Skip to main content
BMC Medical Genomics logoLink to BMC Medical Genomics
. 2011 Jul 19;4:60. doi: 10.1186/1755-8794-4-60

Digital karyotyping reveals probable target genes at 7q21.3 locus in hepatocellular carcinoma

Hui Dong 1,, Hongyi Zhang 2, Jianping Liang 3, Huadong Yan 4, Yangyi Chen 5, Yan Shen 5, Yalin Kong 2, Shengyue Wang 1, Guoping Zhao 1,5, Weirong Jin 1,5
PMCID: PMC3152898  PMID: 21767414

Abstract

Background

Hepatocellular carcinoma (HCC) is a worldwide malignant liver tumor with high incidence in China. Subchromosomal amplifications and deletions accounted for major genomic alterations occurred in HCC. Digital karyotyping was an effective method for analyzing genome-wide chromosomal aberrations at high resolution.

Methods

A digital karyotyping library of HCC was constructed and 454 Genome Sequencer FLX System (Roche) was applied in large scale sequencing of the library. Digital Karyotyping Data Viewer software was used to analyze genomic amplifications and deletions. Genomic amplifications of genes detected by digital karyotyping were examined by real-time quantitative PCR. The mRNA expression level of these genes in tumorous and paired nontumorous tissues was also detected by real-time quantitative RT-PCR.

Results

A total of 821,252 genomic tags were obtained from the digital karyotyping library of HCC, with 529,162 tags (64%) mapped to unique loci of human genome. Multiple subchromosomal amplifications and deletions were detected through analyzing the digital karyotyping data, among which the amplification of 7q21.3 drew our special attention. Validation of genes harbored within amplicons at 7q21.3 locus revealed that genomic amplification of SGCE, PEG10, DYNC1I1 and SLC25A13 occurred in 11 (21%), 11 (21%), 11 (21%) and 23 (44%) of the 52 HCC samples respectively. Furthermore, the mRNA expression level of SGCE, PEG10 and DYNC1I1 were significantly up-regulated in tumorous liver tissues compared with corresponding nontumorous counterparts.

Conclusions

Our results indicated that subchromosomal region of 7q21.3 was amplified in HCC, and SGCE, PEG10 and DYNC1I1 were probable protooncogenes located within the 7q21.3 locus.

Background

Hepatocellular carcinoma (HCC) is one of the major human malignant tumors worldwide. Accumulation of genetic and epigenetic changes plays an important role in the process of hepatocarcinogenesis. Chromosomal aberration is among the most prevalent genetic alterations observed in HCC [1]. Recurrent chromosomal gains of 1q, 6p, 8q, 17q, and 20q, and losses of 1p, 4q, 5q, 6q, 8p, 9p, 10q, 13q, 16q, 17p, 19p, and 22q in HCC have been documented in previous studies [2-7]. Exploring cancer genome in great details always led to the identification of cancer-associated genes (also referred to as target genes) located within the amplified or deleted chromosomal regions. For example, deletion at 1p36 locus in HCC was reported to be one of the common mechanisms for inactivation of RUNX3, a putative tumor suppressor gene located within this region [8]. Elevated expression level of PTK2 and EIF3S3 genes in HCC was demonstrated to be significantly correlated with amplification of 8q23-q24, indicating a potential role for these genes in progression of HCC [9].

Recent innovations on molecular genetic techniques allowed investigators to perform genome-wide analysis of chromosomal aberrations at high resolution. Among these techniques, array-based comparative genomic hybridization (aCGH), high-density single nucleotide polymorphism (SNP) arrays and digital karyotyping have been proved to be the most effective tools in discovering abnormal chromosomal features [7,10,11]. Instead of generating analog signal intensity in the array-based methods, digital karyotyping is characterized by providing direct, unbiased, precise and quantitative measurement of chromosomal aberrations, with a theoretical resolution as high as 0.004 Mb [12].

In the current study, digital karyotyping was applied to detect chromosomal aberrations in HCC. We found that the amplification at 7q21.3 locus may contribute to the development or progression of HCC. Gains of 7q21 have been observed in tumors such as prostate cancer, colorectal cancer and HCC [13-15]. Tsuji et al. has identified PEG10 as a putative oncogene located within the amplified 7q21 locus in HCC [16]. Our study highlighted that more target genes including SGCE, DYNC1I1, SLC25A13, as well as PEG10, were harbored within the amplicons at 7q21.3 in HCC. Furthermore, up-regulation of SGCE, DYNC1I1 and PEG10 genes were also observed in HCC. These results indicated that amplification of 7q21.3 may be involved in carcinogenesis of HCC, and SGCE, DYNC1I1 and PEG10 were candidate oncogenes located within 7q21.3 locus.

Methods

Tissue samples

Clinical tumorous and corresponding non-tumorous liver tissues were obtained from HBV-positive primary HCC patients who underwent curative surgery. Specimens were kept frozen in liquid nitrogen immediately to avoid any degradation of RNA and/or DNA. Blood of normal individuals was obtained from healthy people who underwent regular physical examination. All samples were collected with informed consent and the study was approved by the Institutional Human Subjects Protection Review Board.

Digital karyotyping

Genomic DNA was isolated from one tumorous liver tissue using DNeasy kit (Qiagen) according to the manufacture's instruction. Then, 10 μg of genomic DNA was used to generate digital karyotyping library as described by Leary et al [17]. However, the concatemers of ditags were not cloned into pZero because 454 Genome Sequencer FLX System (Roche) was applied in large scale sequencing in this study. Instead, the concatemers with adhesive ends of CATG were ligated to a pair of modified adaptors A+ and B+ which provide priming regions for the following emulsion PCR and 454 pyrosequencing. The original Adaptor A and B provided by the GS FLX Standard DNA Library Preparation Kit (Roche) were blunt-ended and could not be ligated to concatemers directly. Thus, we designed a modified Adaptor A+ and B+ with an extruding end which was complementary to the adhesive end of concatemers. The sequences of Adaptor A+ and B+ were as followings: Adaptor A+ forward strand: 5'-CCA TCT CAT CCC TGC GTG TCC CAT CTG TTC CCT CCC TGT CTC AGA CTG CAT G-3'; Adaptor A+ reverse strand: 5'-CAG TCT GAG ACA GGG AGG GAA CAG ATG GGA CAC GCA GGG ATG AG-3'; Adaptor B+ forward strand: 5'-Biotin-CCT ATC CCC TGT GTG CCT TGC CTA TCC CCT GTT GCG TGT CTC AGA CTG CAT G-3'; Adaptor B+ reverse strand: 5'-CAG TCT GAG ACA CGC AAC AGG GGA TAG GCA AGG CAC ACA GGG GA-3'. The underlined basepairs were optional barcode sequences. The following procedures were carried out according to the original protocol [18], and sequencing run was performed on 454 GS FLX instrument. The 21 bp genomic tags were extracted using SAGE2000 software (Invitrogen). The experimentally observed tags were mapped to virtual tags on the genome and their relative frequency was counted to detect genomic amplifications and deletions using Digital Karyotyping Data Viewer software http://cgap.nci.nih.gov/SAGE/DKViewHome. The database of virtual genomic tags was established according to sequences of NCBI Human Genome Assembly Build 37 (released on Aug 2009).

Quantitative PCR

Genomic DNAs were extracted from tumorous liver tissues of 52 HCC patients and peripheral blood lymphocytes of 52 normal individuals using DNeasy kit (Qiagen). PCR reaction mixture of 25 μl was composed of 50 ng genomic DNA, 12.5 μl SYBR Premix Ex Taq (TaKaRa), 250 nM of each primer and appropriate volume of ddH2O. The thermal cycles were performed on ABI Prism 7300 apparatus (Applied Biosystems) with conditions of 95°C for 10 s, followed by 40 cycles of 95°C for 5 s and 60°C for 30 s. Each PCR reaction was performed in triplicate and threshold cycle numbers were averaged. The primers (Table 1) were designed using Primer 3 software http://frodo.wi.mit.edu/primer3/. The repetitive element LINE-1, which is likely to has an equivalent copy number in cancer and normal genomes, was used as an endogenous control for normalization of DNA content.

Table 1.

Primers used for real-time quantitative PCR

Genes Primers Product Size
LINE-1 F: AAAGCCGCTCAACTACATGG
R: TGCTTTGAATGCGTCCCAGAG
149 bp
SGCE F: CAGAGACCTTGCTTCCCTTG
R: CGTCTTATCAGCCACTGCAA
193 bp
DYNC1IC F: ATACAGGACACCCAGGCAAG
R: ACTTCTCGGACCATGTCAGG
138 bp
SLC25A13 F: AGGCAGAGCTGGCAAAATAA
R: TCATGCCTTTTTGATGTGGA
105 bp
PEG10 F: CCAGTTGTCATCCACCACAG
R: TGCAATTTTCCACAGACCAA
219 bp

Quantitative reverse transcription-PCR (RT-PCR)

Total RNAs were extracted from 32 pairs of tumorous and corresponding non-tumorous liver tissues using TRIzol reagent (Invitrogen), and then treated with RNase-free DNaseI (Promega) prior to reverse transcription. The reverse transcription reactions and following quantitative PCR reactions, as well as statistical analysis were done as previously described [19]. GAPDH was used as internal control for normalizing mRNA level. The sequences of primers used for quantitative RT-PCR were listed in Table 2.

Table 2.

Primers used for real-time quantitative RT-PCR

Genes Primers Product Size
GAPDH F: ATGGGTGTGAACCATGAGAAG
R: AGTTGTCATGGATGACCTTGG
106 bp
SGCE F: ATGCAAACACCAGACATCCA
R: TCTGATGTGGCAAGTTCTGC
220 bp
DYNC1IC F: TGTGGTCCCCCGTGCATCCT
R: AGGGCGGATGCCCCCTCAAT
127 bp
SLC25A13 F: TGGCTGAGGCCCAGAGGCAG
R: GCTCCAGCAACAGAACCCAGACC
106 bp
PEG10 F: TCCTGTCTTCGCAGAGGAGT
R: TTCACTTCTGTGGGGATGGA
111 bp

Statistical analysis

Student's t test and Bonferroni correction were applied in the statistical analysis of quantitative PCR and RT-PCR data.

Results

Digital karyotyping of HCC

We applied 454 pyrosequencing in the current study, and obtained a total of 821,252 genomic tags from the digital karyotyping library of HCC, among which 529,162 tags could be mapped to unique loci of human genome (i.e. filtered tags). By aligning these filtered tags across each chromosome using Digital Karyotyping Data Viewer software with a window size of 20, we identified multiple subchromosomal regions of amplification (fold change ≥3) and deletion (fold change ≤0.1) (Additional file 1). Among all these chromosomal aberrations, gains of chromosome 7 were of most interest. As many as fifty amplicons with sizes ranging from 287 bp to 212,814 bp were detected on the q arm of chromosome 7, some of which harbored known genes while some did not (Table 3). The amplified subchromosomal region between 116,320,004 bp and 116,359,984 bp of 7q31 harbored MET gene, a well-known oncogene involved in hepatocarcinogenesis [20,21]. The SGCE gene previously reported to be up-regulated in HCC by our group [19], was identified to reside within an amplicon at 94,187,248 bp--94,227,832 bp of 7q21.3. According to the power calculation method developed by Salani et al, a 3-fold amplification covering 38 kb could be detected with a positive predictive value (PPV) ≥95% if 890,628 experimental tags were obtained [22]. Thus, with 821,252 tags available in this study, the PPV of detecting a 3-fold amplification of 40,584 bp which spans SGCE gene was supposed to be approximately 95%. We also observed that another two genes, DYNC1I1 and SLC25A13 located closely to SGCE, were contained within the amplicons at 7q21.3. Gene expression profile analysis of HCC has implied that SGCE and PEG10 harbored within 7q21.3 locus were putative tumor-associated genes [19]. Thus, our further investigation was focused on 7q21.3 locus, trying to find out more candidate protooncogenes within this amplified subchromosomal region.

Table 3.

Amplicons on chromosome 7 detected by digital karyotyping

No. of amplicons Start Position (bp) End Position (bp) Amplification Size (bp) Known genes contained within amplicons
1 85669352 85675348 5996 --
2 90176250 90233199 56949 PFTK1
3 92170683 92181579 10896 --
4 92402830 92489679 86849 CDK6
5 92525776 92559603 33827 --
6 92621928 92628443 6515 --
7 94153659 94160414 6755 CASD1
8 94187248 94227832 40584 SGCE
9 95575453 95593279 17826 DYNC1I1
10 95625240 95626171 931 DYNC1I1
11 95626365 95634906 8541 DYNC1I1
12 95857177 95888724 31547 SLC25A13
13 95984342 95992052 7710 --
14 96016428 96091391 74963 --
15 96091675 96098719 7044 --
16 96223512 96436326 212814 SHFM1
17 96566511 96585224 18713 --
18 100008093 100031196 23103 ZCWPW1, MEPCE
19 100188936 100202216 13280 FBXO24, PCOLCE
20 100212010 100322730 110720 MOSPD3, TFR2, ACTL6B, GNB2, GIGYF1, POP7, EPO
21 100514082 100516140 2058 --
22 100594842 100615369 20527 MUC12
23 100619990 100633128 13138 MUC12
24 100899076 100900255 1179 --
25 100920401 100933959 13558 --
26 101043124 101046675 3551 EMID2
27 101047291 101056595 9304 EMID2
28 101542859 101587823 44964 CUX1
29 101708443 101725375 16932 CUX1
30 116320004 116359562 39558 MET
31 116359697 116359984 287 MET
32 116516633 116651559 134926 CAPZA2, ST7, ST7OT1, ST7OT4
33 116832388 116859422 27034 ST7, ST7OT3
34 116986284 117113342 127058 ASZ1
35 117258567 117275904 17337 CFTR
36 117301541 117312368 10827 CFTR
37 117348151 117357569 9418 CTTNBP2
38 117371511 117376667 5156 CTTNBP2
39 117487299 117511084 23785 CTTNBP2
40 117575700 117576160 460 --
41 117604668 117718500 113832 --
42 117727390 117773948 46558 --
43 117862904 117882935 20031 ANKRD7
44 117888893 117908976 20083 --
45 118228295 118274830 46535 --
46 118275399 118309895 34496 --
47 118442613 118473838 31225 --
48 118574464 118640670 66206 --
49 149702946 149746115 43169 --
50 153635222 153636533 1311 DPP6

Genomic amplification of SGCE, PEG10, DYNC1I1 and SLC25A13 in HCC

To validate genomic amplifications of SGCE, DYNC1I1 and SLC25A13 detected by digital karyotyping analysis, real-time quantitative PCR was performed in 52 HCC samples and 52 normal individuals. PEG10, a gene located very closely to SGCE in a head-to-head manner, was also selected for examination as a positive control, because both amplification and up-regulation of PEG10 have been observed in HCC [16,23]. The schematic illustration of genes located within subchromosomal region of 7q21.3 (from 94,187,248 bp to 95,968,724 bp) was shown in Figure 1. Amplification of genomic DNA was defined as the DNA level of a HCC sample exceeded the mean plus 2 standard deviations of 52 normal individuals [24]. As shown in Figure 2, genomic amplification of SGCE, PEG10, DYNC1I1 and SLC25A13 was observed in 11 (21%), 11 (21%), 11 (21%) and 23 (44%) of the 52 HCC samples respectively. In the cases of SGCE, PEG10, and SLC25A13 genes, significant differences were observed between HCC samples and normal individuals, with p < 0.05 after Bonferroni correction. However, the DYNC1I1 gene was likely to be a nominal one, with p value of 0.07 after Bonferroni correction (Additional File 2).

Figure 1.

Figure 1

Schematic map of amplicons at 7q21.3 in HCC. (A) Digital karyotyping analysis of chromosome 7 in HCC revealed amplicons at 7q21.3 (indicated by blue bars). (B) Zoom in of the 7q21.3 amplicons. (C) RefSeq genes located within the 7q21.3 amplicons.

Figure 2.

Figure 2

Real-time quantitative PCR validation of digital karyotyping data. Totally 52 normal individuals and 52 HCC samples were examined for genomic DNA level of (A) SGCE, (B) PEG10, (C) DYNC1I1 and (D) SLC25A13 respectively by real-time quantitative PCR. The purple horizontal line represented an average of genomic DNA level of each group. HCC samples which gained genomic amplification of examined genes were shown by red squares.

Up-regulated expression of SGCE, PEG10 and DYNC1I1 in HCC

The transcript expression level of SGCE, PEG10, DYNC1I1 and SLC25A13 genes in tumorous and paired nontumorous tissues were examined in 32 HCC patients by real-time quantitative RT-PCR. As shown in Figure 3 and Additional File 3, mRNA expression level of SGCE, PEG10 and DYNC1I1 genes were up-regulated in tumorous liver tissues compared with corresponding nontumorous counterparts. However, no significant difference was observed in expression level of SLC25A13 between tumorous and nontumorous liver tissues (data not shown). Taken together, these results suggested that SGCE, PEG10 and DYNC1I1 were putative oncogenes at the amplified 7q21.3 locus in HCC.

Figure 3.

Figure 3

Up-regulated gene expression of SGCE, PEG10 and DYNC1I1 in HCC. Real-time quantitative RT-PCR was performed in 32 pairs of HCC and corresponding nontumorous liver tissues. Significant up-regulation of mRNA expression level in HCC was observed in SGCE and PEG10 genes (p < 0.05 after Bonferroni correction), and DYNC1I1 was considered as a nominal gene differently expressed in HCC with p value of 0.09 after Bonferroni correction. Blue bars represented expression level of HCC tumorous tissues, red bars represented nontumorous liver tissues, and horizontal bars represented SD values.

Discussion

In the present study, we applied 454 GS FLX, one of the next-generation sequencing systems, in large-scale sequencing of digital karyotyping library of HCC. To the best of our knowledge, no digital karyotyping data of HCC has been published in public. In most of the digital karyotyping libraries of human brain and colon available from public database http://cgap.nci.nih.gov/SAGE/DKViewHome, tags matched to human genome sequences accounted for 62~69% of total genomic tags (Additional File 4). In our sequencing results, 64% (529,162) of the total 821,252 genomic tags were mapped tags, which was quite consistent with published data. Sequentially aligning these tags along each chromosome led to detection of subtle subchromosomal alterations occurred in HCC, among which the amplification of 7q21.3 drew our special attention.

The role of 7q21 amplification either in HCC cell lines or in primary HCC tumors have been implicated in previous studies [16,23,25]. However, within the subchromosome region7q21.3, only PEG10 has been identified as a potential target gene related to progressive development of HCC [16,23]. Our study suggested that another two genes, SGCE and DYNC1I1, may also be HCC-related protooncogenes within the 7q21.3 locus. Genomic amplification of PEG10, SGCE, DYNC1I1 and SLC25A13 were detected by digital karyotyping analysis of HCC, and validated through real-time quantitative PCR. Among 52 HCC samples we examined, eleven (21%) of them showed genomic amplification of SGCE, PEG10 and DYNC1I1 respectively, and 23 (44%) of them exhibited genomic amplification of SLC25A13. Further examinations on mRNA expression level of these genes found that SGCE, PEG10 and DYNC1I1 were significantly up-regulated in HCC tumorous tissues compared with the paired nontumorous counterparts. Taken together, these findings indicated that in addition to PEG10, SGCE and DYNC1I1 were likely to be candidate targets for the 7q21.3 locus in HCC.

PEG10 has been identified as a putative target gene for the amplification at 7q21, as well as a progression related biomarker for HCC [16,23]. SGCE, the epsilon member of sarcoglycan family, was demonstrated to be involved in myoclonus-dystonia syndrome (MDS) which is characterized by rapid myoclonic jerks and dystonia [26]. Recent studies shed light on a role SGCE may play in tumors, as it was up-regulated in a parallel way with PEG10 in both B-cell chronic lymphocytic leukemia and HCC, and showed low or null microsatellite instability in colorectal cancer [19,27,28]. However, since the function of SGCE and the mechanism of how it participate in tumor progression remains unknown up to now, its differential expression in HCC could only be regarded as a potential tumor-related marker without any concrete function.

DYNC1I1 gene encoded dynein intermediate chains 1, a component of cytoplasmic dynein complex, and participated in recognizing, binding and transporting vesicles, proteins, and RNAs et al [29,30]. DYNC1I1 was also reported to be a reliable positive marker in testing bone marrow stromal cells prepared for tissue engineering and cell therapy [31]. Our study indicated DYNC1I1 was amplified and up-regulated in HCC, pointing to a possible association between this gene and hepatocarcinogenesis. Further studies on DYNC1I1 as well as SGCE are needed to explain the exact roles they may play in HCC and/or other tumors.

Conclusions

In this study, we examined chromosomal aberrations of HCC on a genome-wide scale and found that subchromosomal region of 7q21.3 was amplified in HCC. Genomic amplification of PEG10, SGCE, DYNC1I1 and SLC25A13 genes which located within the 7q21.3 locus were detected in HCC, and up-regulated expression of genes was also found in cases of PEG10, SGCE and DYNC1I1. These results suggested that besides PEG10, SGCE and DYNC1I1 may also be probable target genes in the subchromosomal region of 7q21.3. Further studies are needed to explore functional roles of PEG10, SGCE and DYNC1I1 genes might play in the initiation and/or progression of HCC.

Abbreviations

HCC: hepatocellular carcinoma; PEG10: paternally expressed 10; SGCE: sarcoglycan, epsilon; DYNC1I1: dynein, cytoplasmic 1, intermediate chain 1; SLC25A13: solute carrier family 25, member 13.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

HD designed the experiments, participated in most experiments and drafted the manuscript. HYZ, JPL, HDY and YLK collected the clinical samples. YYC performed the bioinformatics analyses. YS and WRJ constructed the digital karyotyping library and performed qPCR experiments. GPZ and SYW participated in manuscript drafting and revision. All authors read and approved the final manuscript.

Pre-publication history

The pre-publication history for this paper can be accessed here:

http://www.biomedcentral.com/1755-8794/4/60/prepub

Supplementary Material

Additional file 1

Subchromosomal regions of amplification and deletion in HCC detected by digital karyotyping. Digital karyotyping revealed that subchromosomal amplification (fold change ≥3) and deletion (fold change ≤0.1) occurred in multiple chromosomes in HCC.

Click here for file (277KB, DOC)
Additional file 2

Raw data of real-time quantitative PCR validation for genomic DNA level of SGCE, PEG10, DYNC1I1 and SLC25A13 genes. Raw data of genomic DNA level of SGCE, PEG10, DYNC1I1 and SLC25A13 genes in 52 normal individuals and 52 HCC samples were presented in this file. Relative genomic DNA level of SGCE, PEG10, DYNC1I1 and SLC25A13 genes were calculated according to the formula 2Ct(LINE-1)-Ct(target gene). Student's t test and Bonferroni correction were applied in the statistical analysis of raw data.

Click here for file (37.5KB, XLS)
Additional file 3

Raw data of real-time quantitative RT-PCR detection for SGCE, PEG10 and DYNC1I1 genes. Raw data of SGCE, PEG10 and DYNC1I1 gene expression level in 32 pairs of HCC and corresponding nontumorous liver tissues determined by real-time quantitative RT-PCR were presented in this file. Relative expression level of DYNC1I1, SGCE and PEG10 genes were calculated according to the formula 2Ct(GAPDH)-Ct(target gene). Student's t test and Bonferroni correction were applied in the statistical analysis of raw data.

Click here for file (29KB, XLS)
Additional file 4

Data summary of 23 digital karyotyping libraries in public database. In the 23 digital karyotyping libraries available at http://cgap.nci.nih.gov/SAGE/DKViewHome, percentage of tags matched to human genome varied from 48% to 69%, while most of them were between 62% and 69%.

Click here for file (47KB, DOC)

Contributor Information

Hui Dong, Email: dongh@chgc.sh.cn.

Hongyi Zhang, Email: zhhyiyi1487@163.com.

Jianping Liang, Email: liangsugd@vip.sina.com.

Huadong Yan, Email: huadongy588@163.com.

Yangyi Chen, Email: archen2@msn.com.

Yan Shen, Email: shsy7704@sina.com.

Yalin Kong, Email: kongwen@vip.163.com.

Shengyue Wang, Email: wangsy@chgc.sh.cn.

Guoping Zhao, Email: gpzhao@sibs.ac.cn.

Weirong Jin, Email: weirong_jin@shbiochip.com.

Acknowledgements

This study was supported by Shanghai Commission for Science and Technology (07ZR14083).

References

  1. Villanueva A, Newell P, Chiang DY, Friedman SL, Llovet JM. Genomics and signaling pathways in hepatocellular carcinoma. Semin Liver Dis. 2007;27:55–76. doi: 10.1055/s-2006-960171. [DOI] [PubMed] [Google Scholar]
  2. Marchio A, Meddeb M, Pineau P, Danglot G, Tiollais P, Bernheim A, Dejean A. Recurrent chromosomal abnormalities in hepatocellular carcinoma detected by comparative genomic hybridization. Genes Chromosomes Cancer. 1997;18:59–65. doi: 10.1002/(SICI)1098-2264(199701)18:1&#x0003c;59::AID-GCC7&#x0003e;3.0.CO;2-0. [DOI] [PubMed] [Google Scholar]
  3. Wong N, Lai P, Lee SW, Fan S, Pang E, Liew CT, Sheng Z, Lau JW, Johnson PJ. Assessment of genetic changes in hepatocellular carcinoma by comparative genomic hybridization analysis: relationship to disease stage, tumor size, and cirrhosis. Am J Pathol. 1999;154:37–43. doi: 10.1016/S0002-9440(10)65248-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Kusano N, Shiraishi K, Kubo K, Oga A, Okita K, Sasaki K. Genetic aberrations detected by comparative genomic hybridization in hepatocellular carcinomas: their relationship to clinicopathological features. Hepatology. 1999;29:1858–1862. doi: 10.1002/hep.510290636. [DOI] [PubMed] [Google Scholar]
  5. Guan XY, Fang Y, Sham JS, Kwong DL, Zhang Y, Liang Q, Li H, Zhou H, Trent JM. Recurrent chromosome alterations in hepatocellular carcinoma detected by comparative genomic hybridization. Genes Chromosomes Cancer. 2000;29:110–116. doi: 10.1002/1098-2264(2000)9999:9999&#x0003c;::AID-GCC1022&#x0003e;3.0.CO;2-V. [DOI] [PubMed] [Google Scholar]
  6. Chang J, Kim NG, Piao Z, Park C, Park KS, Paik YK, Lee WJ, Kim BR, Kim H. Assessment of chromosomal losses and gains in hepatocellular carcinoma. Cancer Lett. 2002;182:193–202. doi: 10.1016/S0304-3835(02)00083-6. [DOI] [PubMed] [Google Scholar]
  7. Patil MA, Gütgemann I, Zhang J, Ho C, Cheung ST, Ginzinger D, Li R, Dykema KJ, So S, Fan ST, Kakar S, Furge KA, Büttner R, Chen X. Array-based comparative genomic hybridization reveals recurrent chromosomal aberrations and Jab1 as a potential target for 8q gain in hepatocellular carcinoma. Carcinogenesis. 2005;26:2050–2057. doi: 10.1093/carcin/bgi178. [DOI] [PubMed] [Google Scholar]
  8. Mori T, Nomoto S, Koshikawa K, Fujii T, Sakai M, Nishikawa Y, Inoue S, Takeda S, Kaneko T, Nakao A. Decreased expression and frequent allelic inactivation of the RUNX3 gene at 1p36 in human hepatocellular carcinoma. Liver Int. 2005;25:380–388. doi: 10.1111/j.1478-3231.2005.1059.x. [DOI] [PubMed] [Google Scholar]
  9. Okamoto H, Yasui K, Zhao C, Arii S, Inazawa J. PTK2 and EIF3S3 genes may be amplification targets at 8q23-q24 and are associated with large hepatocellular carcinomas. Hepatology. 2003;38:1242–1249. doi: 10.1053/jhep.2003.50457. [DOI] [PubMed] [Google Scholar]
  10. Midorikawa Y, Yamamoto S, Ishikawa S, Kamimura N, Igarashi H, Sugimura H, Makuuchi M, Aburatani H. Molecular karyotyping of human hepatocellular carcinoma using single-nucleotide polymorphism arrays. Oncogene. 2006;25:5581–5590. doi: 10.1038/sj.onc.1209537. [DOI] [PubMed] [Google Scholar]
  11. Wang TL, Maierhofer C, Speicher MR, Lengauer C, Vogelstein B, Kinzler KW, Velculescu VE. Digital karyotyping. Proc Natl Acad Sci USA. 2002;99:16156–16161. doi: 10.1073/pnas.202610899. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Salani R, Chang CL, Cope L, Wang TL. Digital karyotyping: an update of its applications in cancer. Mol Diagn Ther. 2006;10:231–237. doi: 10.1007/BF03256461. [DOI] [PubMed] [Google Scholar]
  13. Strohmeyer DM, Berger AP, Moore DH, Bartsch G, Klocker H, Carroll PR, Loening SA, Jensen RH. Genetic aberrations in prostate carcinoma detected by comparative genomic hybridization and microsatellite analysis: association with progression and angiogenesis. Prostate. 2004;59:43–58. doi: 10.1002/pros.20028. [DOI] [PubMed] [Google Scholar]
  14. Nakao K, Shibusawa M, Ishihara A, Yoshizawa H, Tsunoda A, Kusano M, Kurose A, Makita T, Sasaki K. Genetic changes in colorectal carcinoma tumors with liver metastases analyzed by comparative genomic hybridization and DNA ploidy. Cancer. 2001;91:721–726. doi: 10.1002/1097-0142(20010215)91:4&#x0003c;721::AID-CNCR1057&#x0003e;3.0.CO;2-3. [DOI] [PubMed] [Google Scholar]
  15. Sy SM, Wong N, Lai PB, To KF, Johnson PJ. Regional over-representations on chromosomes 1q, 3q and 7q in the progression of hepatitis B virus-related hepatocellular carcinoma. Mod Pathol. 2005;18:686–692. doi: 10.1038/modpathol.3800345. [DOI] [PubMed] [Google Scholar]
  16. Tsuji K, Yasui K, Gen Y, Endo M, Dohi O, Zen K, Mitsuyoshi H, Minami M, Itoh Y, Taniwaki M, Tanaka S, Arii S, Okanoue T, Yoshikawa T. PEG10 is a probable target for the amplification at 7q21 detected in hepatocellular carcinoma. Cancer Genet Cytogenet. 2010;198:118–125. doi: 10.1016/j.cancergencyto.2010.01.004. [DOI] [PubMed] [Google Scholar]
  17. Leary RJ, Cummins J, Wang TL, Velculescu VE. Digital karyotyping. Nat Protoc. 2007;2:1973–1986. doi: 10.1038/nprot.2007.276. [DOI] [PubMed] [Google Scholar]
  18. Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, Bemben LA, Berka J, Braverman MS, Chen YJ, Chen Z, Dewell SB, Du L, Fierro JM, Gomes XV, Godwin BC, He W, Helgesen S, Ho CH, Irzyk GP, Jando SC, Alenquer ML, Jarvie TP, Jirage KB, Kim JB, Knight JR, Lanza JR, Leamon JH, Lefkowitz SM, Lei M, Li J. et al. Genome sequencing in microfabricated high-density picolitre reactors. Nature. 2005;437:376–380. doi: 10.1038/nature03959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Dong H, Ge X, Shen Y, Chen L, Kong Y, Zhang H, Man X, Tang L, Yuan H, Wang H, Zhao G, Jin W. Gene expression profile analysis of human hepatocellular carcinoma using SAGE and LongSAGE. BMC Med Genomics. 2009;2:5. doi: 10.1186/1755-8794-2-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Boix L, Rosa JL, Ventura F, Castells A, Bruix J, Rodés J, Bartrons R. c-met mRNA overexpression in human hepatocellular carcinoma. Hepatology. 1994;19:88–91. doi: 10.1002/hep.1840190115. [DOI] [PubMed] [Google Scholar]
  21. Ueki T, Fujimoto J, Suzuki T, Yamamoto H, Okamoto E. Expression of hepatocyte growth factor and its receptor c-met proto-oncogene in hepatocellular carcinoma. Hepatology. 1997;25:862–866. doi: 10.1002/hep.510250413. [DOI] [PubMed] [Google Scholar]
  22. Salani R, Chang CL, Cope L, Wang TL. Digital karyotyping: an update of its applications in cancer. Mol Diagn Ther. 2006;10:231–237. doi: 10.1007/BF03256461. [DOI] [PubMed] [Google Scholar]
  23. Ip WK, Lai PB, Wong NL, Sy SM, Beheshti B, Squire JA, Wong N. Identification of PEG10 as a progression related biomarker for hepatocellular carcinoma. Cancer Lett. 2007;250:284–291. doi: 10.1016/j.canlet.2006.10.012. [DOI] [PubMed] [Google Scholar]
  24. Shih IeM, Sheu JJ, Santillan A, Nakayama K, Yen MJ, Bristow RE, Vang R, Parmigiani G, Kurman RJ, Trope CG, Davidson B, Wang TL. Amplification of a chromatin remodeling gene, Rsf-1/HBXAP, in ovarian carcinoma. Proc Natl Acad Sci USA. 2005;102:14004–14009. doi: 10.1073/pnas.0504195102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Sy SM, Wong N, Lai PB, To KF, Johnson PJ. Regional over-representations on chromosomes 1q, 3q and 7q in the progression of hepatitis B virus-related hepatocellular carcinoma. Mod Pathol. 2005;18:686–692. doi: 10.1038/modpathol.3800345. [DOI] [PubMed] [Google Scholar]
  26. Zimprich A, Grabowski M, Asmus F, Naumann M, Berg D, Bertram M, Scheidtmann K, Kern P, Winkelmann J, Müller-Myhsok B, Riedel L, Bauer M, Müller T, Castro M, Meitinger T, Strom TM, Gasser T. Mutations in the gene encoding epsilon-sarcoglycan cause myoclonus-dystonia syndrome. Nat Genet. 2001;29:66–69. doi: 10.1038/ng709. [DOI] [PubMed] [Google Scholar]
  27. Kainz B, Shehata M, Bilban M, Kienle D, Heintel D, Krömer-Holzinger E, Le T, Kröber A, Heller G, Schwarzinger I, Demirtas D, Chott A, Döhner H, Zöchbauer-Müller S, Fonatsch C, Zielinski C, Stilgenbauer S, Gaiger A, Wagner O, Jäger U. Overexpression of the paternally expressed gene 10 (PEG10) from the imprinted locus on chromosome 7q21 in high-risk B-cell chronic lymphocytic leukemia. Int J Cancer. 2007;121:1984–1993. doi: 10.1002/ijc.22929. [DOI] [PubMed] [Google Scholar]
  28. Ortega P, Moran A, Fernandez-Marcelo T, De Juan C, Frias C, Lopez-Asenjo JA, Sanchez-Pernaute A, Torres A, Diaz-Rubio E, Iniesta P, Benito M. MMP-7 and SGCE as distinctive molecular factors in sporadic colorectal cancers from the mutator phenotype pathway. Int J Oncol. 2010;36:1209–1215. doi: 10.3892/ijo_00000604. [DOI] [PubMed] [Google Scholar]
  29. Pfister KK, Shah PR, Hummerich H, Russ A, Cotton J, Annuar AA, King SM, Fisher EM. Genetic analysis of the cytoplasmic dynein subunit families. PLoS Gene. 2006;2:e1. doi: 10.1371/journal.pgen.0020001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kardon JR, Vale RD. Regulators of the cytoplasmic dynein motor. Nat Rev Mol Cell Biol. 2009;10:854–865. doi: 10.1038/nrm2804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Igarashi A, Segoshi K, Sakai Y, Pan H, Kanawa M, Higashi Y, Sugiyama M, Nakamura K, Kurihara H, Yamaguchi S, Tsuji K, Kawamoto T, Kato Y. Selection of common markers for bone marrow stromal cells from various bones using real-time RT-PCR: effects of passage number and donor age. Tissue Eng. 2007;13:2405–2417. doi: 10.1089/ten.2006.0340. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 1

Subchromosomal regions of amplification and deletion in HCC detected by digital karyotyping. Digital karyotyping revealed that subchromosomal amplification (fold change ≥3) and deletion (fold change ≤0.1) occurred in multiple chromosomes in HCC.

Click here for file (277KB, DOC)
Additional file 2

Raw data of real-time quantitative PCR validation for genomic DNA level of SGCE, PEG10, DYNC1I1 and SLC25A13 genes. Raw data of genomic DNA level of SGCE, PEG10, DYNC1I1 and SLC25A13 genes in 52 normal individuals and 52 HCC samples were presented in this file. Relative genomic DNA level of SGCE, PEG10, DYNC1I1 and SLC25A13 genes were calculated according to the formula 2Ct(LINE-1)-Ct(target gene). Student's t test and Bonferroni correction were applied in the statistical analysis of raw data.

Click here for file (37.5KB, XLS)
Additional file 3

Raw data of real-time quantitative RT-PCR detection for SGCE, PEG10 and DYNC1I1 genes. Raw data of SGCE, PEG10 and DYNC1I1 gene expression level in 32 pairs of HCC and corresponding nontumorous liver tissues determined by real-time quantitative RT-PCR were presented in this file. Relative expression level of DYNC1I1, SGCE and PEG10 genes were calculated according to the formula 2Ct(GAPDH)-Ct(target gene). Student's t test and Bonferroni correction were applied in the statistical analysis of raw data.

Click here for file (29KB, XLS)
Additional file 4

Data summary of 23 digital karyotyping libraries in public database. In the 23 digital karyotyping libraries available at http://cgap.nci.nih.gov/SAGE/DKViewHome, percentage of tags matched to human genome varied from 48% to 69%, while most of them were between 62% and 69%.

Click here for file (47KB, DOC)

Articles from BMC Medical Genomics are provided here courtesy of BMC

RESOURCES