -3′, where the sense and antisense sequences targeting gene-specific RNA transcripts are underlined. Each DNA oligonucleotide was ligated and subcloned into the entry pENTR™/U6 lentiviral vector (Invitrogen), and then cloned into the pLenti6/BLOCK-iT-DEST vector with an LR recombination reaction to create the CTSL and CTSC shRNA expression constructs. The recombinant shRNA CTSL, CTSC and scrambled control lentiviral plasmids were each transfected into HEK293 cells to produce CTSL, CTSC and control shRNA lentiviral transduction constructs. MISSION lentiviral transduction constructs were used for CTSB (Sigma). These included TRCN- 3655, -3656, -3657, -3658 and -3659 (B55-B59) and the MISSION Non-Target shRNA Control Transduction Particles (SHC002V). Lentiviral CTSL, CTSC, CTSB and control shRNA constructs were each transfected into HMC-1 cells according to the manufacturers’ instructions. Cells stably expressing them were selected with blasticidin (CTSL and CTSC) and puromycin (CTSB), and analyzed by enzyme activity and western blotting.

Analytic techniques

β-Tryptase enzymatic activity was monitored in 1 cc plastic cuvettes or 96-well microtiter plates using tosyl-Gly-Pro-Lys-p-nitroanilide (TGPK) as the substrate as described (20), except that soy bean trypsin inhibitor (SBTI) (10 μg/ml) was included when impure preparations, e.g., cell extracts, were used in order to inhibit tryptic serine proteases other than tetrameric tryptase (21). The increase in p–nitroanilide was measured at 405 nm in a Cary 3 UV-VIS spectrophotometer or in a Bio-Tek EL312 Kinetic plate reader (Bio-Tek Instruments, Winooski, VT). One unit of enzyme activity was defined as the amount that cleaves 1 μmol of synthetic substrate per min.

Gelatin zymography to detect tryptase was performed with samples that had been incubated in 1% SDS, 125 mM Tris, pH 6.8, and 10% glycerol in the absence of a reducing agent for 10 min at room temperature, and then immediately subjected to SDS-PAGE in a polyacrylamide gel (10%) that had been copolymerized with 0.1% gelatin (22). After electrophoresis the gel was washed twice in 2.5% Triton X-100 for 20 min to remove SDS, and then incubated overnight at 37°C before staining with Coomassie blue.

Chymase activity was measured using Suc-Ala-Ala-Pro-Phe-MCA as described (5). CTSC activity was determined using either Gly-Phe-p-nitroanilide (100 μM) as substrate in 50 mM sodium acetate buffer, pH 6.0, 1 mM EDTA, 4 mM DTT (23). CTSL and CTSB were measured using Z-Phe-Arg-MCA and Z- Arg-Arg-MCA, respectively (24). In cell extracts, unless stated otherwise, CTSL measurements were performed in the presence of 1 μM CA-074 and CTSB measurements were performed in the presence of 1 μM CLIK-148. For inhibition studies, the enzymes were preincubated with various inhibitors at room temperature for 15 min before measurement of activity. Protein concentrations were measured by the BCA method using BSA as a standard.

Total HMC-1 cell RNA from resting mast cells was isolated and DNase-treated, respectively, with the RNeasy Miniprep kit and RNase-Free DNase Set (Qiagen, GmbH, Germany). cDNA was synthesized (5 min at 65°C, 60 min at 37°C) from 500 ng total RNA using the Ready-To-Go T-Primed First-Strand Kit (Amersham Biociences, 800 Centennial Ave. NJ08855) with an Eppendorf Master Gradient amplifier. Primers (sense; antisense; product size; GenBank accession number available at http://www.ncbi.nlm.nih.gov/nuccore/) were designed with primer express 3.0 software (Applied Biosystems) as follows: CTSB (5′-gatctgcatccacaccaatg-3′; 5′-ggagggatggagtacggtct-3′; 198; BC095408); CTSL (5′-gctaatgacaccggctttgt-3′; 5′-tttcaaatccgtagccaacc-3′; 202; M20496.1); tryptase (5′-cttggactggatccaccact-3′; 5′-ggaaggggctcagaagagag-3′; 202; M37488); β-actin (5′-ggcatcctcaccctgaagta-3′; 5′-ggggtgttgaaggtctcaaa-3′; 203; NM_001101.3). For quantitative PCR, 2 μl of cDNA were combined with 1 μl of sense and antisense primers (10 μM each) and 12.5 μl of SYBR Green Supermix from the iScript™ SYBR Green RT-PCR kit (Bio-Rad, Hercules, CA) in a final volume of 25 μl. PCR reaction conditions included a hot start at 95°C for 5 min, followed by 35 cycles of 95°C for 30 sec, 55°C for 30 second and 72°C for 30 second. C(t) values for each mRNA were obtained and analyzed using the 2−ΔΔC(t) method. mRNA expression levels of CTSB, CTSL and tryptase were each normalized to that of β-actin. All reactions were run and analyzed with the CFX96™ Real-Time PCR BioRad Detection System and the CFX Manager software 1.0. A melting curve was analyzed at the end of each experiment to assess primer-dimer formation.

Results

CTSC is not essential for the activation of human tryptase in HMC-1 cells

Although the Gly-Phe-CHN2 inhibitor of CTSC activity inhibited the maturation of tryptase by intact and disrupted human mast cell leukemia cells (HMC-1) (3, 4), mature tryptase was detected in mast cells derived from CTSC knockout mice (5). To examine the dependence of the maturation of human β-tryptase on CTSC, an shRNA lentivirus construct was prepared and used to transfect HMC-1 cells that were then selected with blasticidin. Knockdown of CTSC activity by 78% (Fig. 1A) and protein by 77% (Figs. 1B–C) in stably-transfected HMC-1 cell lines only diminished tryptase peptidolytic activity by about 23% in cell extracts (Fig. 1D). The tryptase activity assay using TGPK as substrate is made more specific for tryptase by including SBTI, which inhibitis most serine proteases with tryptic activity, such as CTSG, but does not affect the activity of β-tryptase tetramers (25, 26). As shown in Figure 1E, using comparable amounts of CTS L, B and G and of β-tryptase to cleave TGPK, the specific activity of CTSG is ~1,200-fold less than that of β-tryptase, whereas those of CTS L, B and C are not detectable (<10,000-fold lower than that of β-tryptase).

Figure 1. CTSC is not essential for the activation of human tryptase in HMC-1 cells.

Figure 1

Open in a new tab

CTSC shRNA suppresses the expression of CTSC activity (A) and protein (B,C) to a greater extent than tryptase activity (D,F) in HMC-1 cells. Control and CTSC-specific shRNA constructs were transfected into HMC-1 cells. CTSC1 and CTSC2 represent two different stably-transfected cell lines using the same CTSC-targeted construct. CTSC activity and protein from extracts of HMC-1 cells, prepared from equivalent cell numbers 15 d post blacticidin (6 μg/ml) selection, were measured, respectively, with Gly-L-Phe-p-nitroanilide and by Western blotting with anti-CTSC polyclonal antibody (1:1000 dilution) and anti-β-actin polyclonal antibody (1:2000 dilution), respectively. A representative Western blot is shown in B. Western blot band intensities, calculated from the infrared fluorescence data captured by the Odyssey system, for CTSC were normalized to those of β-actin and set to 100% in the vector control (C). Tryptase enzyme activity in the HMC-1 extracts was measured with TGPK in the presence of SBTI (10 μg/ml) in D and by gelatin zymography in F. TGPK tryptase assay results when performed in the presence and absence of SBTI (10 ug/ml) with comparable amounts of CTSL, CTSB, CTSC, CTSG and tryptase are shown in E. The migrations shown in F of β-galactosidase (β-Gal hatch mark, 132,000 kDa, Kaleidoscope Prestained Standards, BioRad) and purified lung-derived β-tryptase tetramer (last lane) used as a zymography controls, migrate to the same position as the HMC-1 tryptase bands, whereas monomeric recombinant β2-protryptase runs with a faster mobility (not shown) (6).

Another approach to examine the affect CTSC silencing has on tryptase is by gelatin zymography. β-Tryptase tetramers have been shown to migrate considerably slower than inactive tryptase monomers, and only the tetramer exhibited gelatinolytic activity (6). As shown in Figure 1F, CTSC silencing has no substantial effect on tryptase activity by zymography. The ability of CTSC shRNA to silence CTSC without substantially affecting tryptase maturation raises the possibility that proteases other than CTSC process β-protryptase in human mast cells.

Specificities of inhibitors and assays of cathepsins

To measure activity levels of cathepsins B and L in mast cell releasates or extracts, the specificities of the inhibitors and assays used were examined as shown in Figure 2. GF-CHN2 targets CTSC, CLIK-148 targets CTSL and CA-074Me targets CTSB (Fig. 2A) in solution with purified cathepsins with apparent specificity because each inhibitor essentially abrogates the activity of its intended target at a 1 μM concentration without appreciably affecting the activity of the other cathepsins at a 10 μM concentration. Further, neither of these inhibitors affects β-tryptase activity (Fig. 2B). Figure 2C shows the abilities of purified β-tryptase and CTSG to cleave these substrates. Equimolar amounts of β-tryptase and CTSG, respectively, exhibit 0.4% and 0.5% of the activity of CTSL to cleave Z-Phe-Arg-MCA, and β-tryptase and CTSG, respectively, exhibit 0.3% and 0.1% of the activity of CTSB to cleave Z-Arg-Arg-MCA.

Figure 2.

Figure 2

Open in a new tab

Specificities of cathepsin inhibitors and assays. Inhibitory activities of GF-CNH2 (GF), CA-074 (CA) and CLIK-148 (CLIK) for CTSC, CTSB and CTSL (A) and tryptase (B). Each CTS was assayed with synthetic substrates (Methods) in the presence and absence of cathepsin-specific inhibitors and, for CTSL and CTSB, of an inhibitor of cysteine proteases, E64, and expressed as a percentage of uninhibited activity. The TGPK cleaving activity of lung tryptase was tested with cathepsin-specific inhibitors and expressed as a percentage of uninhibited activity. The activities of β-tryptase (T) and CTSG (G) against Z-Phe-Arg-MCA relative to an equimolar amount of CTSL (L) and of β-tryptase and CTSG against Z-Arg-Arg-MCA relative to an equimolar amount of CTSB are shown in (C). Heparin was included with tryptase and CTSG. Extracts of skin mast cells (D) and HMC-1 cells (E) were assessed for Z-Phe-Arg-MCA and Z-Arg-Arg-MCA cleaving activities (U/ml) in the absence and presence of CA-074, CLIK-148, E64 and E64d, the cell-permeable ethyl ester of E64. Black bars, control and 1 μM inhibitor concentrations; grey bars, control and 5 μM inhibitor concentrations.

The CTS C, B and L inhibitors can be used to further assess and promote the specificity of the CTSB and CTSL assays when both of these enzymes are present. Indeed, the measurement of CTSL activity is performed in the presence of CA-074 (CTSB inhibitor), because CTSB weakly cleaves Z-Phe-Arg-MCA under the conditions used to measure CTSL activity. This is evident in extracts of human primary skin mast cells (Fig. 2D) and HMC-1 cells (Fig. 2E) in which 20% of the Z-Phe-Arg-MCA cleaving activity remains after addition of CLIK-148 (CTSL inhibitor). But in the presence of CA-074 (CTSB inhibitor), all remaining Z-Phe-Arg-MCA cleavage activity is inhibited by CLIK-148. In contrast, the measurement of CTSB activity by cleavage of Z-Arg-Arg-MCA activity is almost completely inhibited by CA-074 in the skin mast cell (Fig. 2C) and HMC-1 cell (Fig. 2D) extracts. Furthermore, the ability of CTSL and CTSB inhibitors and the cysteine protease inhibitor E64 or its cell permeable analog, E64d, to completely inhibit cleavage of these substrates indicates that non-cysteine proteases, including tryptase and CTSG (serine proteases), do not contribute to CTSB and CTSL activity measurements under the conditions employed.

CTSL and CTSB co-localize with tryptase to human mast cell secretory granules

For CSTB and CTSL to process protryptase in cells, they would need to co-localize with protryptase in an acidic compartment. To determine whether cathepsins B and L functionally localize to secretory granules, their release by primary human skin mast cells activated with anti-FcεRIα mAb to degranulate was assessed. As shown in Figure 3, the net% of CTSL released was only 10% lower than that of tryptase, while CTSB net% release was 54% lower. This suggests that most of the CTSL and about half of the CTSB in primary skin mast cells co-localize with tryptase to secretory granules, and presumably traverse the same intracellular pathway.

Figure 3. CTSL and CTSB reside in the secretory granules of skin-derived human mast cells.

Figure 3

Open in a new tab

Skin mast cells were prepared and stimulated with anti-FcεRIα mAb (22E7, 1 μg/ml) for 30 min at 37°C as described (19). Cell extract and media were assayed for tryptase with TGPK, CTSL with Z-Phe-Arg-MCA, CTSB with Z-Arg-Arg-MCA and lactate dehydrogenase (LDH) in the medium and cell extracts. LDH percent release values with unstimulated and 22E7-stimulated cells were less than 5%, and tryptase, CTSL and CTSB release values were less than 5% with unstimulated cells. Net% release values shown represent the mean ± SD for three independent experiments. Net% release values of CTSL (*, p=0.04) and of CTSB (#, p<0.001) were significantly lower than those of tryptase by ANOVA.

CTSL and CTSB silencing with shRNA demonstrates their involvement in protryptase processing in HMC-1 cells

Figure 4 shows the cellular content of cathepsin and tryptase activities in HMC-1 cells that had been stably transfected with CTSB and CTSL shRNA Lentivirus constructs. Marked decreases in CTSB activity occur in response to B55, B57, B59 and Bmix constructs, and smaller decrements occur in response to B56 and B58 constructs (Fig. 4A). In these cells transfected with CTSB shRNA, tryptase expression is attenuated in proportion to that of CTSB, whereas smaller decrements occur with CTSL activity and no change or a slight increase occurs in CTSC activity. This relationship is shown more clearly in Figure 4B, where CTSB shRNA is associated with a 90% loss of CTSB activity, a 30% loss of CTSL activity, a 90% loss of tryptase activity and a 10% increase in CTSC activity. In separate experiments shown in Figure 4C, the impact of CTSB shRNA on protease mRNA as well as activity levels in HMC-1 cells is assessed. Comparative analyses of mRNA expression were done by quantitative real-time RT-PCR using the 2−ΔΔC(t) method. CTSB shRNA causes comparable decreases in cellular levels of CTSB activity and mRNA, a comparable decrease in tryptase activity while tryptase mRNA is unchanged, and no significant changes in cellular levels of CTSL activity and mRNA. Marked decreases in CTSL activity occurred in response to L662 and L98 CTSL shRNA constructs (Fig. 4D). Tryptase activity also diminished, but to a lesser magnitude. Inhibition of CTSL activity by 85% caused a 60% decrease in tryptase activity, but no change in CTSB or CTSC activities. Thus, silencing either CTSB or CTSL has a substantially greater impact on lowering levels of tryptase activity than does silencing CTSC.

Figure 4. ShRNA constructs targeting CTSL and CTSB reduce β-tryptase activity in HMC-1 cells.

Figure 4

Open in a new tab

A. Effect of CTSB shRNA on the activities of tryptase, CTSL, CTSB and CTSC in HMC-1 cells. HMC-1 cells were stably transfected with different CTSB (lanes 1–6, B55, B56, B57, B58, B59 and a mixture of these constructs (Bmix), respectively) and control (lanes C) shRNA constructs and assessed for protease activities. *, p < 0.05 by ANOVA for a significant difference from the corresponding control. B. Correspondence of percent CTSB enzymatic activity to those of CTSC, CTSL and tryptase from A. Linear regression lines (black) and 95% confidence intervals (gray) are shown. The regression equations and r2 values are: 115 − 0.2x and 0.36 for CTSC, 64 + 0.4x and 0.93 for CTSL and −1.7 + 1.1x and 0.98 for tryptase, where x=CTSB cellular activity. C. Effects of CTSB shRNA on protein and mRNA levels of CTSB, CTSL and tryptase (lane numbering corresponds to A). mRNA levels are expressed as *, p<0.05 by ANOVA for a significant difference from the corresponding control. D. Effect of CTSL shRNA on the enzymatic activities of tryptase, CTSL, CTSB and CTSC in HMC-1 cells. HMC-1 cells were stably transfected with different CTSL (lanes 1 (L662) and 2 (L98)) and control (lanes C) shRNA constructs and assessed for protease activities. *, p < 0.05 by ANOVA for a significant difference from the corresponding control.

The effects of these CTS shRNAs on β-(pro)tryptase in HMC-1 cells were further examined by an immunoassay that detects both mature and pro forms of tryptase. Silencing CTSL with L662 and L98 (Fig. 5A) significantly decreases cellular levels of total tryptase by 51% and 57%, respectively, while L662 (but not L98) significantly increases total tryptase levels in the medium by 22%. Silencing CTSB with B55-59 and Bmix constructs (Fig. 5B) significantly decreases cellular levels of total tryptase by 35–46% in B57-59 transfected HMC-1 cells, while all constructs except B58 significantly and substantially increase total tryptase levels in the medium by 1.5 to 2.6-fold. Nearly all of the spontaneously secreted tryptase is protryptase, because mature tryptase is below the limit of detection (<10 ng/106 HMC-1 cell-equivalents in each condition) with a mature tryptase-specific ELISA. Of note, B58 also fails to significantly diminish tryptase activity in HMC-1 cells (Fig. 4A, bar #4). Thus, attenuating protryptase processing in HMC-1 cells by lowering levels of CTSB or CTSL significantly increases the amounts of protryptase being spontaneously secreted by these cells, particularly if CTSB is targeted.

Figure 5. Immunoreactive levels of tryptase in HMC-1 cells stably transfected with CTSL (A), CTSB (B) and control shRNA constructs.

Figure 5

Open in a new tab

Levels of mature and total tryptase (ELISAs) in cell extracts and in media collected over 4 d were determined in 3 independent experiments. *, p<0.05; †, p<0.01; #, p<0.001 when compared to the corresponding control.

Pharmacologic inhibition of either CTSL or CTSB activity in HMC-1 and primary skin mast cells shows that both cathepsins are needed to process protryptase

HMC-1 cells were used to assess the involvement of CTSC and CTSL in the intracellular processing of β-protryptase using pharmacologic inhibitors. Inhibitors of CTSC, CTSL and CTSB incubated with HMC-1 cells each results in a dose-dependent (Fig. 6A) and time-dependent (Fig. 6B) decrease in cell-associated β-tryptase activity by 50% of control or greater. In order to validate the findings with HMC-1 cells in tissue-derived mast cells, primary mast cells obtained from human skin (19) were studied with CTSL, CTSB and CTSC pharmacologic inhibitors. To better detect the effects of these inhibitors on protryptase processing, skin mast cells were first partially depleted of mature tryptase and other secretory granule components by activating these cells to degranulate with anti-FcεRIα mAb. Washed degranulated cells were then placed in culture with SCF alone or together with CTS inhibitors for up to 6 d. Compared to a medium control, treatment for 6 d with CLIK-148 decreased CTSL activity by 88% and CTSB activity by 20%. Treatment with CA074Me decreased CTSB levels by about 83% and CTSL levels by 20%. Treatment with GF-CHN2 had no detectable effect on cellular levels of CTSB and CTSL activities. As shown in Figure 6C tryptase activity declines to 39–48% of control after 6 d with the CTS inhibitors, which is reflected in the representative Western blots in Figure 6D, which show an apparent decline after 6 d of treatment with CTS L, B and C inhibitors of mature tryptase (G5 mAb label), but not of total tryptase (G3 mAb label). In contrast to mature tryptase, β-hexosaminidase activity (Fig. 6E), another secretory granule component, is not significantly affected by any of these inhibitors. Moreover, chymase activity (Fig. 6F) declines to about 45% of control in the presence of the CTSC inhibitor, but is unchanged in the presence of CTSB and CTSL inhibitors. Of further possible interest is that the ratios of protease activities in skin mast cells to HMC-1 cells were 240 for tryptase, 9.7 for CTSB, 5.8 for CTSL and 0.2 for CTSC. The smaller amount of CTSC activity in skin mast cells relative to that in HMC-1 cells compared to the higher amounts of tryptase and the other cathepsins has been confirmed by Western blotting of CTSC protein normalized to that of β-actin, which indicates a CTSC protein ratio in skin mast cells to HMC-1 cells of 0.5.

Figure 6. HMC-1 cells (A,B) and primary skin mast cells (C–E) treated with pharmacologic cathepsin inhibitors.

Figure 6

Open in a new tab

Dose-response (A) and time-course (B) effects of CTSL, CTSB and CTSC pharmacologic inhibitors on β-tryptase activity in HMC-1 cells. HMC-1 cells in culture were incubated with different concentrations of CLIK-148, CA-074Me and GF-CHN2 for 3 d (A) or with each inhibitor (10 μM) for various times (B) and then assessed for tryptase activity in the presence of SBTI with TGPK. Viable cell percentages were always >90%. The average from two independent experiments along with range (error bars) are shown. C–F. Primary skin mast cells. Mast cells derived from human skin that had been activated with anti-FcεRIα mAb (22E7) (0.1 μg/ml for 30 min) (19) were washed and placed into culture in the presence or absence of CLIK148, CA074Me or GF-CHN2 for up to 6 d; medium (SCF ± CTS inhibitors) was replenished on days 2 and 4. Tryptase activity (C), tryptase and β-actin Western blots (D), β-hexosaminidase activity (E) and chymase activity (F) were measured or detected in cell extracts. (activities: mean ± SD, n=3 to 4) †, p<0.001 when compared to the buffer control value at the same time point. The Western blot detects mature (G5 mAb) and total (G3 mAb) tryptase in identical numbers of skin mast cells treated for 6 days as in C and is representative of three experiments. Arrowhead, β-actin; arrow, tryptase.

Discussion

The current study identifies CTSB and CTSL as the two principal processing proteases for β-protryptase in human mast cells. Genes for β-tryptase but not for α-tryptase are present in the HMC-1 cell genome, and mature β-tryptase accounts for essentially all of the tryptase enzymatic activity in both primary skin mast cells and HMC-1 cells, because mature α-tryptase has minimal enzymatic activity. CTSC, based on CTSC gene-specific RNA silencing, may account for a minor portion of β-protryptase processing, but is not critical for mature β-tryptase formation in HMC-1 cells. The prior and current finding that Gly-Phe-CHN2, a putative inhibitor of CTSC, inhibits β-tryptase formation in HMC-1 cells and extracts (3, 4), suggests an off-target effect of this molecule. Also in skin mast cells, this CTSC inhibitor causes a decline in chymase activity, probably because prochymase processing depends upon CTSC (5). However, β-hexosaminidase levels are unchanged by Gly-Phe-CHN2, which argues against a general effect on granule enzymes.

These targeted depletion experiments in HMC-1 cells along with the low level of CTSC activity and protein in primary human skin mast cells are consistent with the finding that CTSC-deficient murine mast cells do produce mature tryptase (5). CTSB and CTSL, which process β and α protryptases to their mature forms in solution (6), appear to process at least β-protryptase while inside human mast cells, because when these enzymes are either silenced with gene-specific shRNA or inhibited by selective pharmacologic agents in situ, cellular levels of mature enzymatically-active β-tryptase are markedly diminished while levels of spontaneously-secreted protryptase are increased. Furthermore, CTSL and CTSB functionally co-localize with β-tryptase to the secretory granules of primary human skin mast cells, positioning these cathepsins to process protryptase during their intracellular migration or upon their arrival in secretory granules.

CTSL and CTSB have been linked to secretory granule pathways and intracellular processing of proenzymes and other proteins in a variety of different cell types (27–29). In chromaffin cells, CTSL processes proenkepahalin to [Met]enkephalin (29). CTSB activates trypsinogen to trypsin in the pancreatic exocrine pathway (28). CTSL and CTSS but not CTSB process proCTSC to its active tetrameric form (30). CTSL plays a critical role in processing invariant chain (Ii) in cortical thymic epithelial cells (31), while the p41 alternative splice variant of Ii binds to and inhibits CTSL (32). CTSL processes antigen in cortical thymic epithelial cells, and thereby influences positive selection of developing CD4+ lymphocytes (33). CTSL deficiency introduced into NOD mice diminishes production of CD4 T cells and attenuates the development of autoimmune diabetes (34). Thymocyte expression of CTSL also is critical for the development of natural killer T cells, perhaps through processing of putative natural CD1d ligands needed for natural killer T cell selection (35).

To validate these cathepsin-dependent processing pathways as being relevant to what happens inside mast cells, shRNA constructs targeting specific cathepsins were employed. Decrements in the cellular activity levels of the targeted cathepsins B and L of greater than 80% correlated with substantial decrements in mature enzymatically-active tryptase levels within HMC-1 cells along with increases in the spontaneous secretion of protryptase. The magnitude of the decline in intracellular tryptase levels was almost equal to the decline in CTSB when CTSB shRNA was used, but was not as great as the decline in CTSL levels when CTSL shRNA was used. Why CTSB silencing appears to be more potent than CTSL silencing at lowering cellular levels of active tryptase is not obvious, but might be explained in part by two of our observations. First, CTSB silencing potentiates the spontaneous secretion of protryptase better than CTSL silencing. Second, CTSB silencing also causes a modest reduction in CTSL levels, whereas silencing CTSL has no effect on CTSB levels. On the other hand, inhibition of CTSL and CTSB with specific pharmacologic antagonists result in comparable declines in β-tryptase activity in both HMC-1 cells and primary human skin mast cells.

Localization of CTSB and CTSL to mast cell secretory granules indicates they will be released into tissues in vivo when mast cells are activated to degranulate, probably bound to proteoglycan, and thereby extends the protease repertoire of the protease:proteoglycan complex of human mast cell secretory granules. CTSL and CTSB act optimally at the acidic pH found in mast cell secretory granules as well as in lysosomes, and are irreversibly inactivated at pH ≥ 7 (36), which should restrict their extracellular activities to sites where the pH is acidic. Such sites might include those where inflammation occurs, such as the asthmatic airway, or where poor vascularity exists, such as regions associated with solid tumors and healing wounds. Heparin and chondroitin sulfate, which co-localize to mast cell secretory granules, bind to and promote the processing of proCTSL (37, 38), and bind even better to mature CTSL and CTSB (39), stabilizing these enzymes at neutral pH.

Why CTSL cannot compensate for CTSB when the latter is silenced and vice-versa is not clear. Purified CTSL and CTSB each readily process α/β protryptases to maturity in solution (6). But within mast cells, silencing or inhibiting either CTSL or CTCB impairs protryptase processing. Silencing CTSB has a modest effect on lowering CTSL levels, while silencing CTSL has no discernible effect on CTSB levels. Perhaps these cathepsins act to do more than just remove the propeptide, and play additional non-redundant roles in the production of mature tryptase or its trafficking to and storage in secretory granules.

In summary, cathepsins L and B play novel non-redundant roles in the processing of human β-protryptase and perhaps of α-protryptase. These cathepsins co-traffic with (pro)tryptases and heparin to human mast cell secretory granules, act at the acidic pH present either before or after entry into this organelle, and are secreted when these cells degranulate, raising an opportunity for them also to act in the extracellular milieu. Furthermore, pharmaceutical agents that enter mast cells and target these cathepsins in vivo are likely to attenuate protryptase processing, increase the spontaneous secretion of protryptases and lead to higher extracellular levels of protryptases in vivo.

Acknowledgments

Human skin acquisition was facilitated by the Virginia Commonwealth University Tissue and Data Acquisition and Analysis Core Facility, the National Disease Research Interchange (http://www.ndriresource.org/), the Cooperative Human Tissue Network (http://www.chtn.nci.nih.gov/) and St. Mary’s Hospital (Richmond, VA).

This work was supported in part by NIH grants R01-AI27517 and U19-AI77435 (to L.B.S.); tissue acquisition was supported in part by the NIH-NCI Cancer Center Core Support Grant P30 CA016059, the Department of Pathology and Massey Cancer Center at VCU.

Footnotes

1

This work was supported in part by NIH grants R01-AI27517 and U19-AI77435 (to L.B.S.).

Disclosures

The authors have declared that no conflicts of interest exist except as follows. L.B.S. receives royalties from VCU that have been collected from Phadia for the tryptase assay.

References

  • 1.Schwartz LB, Lewis RA, Austen KF. Tryptase from human pulmonary mast cells. Purification and characterization. J Biol Chem. 1981;256:11939–11943. [PubMed] [Google Scholar]
  • 2.Schwartz LB, Lewis RA, Seldin D, Austen KF. Acid hydrolases and tryptase from secretory granules of dispersed human lung mast cells. J Immunol. 1981;126:1290–1294. [PubMed] [Google Scholar]
  • 3.Sakai K, Ren S, Schwartz LB. A novel heparin-dependent processing pathway for human tryptase. Autocatalysis followed by activation with dipeptidyl peptidase I. J Clin Invest. 1996;97:988–995. doi: 10.1172/JCI118523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sheth PD, Pedersen J, Walls AF, McEuen AR. Inhibition of dipeptidyl peptidase I in the human mast cell line HMC-1: blocked activation of tryptase, but not of the predominant chymotryptic activity. Biochem Pharmacol. 2003;66:2251–2262. doi: 10.1016/j.bcp.2003.08.002. [DOI] [PubMed] [Google Scholar]
  • 5.Wolters PJ, Pham CTN, Muilenburg DJ, Ley TJ, Caughey GH. Dipeptidyl peptidase I is essential for activation of mast cell chymases, but not tryptases, in mice. J Biol Chem. 2001;276:18551–18556. doi: 10.1074/jbc.M100223200. [DOI] [PubMed] [Google Scholar]
  • 6.Le QT, Min HK, Xia HZ, Fukuoka Y, Katunuma N, Schwartz LB. Promiscuous processing of human α/β-protryptases by cathepsins L, B and C. J Immunol. 2011;186 doi: 10.4049/jimmunol.1001804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kummer JA, Kamp AM, Citarella F, Horrevoets AJ, Hack CE. Expression of human recombinant granzyme A zymogen and its activation by the cysteine proteinase cathepsin C. J Biol Chem. 1996;271:9281–9286. doi: 10.1074/jbc.271.16.9281. [DOI] [PubMed] [Google Scholar]
  • 8.Smyth MJ, McGuire MJ, Thia KY. Expression of recombinant human granzyme B. A processing and activation role for dipeptidyl peptidase I. J Immunol. 1995;154:6299–6305. [PubMed] [Google Scholar]
  • 9.Wilharm E, Parry MA, Friebel R, Tschesche H, Matschiner G, Sommerhoff CP, Jenne DE. Generation of catalytically active granzyme K from Escherichia coli inclusion bodies and identification of efficient granzyme K inhibitors in human plasma. J Biol Chem. 1999;274:27331–27337. doi: 10.1074/jbc.274.38.27331. [DOI] [PubMed] [Google Scholar]
  • 10.Pham CT, Ley TJ. Dipeptidyl peptidase I is required for the processing and activation of granzymes A and B in vivo. Proc Natl Acad Sci U S A. 1999;96:8627–8632. doi: 10.1073/pnas.96.15.8627. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.McGuire MJ, Lipsky PE, Thiele DL. Generation of active myeloid and lymphoid granule serine proteases requires processing by the granule thiol protease dipeptidyl peptidase I. J Biol Chem. 1993;268:2458–2467. [PubMed] [Google Scholar]
  • 12.Adkison AM, Raptis SZ, Kelley DG, Pham CT. Dipeptidyl peptidase I activates neutrophil-derived serine proteases and regulates the development of acute experimental arthritis. J Clin Invest. 2002;109:363–371. doi: 10.1172/JCI13462. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Henningsson F, Yamamoto K, Saftig P, Reinheckel T, Peters C, Knight SD, Pejler G. A role for cathepsin E in the processing of mast-cell carboxypeptidase A. J Cell Sci. 2005;118:2035–2042. doi: 10.1242/jcs.02333. [DOI] [PubMed] [Google Scholar]
  • 14.Sakai K, Long SD, Pettit DA, Cabral GA, Schwartz LB. Expression and purification of recombinant human tryptase in a baculovirus system. Protein Expr Purif. 1996;7:67–73. doi: 10.1006/prep.1996.0010. [DOI] [PubMed] [Google Scholar]
  • 15.Schwartz LB, Min HK, Ren S, Xia HZ, Hu J, Zhao W, Moxley G, Fukuoka Y. Tryptase Precursors Are Preferentially and Spontaneously Released, Whereas Mature Tryptase Is Retained by HMC-1 Cells, Mono-Mac-6 Cells, and Human Skin-Derived Mast Cells. J Immunol. 2003;170:5667–5673. doi: 10.4049/jimmunol.170.11.5667. [DOI] [PubMed] [Google Scholar]
  • 16.Butterfield JH, Weiler D, Dewald G, Gleich GJ. Establishment of an immature mast cell line from a patient with mast cell leukemia. Leukemia Res. 1988;12:345–355. doi: 10.1016/0145-2126(88)90050-1. [DOI] [PubMed] [Google Scholar]
  • 17.Katunuma N, Tsuge H, Nukatsuka M, Asao T, Fukushima M. Structure-based design of specific cathepsin inhibitors and their application to protection of bone metastases of cancer cells. Arch Biochem Biophys. 2002;397:305–311. doi: 10.1006/abbi.2001.2709. [DOI] [PubMed] [Google Scholar]
  • 18.Murata M, Miyashita S, Yokoo C, Tamai M, Hanada K, Hatayama K, Towatari T, Nikawa T, Katunuma N. Novel epoxysuccinyl peptides. Selective inhibitors of cathepsin B, in vitro. FEBS Lett. 1991;280:307–310. doi: 10.1016/0014-5793(91)80318-w. [DOI] [PubMed] [Google Scholar]
  • 19.Kambe N, Kambe M, Kochan JP, Schwartz LB. Human skin-derived mast cells can proliferate while retaining their characteristic functional and protease phenotypes. Blood. 2001;97:2045–2052. doi: 10.1182/blood.v97.7.2045. [DOI] [PubMed] [Google Scholar]
  • 20.Schwartz LB, Bradford TR. Regulation of tryptase from human lung mast cells by heparin. Stabilization of the active tetramer. J Biol Chem. 1986;261:7372–7379. [PubMed] [Google Scholar]
  • 21.Jogie-Brahim S, Min HK, Fukuoka Y, Xia HZ, Schwartz LB. Expression of alpha-tryptase and beta-tryptase by human basophils. J Allergy Clin Immunol. 2004;113:1086–1092. doi: 10.1016/j.jaci.2004.02.032. [DOI] [PubMed] [Google Scholar]
  • 22.Heussen C, Dowdle EB. Electrophoretic analysis of plasminogen activators in polyacrylamide gels containing sodium dodecyl sulfate and copolymerized substrates. Analytical Biochemistry. 1980;102:196–202. doi: 10.1016/0003-2697(80)90338-3. [DOI] [PubMed] [Google Scholar]
  • 23.McGuire MJ, Lipsky PE, Thiele DL. Purification and characterization of dipeptidyl peptidase I from human spleen. Arch Biochem Biophys. 1992;295:280–288. doi: 10.1016/0003-9861(92)90519-3. [DOI] [PubMed] [Google Scholar]
  • 24.Barrett AJ, Kirschke H. Cathepsin B, Cathepsin H, and cathepsin L. Methods Enzymol. 1981;80(Pt C):535–561. doi: 10.1016/s0076-6879(81)80043-2. [DOI] [PubMed] [Google Scholar]
  • 25.Alter SC, Kramps JA, Janoff A, Schwartz LB. Interactions of human mast cell tryptase with biological protease inhibitors. Arch Biochem Biophys. 1990;276:26–31. doi: 10.1016/0003-9861(90)90005-j. [DOI] [PubMed] [Google Scholar]
  • 26.Fukuoka Y, Schwartz LB. The B12 anti-tryptase monoclonal antibody disrupts the tetrameric structure of heparin-stabilized beta-tryptase to form monomers that are inactive at neutral pH and active at acidic pH. J Immunol. 2006;176:3165–3172. doi: 10.4049/jimmunol.176.5.3165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Waguri S, Sato N, Watanabe T, Ishidoh K, Kominami E, Sato K, Uchiyama Y. Cysteine proteinases in GH4C1 cells, a rat pituitary tumor cell line, are secreted by the constitutive and regulated secretory pathways. Eur J Cell Biol. 1995;67:308–318. [PubMed] [Google Scholar]
  • 28.Kukor Z, Mayerle J, Kruger B, Toth M, Steed PM, Halangk W, Lerch MM, Sahin-Toth M. Presence of cathepsin B in the human pancreatic secretory pathway and its role in trypsinogen activation during hereditary pancreatitis. J Biol Chem. 2002;277:21389–21396. doi: 10.1074/jbc.M200878200. [DOI] [PubMed] [Google Scholar]
  • 29.Yasothornsrikul S, Greenbaum D, Medzihradszky KF, Toneff T, Bundey R, Miller R, Schilling B, Petermann I, Dehnert J, Logvinova A, Goldsmith P, Neveu JM, Lane WS, Gibson B, Reinheckel T, Peters C, Bogyo M, Hook V. Cathepsin L in secretory vesicles functions as a prohormone-processing enzyme for production of the enkephalin peptide neurotransmitter. Proc Natl Acad Sci U S A. 2003;100:9590–9595. doi: 10.1073/pnas.1531542100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Dahl SW, Halkier T, Lauritzen C, Dolenc I, Pedersen J, Turk V, Turk B. Human recombinant pro-dipeptidyl peptidase I (cathepsin C) can be activated by cathepsins L and S but not by autocatalytic processing. Biochemistry. 2001;40:1671–1678. doi: 10.1021/bi001693z. [DOI] [PubMed] [Google Scholar]
  • 31.Nakagawa T, Roth W, Wong P, Nelson A, Farr A, Deussing J, Villadangos JA, Ploegh H, Peters C, Rudensky AY. Cathepsin L: Critical role in Ii degradation and CD4 T cell selection in the thymus. Science. 1998;280:450–453. doi: 10.1126/science.280.5362.450. [DOI] [PubMed] [Google Scholar]
  • 32.Guncar G, Pungercic G, Klemencic I, Turk V, Turk D. Crystal structure of MHC class II-associated p41 Ii fragment bound to cathepsin L reveals the structural basis for differentiation between cathepsins L and S. EMBO J. 1999;18:793–803. doi: 10.1093/emboj/18.4.793. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Honey K, Nakagawa T, Peters C, Rudensky A. Cathepsin L regulates CD4+ T cell selection independently of its effect on invariant chain: a role in the generation of positively selecting peptide ligands. J Exp Med. 2002;195:1349–1358. doi: 10.1084/jem.20011904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Maehr R, Mintern JD, Herman AE, Lennon-Dumenil AM, Mathis D, Benoist C, Ploegh HL. Cathepsin L is essential for onset of autoimmune diabetes in NOD mice. J Clin Invest. 2005;115:2934–2943. doi: 10.1172/JCI25485. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Honey K, Benlagha K, Beers C, Forbush K, Teyton L, Kleijmeer MJ, Rudensky AY, Bendelac A. Thymocyte expression of cathepsin L is essential for NKT cell development. Nature Immunology. 2002;3:1069–1074. doi: 10.1038/ni844. [DOI] [PubMed] [Google Scholar]
  • 36.Turk B, Bieth JG, Bjork I, Dolenc I, Turk D, Cimerman N, Kos J, Colic A, Stoka V, Turk V. Regulation of the activity of lysosomal cysteine proteinases by pH-induced inactivation and/or endogenous protein inhibitors, cystatins. Biol Chem Hoppe Seyler. 1995;376:225–230. doi: 10.1515/bchm3.1995.376.4.225. [DOI] [PubMed] [Google Scholar]
  • 37.Fairhead M, Kelly SM, van der Walle CF. A heparin binding motif on the pro-domain of human procathepsin L mediates zymogen destabilization and activation. Biochem Biophys Res Commun. 2008;366:862–867. doi: 10.1016/j.bbrc.2007.12.062. [DOI] [PubMed] [Google Scholar]
  • 38.Kihara M, Kakegawa H, Matano Y, Murata E, Tsuge H, Kido H, Katunuma N. Chondroitin sulfate proteoglycan is a potent enhancer in the processing of procathepsin L. Biol Chem. 2002;383:1925–1929. doi: 10.1515/BC.2002.216. [DOI] [PubMed] [Google Scholar]
  • 39.Almeida PC, I, Nantes L, Chagas JR, Rizzi CC, Faljoni-Alario A, Carmona E, Juliano L, Nader HB, Tersariol IL. Cathepsin B activity regulation. Heparin-like glycosaminogylcans protect human cathepsin B from alkaline pH-induced inactivation. J Biol Chem. 2001;276:944–951. doi: 10.1074/jbc.M003820200. [DOI] [PubMed] [Google Scholar]

RESOURCES