Skip to main content
American Journal of Physiology - Gastrointestinal and Liver Physiology logoLink to American Journal of Physiology - Gastrointestinal and Liver Physiology
. 2011 May 12;301(2):G287–G296. doi: 10.1152/ajpgi.00415.2010

Basally activated nonselective cation currents regulate the resting membrane potential in human and monkey colonic smooth muscle

Laura Dwyer 1,*, Poong-Lyul Rhee 2,*, Vanessa Lowe 1, Haifeng Zheng 1, Lauren Peri 1, Seungil Ro 1, Kenton M Sanders 1, Sang Don Koh 1,✉
PMCID: PMC3154607  PMID: 21566016

Abstract

Resting membrane potential (RMP) plays an important role in determining the basal excitability of gastrointestinal smooth muscle. The RMP in colonic muscles is significantly less negative than the equilibrium potential of K+, suggesting that it is regulated not only by K+ conductances but by inward conductances such as Na+ and/or Ca2+. We investigated the contribution of nonselective cation channels (NSCC) to the RMP in human and monkey colonic smooth muscle cells (SMC) using voltage- and current-clamp techniques. Qualitative reverse transcriptase-polymerase chain reaction was performed to examine potential molecular candidates for these channels among the transient receptor potential (TRP) channel superfamily. Spontaneous transient inward currents and holding currents were recorded in human and monkey SMC. Replacement of extracellular Na+ with equimolar tetraethylammonium or Ca2+ with Mn2+ inhibited basally activated nonselective cation currents. Trivalent cations inhibited these channels. Under current clamp, replacement of extracellular Na+ with N-methyl-d-glucamine or addition of trivalent cations caused hyperpolarization. Three unitary conductances of NSCC were observed in human and monkey colonic SMC. Molecular candidates for basally active NSCC were TRPC1, C3, C4, C7, M2, M4, M6, M7, V1, and V2 in human and monkey SMC. Comparison of the biophysical properties of these TRP channels with basally active NSCC (bINSCC) suggests that TRPM4 and specific TRPC heteromultimer combinations may underlie the three single-channel conductances of bINSCC. In conclusion, these findings suggest that basally activated NSCC contribute to the RMP in human and monkey colonic SMC and therefore may play an important role in determining basal excitability of colonic smooth muscle.

Keywords: spontaneous transient inward currents, transient receptor potential channels


in the gastrointestinal (gi) tract, coordinated transit of luminal contents is regulated by a range of factors released from excitatory and inhibitory motor neurons as well as rhythmical electrical activity generated by specialized pacemaker cells known as interstitial cells of Cajal (ICC) (5, 13, 18, 25, 33). Signals from enteric neurons and ICC are transmitted to smooth muscle cells (SMC), where they are integrated into the final acts of excitation and contraction. Thus the specific ionic conductances that regulate resting membrane potential (RMP) in SMC play a critical role in determining the responsiveness of SMC to extrinsic excitatory and inhibitory signals and the basal pattern of contractile activity (25).

RMP of SMC in the colon is significantly less negative than the equilibrium potential for K+ (EK) ions (23), suggesting that an opposing influx of Na+ and/or Ca2+ ions occurs, possibly through nonselective cation channels (NSCC). With RMP regulated to be positive to EK, colonic SMC are more excitable because they lie close to the potential range for activation of voltage-dependent Ca2+ channels (34). Small depolarizing stimuli such as inputs from excitatory motor neurons can accomplish excitation-contraction coupling, and small hyperpolarizing stimuli, such as input from inhibitory motor neurons, can lead to inhibition of contraction. The level of the membrane potential, therefore, is fundamental to colonic motility.

Surprisingly few studies have examined the ionic mechanisms responsible for the relatively depolarized RMP (e.g., −60 to −40 mV) in colonic and other GI muscles. In vascular muscles, such as rabbit pulmonary artery, small background NSCC currents were suggested to shift RMP positive from EK (3). Current-clamp recordings identified a background NSCC in rabbit coronary artery SMC that is activated by lysophosphatidylcholine and contributes to RMP (26). Basally active NSCC have also been suggested to contribute to RMPs in rabbit ear artery and urinary bladder SMC (1, 2, 27).

Human colonic smooth muscles have RMPs of ∼−50 mV (23). Here we tested the hypothesis that NSCC conductances contribute significantly to RMP in SMC. We used voltage- and current-clamp techniques to characterize NSCC in colonic SMC, and RT-PCR was performed on human and monkey colonic smooth muscles and SMC to identify molecular candidates for basally active NSCC.

MATERIALS AND METHODS

Human tissue.

Human colonic specimens were obtained under the guidelines and approval of the Ethical Committee of Samsung Medical Center (Seoul, Korea). Patients of both sexes (24 male and 9 female) ranging in age from 43 to 76 yr underwent surgery mainly for colon cancer. Under anesthesia, diseased colonic tissue was removed along with a small region of healthy tissue (ascending 8, transverse 3, descending 11, sigmoid 12). This healthy tissue was placed in cold Krebs-Ringer buffer (KRB) of the following composition (in mM): 118.5 NaCl, 4.7 KCl, 2.5 CaCl2, 1.2 MgCl2, 23.8 NaHCO3, 1.2 KH2PO4, and 11.0 dextrose.

Animal tissue.

Cynomolgus monkey tissues were obtained from Charles River Preclinical Services (Sparks, NV). The protocol for euthanizing monkeys was approved by the Institutional Animal Care and Use Committee (IACUC) and assures compliance with the United States Department of Agriculture (USDA), Public Health Service (PHS) Office of Laboratory Animal Welfare (OLAW) Policy and the Animal Welfare act (Charles River Laboratories, Preclinical Services, Sparks, NV). Monkeys of either sex (36 monkeys, 2.5–7 yr) were sedated with Ketamine (10 mg/kg) via intramuscular injection to the quadriceps. They were then given Beuthanasia-D solution containing pentobarbital sodium and phenytoin sodium (200 mg/kg) via intravenous therapy followed by exsanguination. The proximal colon was removed, placed in cold KRB, and transported to our laboratory.

Preparation of isolated colonic SMC.

Segments of human and monkey colon were opened and pinned to the base of a dissecting dish containing fresh KRB. The mucosa and submucosa were removed. Freshly dispersed colonic SMC were prepared from colonic muscle strips using Ca2+-free Hank's solution containing (in mM): 125 NaCl, 5.36 KCl, 15.5 NaOH, 0.336 Na2HPO4, 0.44 KH2PO4, 10 glucose, 2.9 sucrose, and 11 Hepes, adjusted to pH 7.4 with Tris. Pieces of muscle were incubated for 50–55 min at 37°C in a Ca2+-free solution (2 ml) containing collagenase (4 mg/ml) (Worthington Biochemical, Lakewood, NJ), trypsin inhibitor (8 mg/ml), fatty acid-free bovine serum albumin (8 mg/ml), papain (2 mg/ml), and l-dithiothreitol (0.3 mg/ml; Sigma-Aldrich, MO). Tissue pieces were washed with Ca2+-free solution and agitated to produce a cell suspension. Dispersed SMC were stored at 4°C. Drops of the cell suspensions were placed on the bottom of a 300-μl chamber mounted on an inverted microscope and allowed to adhere to the bottom for 5 min before recording.

Voltage-clamp and current-clamp methods.

Whole cell voltage-clamp techniques and single-channel recordings (inside-out configuration) were used to record membrane currents from dissociated SMC. Membrane currents were amplified by an Axopatch 200B (Axon Instruments, Foster City, CA) and digitized with an analog-to-digital converter (Digidata 1322, Axon Instruments). Data were collected at 5 kHz, filtered at 2 kHz via Bessel filter, and digitized online with pCLAMP software (version 9, Axon Instruments). The data were analyzed with the use of pCLAMP software (version 10, Axon Instruments). Pipette resistances were 1–2 MΩ for whole cell and 3–5 MΩ for single-channel recordings. Conventional and perforated whole cell (amphotericin B) patch-clamp techniques were used for recording ionic currents under voltage clamp. The RMP was measured using the current-clamp configuration (I = 0). Experiments were performed at room temperature.

Solutions and reagents.

In conventional dialyzed whole cell experiments, the internal solution contained (in mM): 135 KCl, 1.0 EGTA, 0.424 CaCl2, 0.1 Na2GTP, 3 MgATP, 10 glucose, 2.5 creatine phosphate disodium and 10 HEPES. Calculated free Ca2+ was ∼100 nM by Maxchelator software (Stanford University). The external solution was (in mM): 135 NaCl, 5 KCl, 2 CaCl2, 1.2 MgCl2, 10 glucose, 10 HEPES and adjusted to pH 7.4 with Tris (Ca physiological salt solution, CaPSS). In some experiments, extracellular Ca2+ was replaced with equimolar Mn2+ (MnPSS). In Na+ replacement experiments, Na+ was replaced with either equimolar tetraethylammonium (TEA) or with N-methyl-d-glucamine (NMDG) under voltage-clamp conditions. In some experiments SMC were perfused in BaPSS [Ca2+ was replaced with Ba2+ (2 mM)]. To isolate inward currents, the pipette solution contained (in mM): 135 CsCl, 1.0 EGTA, 0.424 CaCl2, 0.1 Na2GTP, 3 MgATP, 10 glucose, 2.5 creatine phosphate disodium, and 10 HEPES. This solution was adjusted to pH 7.2 with Tris. For low-Cl− solution (30 mM), CsCl was replaced with equimolar cesium aspartate (ECl was −40 mV). The calculated junction potential was 7 mV. For perforated patches, amphotericin B (60 mg/ml) was dissolved in DMSO, sonicated, and diluted in the pipette solution to give a final concentration of 270 μg/ml. For inside-out single-channel recordings, the pipette solution contained (in mM): 140 CsCl, 1 EGTA, 0.96 CaCl2, 10 HEPES. Bath solution contained (in mM): 30 CsCl, 110 Cs-aspartate, 1 EGTA, 0.96 CaCl2, and 10 HEPES. Solutions were adjusted to pH 7.4 and 7.2 with Tris, respectively. Certain experiments were used with symmetrical Cl− (140/140 mM). The effects of gadolinium (Gd3+), lanthanum (La3+), nickel (Ni2+), and nicardipine were tested by bath perfusion. For current-clamp recordings (I = 0), SMC were exposed to CaPSS, and the internal solution contained (in mM): 135 KCl, 1.0 EGTA, 0.424 CaCl2, 0.1 Na2GTP, 3 MgATP, 10 glucose, 2.5 creatine phosphate disodium, and 10 HEPES. In current-clamp (I = 0) recordings, external Na+ was reduced to 5 mM with the remaining 130 mM Na+ replaced with NMDG. All chemicals used were purchased from Sigma.

RNA isolation, RT-PCR.

Colonic tissue and SMC were used for molecular studies. SMC were collected by applying suction to the pipette, resulting in aspiration of the cells into the pipette. Total RNA was isolated from human and monkey colonic tissue and SMC using TRIzol reagent (GIBCO, Gaithersburg, MD) according to the manufacturer's instructions. Eluted total RNA was treated with DNase I to remove genomic DNA, which might be isolated along with total RNAs. First-strand cDNA was prepared from the total RNA with a Superscript Reverse Transcriptase kit (GIBCO). One microgram of total RNA was reverse transcribed with 200 U of reverse transcriptase in a 20-μl reaction containing 25 ng of oligo(dT) primer, dNTPs each at 500 μM, 75 mM KCl, 3 mM MgCl2, 10 mM DTT, and 50 mM Tris·HCl (pH 8.3). All primers, β2 macroglobulin (B2M), transient receptor potential (TRP) channel members from subfamilies C, M, and V, were designed from a region spanning at least two exons in reference to cDNAs in the National Center for Biotechnology Information (NCBI) (see Table 1). Each gene cDNA was amplified by RT-PCR with gene-specific primers. RT-PCR was carried out with AmpliTaq polymerase (PE Biosystems, Foster City, CA) in a 2300 thermal cycler (PE Biosystems), and PCR fragments were analyzed by gel electrophoresis (2% agarose). All amplicons were at the expected cDNA size, which showed that they were clean from genomic DNA contamination. RT-PCR analysis was performed on human and monkey tissue, and SMC were collected from four different individuals.

Table 1.

Oligonucleotides used in the TRP channel study

Name Sequences (5′-3′) Tm Size of cDNA, bp Gene Specificity
TRPC1-2 CTGTGGATTATTGGGATGATTTGGTCA 57 138/3611 TRPC1 M/H/MK
TRPC1-2r CACTTTGAGGGCAAAGGTTGCCAA 57 TRPC1 M/H/MK
TRPC2-1 CTCCTCCTGGCTGGGCTTG 58 159/770 TRPC2 M/H
TRPC2-1r GGTGAAGCTGAGCATGCTGGTG 59 Trpc2 M/H
TRPC3-2 CAGCATTCTCAATCAGCCAACACG 57 157/13058 TRPC3 M/H/MK
TRPC3-2r AAGTTCATAACGAAGGCTGGAGATATC 57 TRPC3 M/H/MK
TRPC4-1 CTACCTGATAGCTCCCAAAAGCC 57 152/152 TRPC4 M/H/MK
TRPC4-1r GACCTTGCCTGTTCAAGTCTGAC 57 TRPC4 M/H/MK
TRPC5-3 CATCTCCCTGGTAGTGCTGCTG 59 134/23393 TRPC5 M/H/MK
TRPC5-3r CACCTTCATCAAAGTAACTCATCCAGAG 58 TRPC5 M/H/MK
TRPC5-1 GGATTTTGCAATGAACTCCCTCTACC 58 146/5557 TRPC5 M/H
TRPC5-1r ATGTTGGATATTGCGAAGAGTGCTTC 57 TRPC5 M/H
TRPC6-2 GTGGTCCTTGCTGTTGCCATTG 57 175/9469 TRPC6 M/H/MK
TRPC6-2r CTTCAAATCTGTCAGCTGCATTCATGAC 58 TRPC6 M/H/MK
TRPC7-2 CTCATAATGAGAATCAAGATGTGCCTC 57 136/1167 TRPC7 M/H/MK
TRPC7-2r CAGAATTCCTCATGCCAGCCTG 57 TRPC7 M/H/MK
hTRPM1-1 CGTGGATTGAAGCTCTTCCTTAGC 57 185/23243 TRPM1 H/MK
hTRPM1-1r CTTTCATTGATTTCTTCCAACCTCATTGAC 58 TRPM1 H/MK
hTRPM2-1 CCTGCAGCAAGATCCTGAAGGA 57 155/1574 TRPM2 H/MK
hTRPM2-1r GAGCAGTTTCTGGGCTCTCTCTTC 59 TRPM2 H/MK
hTRPM3-1 GAAGTGTTTGCGGACCAGATAGACC 59 105/37825 TRPM3 H/MK
hTRPM3-1r CACGATCCAAGCTCCTGTCTTGC 59 TRPM3 H/MK
hTRPM4-1 CTGGATGAGCTGCGTTTGGCTG 59 TRPM4 M/H/MK
hTRPM4-1r GAACTCAGGCCGGTCATTCAGCA 59 141/1257 TRPM4 H/MK
TRPM5-1 CAACTGGAACAAGTGTGACATGGTG 58 TRPM5 M/H/MK
hTRPM5-1r CAGCGTGAACACCATGAAGTCCATG 59 127/494 TRPM5 H/MK
TRPM6-1 GAATCAACATGCAGGTCCATATGTGAC 58 174/3159 TRPM6 M/H/MK
hTRPM6-1r TGGCTCAAATACAATATCTCGAGCTAG 57 TRPM6 H/MK
hTRPM7-1 GGTATGTGCGTTTGCTAGATTTTCTAGC 58 180/5749 TRPM7 H/MK
hTRPM7-1r GAGTCCAAGATGGTGCTTCATGAG 57 TRPM7 H/MK
TRPM8-1 AAGCTTCTGCTGGAGTGGAACCAG 59 126/4818 TRPM8 M/H/MK
TRPM8-1r CTTGGGTCTGTCCTTTATGAGAGCC 59 TRPM8 M/H/MK
TRPV1-2 GAGAGCAAGAACATCTGGAAGCTGC 59 204/1502 TRPV1 M/H/MK
TRPV1-2r GATGATGCCCACGTTGGTGTTCC 59 TRPV1 M/H/MK
hTRPV2-1 GATCTGGCTGGACTTCCAGAGTAC 59 110/2460 TRPV2 H/MK
TRPV2-1r TTCAGCACAGCCTTCATCAGGCAC 59 TRPV2 M/H/MK
hTRPV3-1 GCTGAAGAAGCGCATCTTTGCAGC 59 135/910 TRPV3 H/Mk
TRPV3-1r GTCAGCTTGTGCATGAGGAAGTCAG 59 TRPV3 M/H/MK
TRPV4-1 GTGCTGGAGATCCTGGTGTACAAC 59 136/2369 TRPV4 M/H/MK
TRPV4-1r TAGGAGACCACGTTGATGTAGAAGG 58 TRPV4 M/H/MK
hTRPV5-1 CTGCACATCGCTGTTGTGAACCAG 59 159/466 TRPV5 H/MK
TRPV5-1r CACACAGGCAGCAAAGGACAAAG 57 TRPV5 M/H/MK
TRPV6-1 TGGTGCTGGTGACCATGGTGATG 59 189/524 TRPV6 M/H/MK
TRPV6-1r CCATCAGCCAGCAGAATCGCATC 59 TRPV6 M/H/MK
hB2M-1 CTCTTTCTGGCCTGGAGGCTATC 59 B2M H/MK
hB2M-1r GAAGTTGACTTACTGAAGAATGGAGAGCTCTCCATTCTTCAGTAAGTCAACTTC 57 152 B2M H/MK

Reference cDNA sequences for each gene in the NCBI were used to design oligonucleotides.

TRP, transient receptor potential; M, mouse; H, human; MK, monkey.

Statistical analysis.

Data are reported as means ± SE; n is the number of cells tested. Statistical significance was evaluated by Student's t-test. P values <0.05 were considered significant.

RESULTS

Basally activated NSCC in human and monkey colonic SMC.

Whole cell voltage-clamp experiments were performed on single colonic SMC isolated from human and monkey colon smooth muscle under physiological extracellular (CaPSS) and intracellular K+-rich solution (ECl = 0 mV) (see materials and methods). We recorded basally activated inward currents that were composed of two types of inward currents. One was a net inward “holding current” (HC, see red dotted line, Fig. 1, A and Aa), which was the measured current between 0 pA and the red-dotted line as an average over 60 s of recording. The other type of inward currents was spontaneous transient inward currents (STICs, green arrow and asterisk, Fig. 1, A and Aa). Figure 1Aa illustrates how STICs were measured by taking an average of peak currents (green asterisk) over a period of 60 s from the red-dotted line (which represents 0 mV for measuring STIC currents). At a holding potential of −80 mV, the HC recorded from human colonic SMC was −46 ± 3 pA (n = 18, Fig. 1A). The amplitude of STICs ranged from −8 to −60 pA, with an average of −21 ± 2 pA (Fig. 1A). Similar STIC activity was recorded in monkey colonic SMC, where the average amplitude was −12 ± 2 pA (n = 19, Fig. 1B). The average HC was −30 ± 4 pA (Fig. 1B).

Fig. 1.

Fig. 1.

Spontaneous transient inward currents (STICs) recorded in colonic smooth muscle cell (SMC). A and B: under voltage clamp at a holding potential of −80 mV, ongoing inward currents were recorded in human and monkey colonic SMC. This activity was divided into two components: holding current (HC, red-dotted line, A and B) and STICs (green-dotted arrow and asterisk, A and B). Aa: HC that was the measured current (red arrow) between 0 pA and the red-dotted line as an average over a 60-s recording. STICs were measured by taking an average of peak currents (green asterisk, Aa) over a period of 60 s from the red-dotted line (which represents 0 mV for measuring STIC currents). HC and STICs were collectively termed basally activated nonselective cation currents or bINSCC. r denotes single-ramp depolarization from −80 to +80 mV. B: bINSCC were also recorded in monkey colonic SMC. Ca and Da: representative traces illustrating differences in HC and STIC activity at different potentials when ECl was set to −40 mV. Cb–Cc and Db–Dc: current-voltage (I-V) relationships showing average HC and STIC activity at different potentials and this activity reversed at ∼0 mV.

STICs normally refer to activation of Ca2+-activated Cl− channels (4, 10, 20). Therefore, in the next experiments, internal Cl− concentration was decreased to 30 mM in a Cs+-rich solution (see materials and methods), setting ECl to −40 mV. Cells were held from −80 mV to +80 mV for ∼2 min at tested potentials. In human colonic SMC, HC and STICs reversed at ∼0 mV (n = 5, Fig. 1, Ca–Cc). HC and STICs also reversed at ∼0 mV in monkey colonic SMC (n = 4, Fig. 1, Da–Dc). These data indicate that a Cl− conductance does not contribute to basally activated inward currents in human and monkey colonic SMC. Therefore, we termed these basally activated inward currents as “basally activated nonselective cation currents” or bINSCC.

Na+ contributed to bINSCC and membrane potential.

Na+ is a major charge carrier in NSCC (9). In these experiments, Cs+-rich internal solutions were used to exclude contamination by K+ conductances (see materials and methods). External Na+ (135 mM) was replaced with equimolar TEA to test the effect of Na+ removal. HC was significantly reduced from −44 ± 5 to −16 ± 2 pA (n = 5, P < 0.001, Fig. 2, A and C), and STIC activity was also decreased from −22 ± 0.1 to −9 ± 0.2 pA at −80 mV (n = 5, P < 0.001, Fig. 2, A and D) in human colonic SMC. In monkey colonic SMC, HC was significantly reduced from −28 ± 8 to −11 ± 3 pA (n = 6, P < 0.05, Fig. 2, B and C), and STIC activity was decreased from −11 ± 0.1 to −4 ± 0.04 pA at −80 mV (n = 5, P < 0.001, Fig. 2, B and D). We also tested the effect of Na+ replacement with NMDG under voltage-clamp conditions. In human colonic SMC, HC was significantly reduced from −29 ± 3 to −14 ± 1 pA (n = 4, P < 0.05, Fig. 2, E and G), and STIC activity was also decreased from −13 ± 3 to −5 ± 1 pA at −80 mV (n = 4, P < 0.05, Fig. 2, E and H). In monkey colonic SMC, HC was also significantly reduced from −55 ± 8 to −25 ± 2 pA (n = 4, P < 0.05, Fig. 2, F and G), and STIC activity was decreased from −13 ± 2 pA to −5 ± 1 pA at −80 mV (n = 4, P < 0.05, Fig. 2, F and H).

Fig. 2.

Fig. 2.

Na+ contributed to bINSCC. A and B: under voltage clamp, replacement of external Na+ (135 mM) with equimolar tetraethylammonium (TEA) significantly reduced HC and STIC activity in human and monkey colonic SMC. C: summary of the effect of TEA on HC in colonic SMC (human, n = 5; monkey, n = 6). D: summary of the effect of TEA on STICs in colonic SMC (human, n = 5; monkey, n = 5). E and F: similar effect on HC and STIC was seen with replacement of external Na+ (135 mM) with equimolar N-methyl-d-glucamine (NMDG) in human and monkey colonic SMC. G: summary of the effect of NMDG on HC in colonic SMC (human, n = 4; monkey, n = 4). H: summary of the effect of NMDG on STICs in colonic SMC (human, n = 4; monkey, n = 4). *P < 0.05 and ***P < 0.001.

Current-clamp recordings (I = 0) were performed to explore the significance of bINSCC in regulating the RMP in colonic SMC. The pipette solution contained 140 mM K+ in a conventional dialyzed whole cell configuration (see materials and methods). Reduction in external Na+ from 135 mM to 5 mM (replaced with 130 mM NMDG) induced hyperpolarization in human SMC from −31 ± 6 mV to −49 ± 4 mV (n = 4, P < 0.05, Fig. 3A) and in monkey SMC from −34 ± 5 mV to −47 ± 5 mV (n = 4, P < 0.01, Fig. 3C). Transient hyperpolarization was recorded under control conditions in human and monkey SMC. To test the involvement of Ca2+-activated K+ conductance for transient hyperpolarization, we performed NMDG experiments in the presence of TEA (1 mM) (to block large-conductance Ca2+-activated K+ channels) and apamin (300 nM) (a small-conductance Ca2+-activated K+ channel blocker). TEA and apamin treatment gradually reduced the spontaneous transient hyperpolarization (Fig. 3B). In the continued presence of TEA and apamin, application of NMDG (130 mM) still induced significant hyperpolarization from −22 ± 4 mV to −44 mV ± 5 mV (n = 4, P < 0.001, Fig. 3B). Monkey colonic SMC also showed transient hyperpolarization, which was also gradually inhibited by pretreatment of TEA and apamin (Fig. 3D). Furthermore, replacement with NMDG induced significant hyperpolarization from −17 ± 3 mV to −33 ± 3 mV (n = 4, P < 0.001, Fig. 3D). These data suggest that a Na+-permeable conductance (bINSCC) contributes to RMP in colonic SMC.

Fig. 3.

Fig. 3.

Na+ contributed to membrane potential. A: in current clamp (I = 0), a reduction in external Na+ from 135 mM to 5 mM (130 mM NMDG) induced hyperpolarization in human colonic SMC (n = 4). B: pretreatment with TEA (1 mM) and apamin (300 nM) gradually decreased spontaneous transient hyperpolarization. Addition of NMDG in the presence of TEA and apamin also caused hyperpolarization. C and D: similar effect of Na+ replacement with NMDG was recorded in monkey colonic SMC in the absence (C) and presence (D) of TEA and apamin (n = 4).

The effects of NSCC blockers on bINSCC and membrane potential.

The trivalent cations, Gd3+ and La3+, are widely used as NSCC/TRP channel blockers (30). Therefore, we tested their effects on bINSCC. Under voltage-clamp conditions, La3+ (10 μM) significantly decreased the HC from −45 ± 7 pA to −20 ± 2 pA (n = 5, P < 0.001, Fig. 4, A and E) and STIC activity from −17 ± 0.2 pA to −6 ± 0.1 pA (n = 5, P < 0.001, Fig. 4, A and F) in human colonic SMC. Application of La3+ (10 μM) significantly inhibited bINSCC in monkey colonic SMC (HC: n = 4, P < 0.05, and STICs: n = 4, P < 0.001, Fig. 4, B, E, and F). Gd3+ (10 μM) also significantly decreased the HC from −44 ± 7 pA to 16 ± 5 pA (n = 4, P < 0.05, Fig. 4, C and E) and STICs from −24 ± 0.2 pA to −10 ± 0.2 pA (n = 4, P < 0.001, Fig. 4, C and F) in human colonic SMC. Similarly, Gd3+ inhibited both components of bINSCC in monkey colonic SMC (HC: n = 7, P < 0.05, and STICs: n = 6, P < 0.005, Fig. 4, D, E, and F). These inhibitory effects were not reversible after 20-min washout, as previously reported for NSCC in other cells (17, 24).

Fig. 4.

Fig. 4.

NSCC blockers inhibited bINSCC and influenced membrane potential. A and B: addition of the NSCC blocker, La3+ (10 μM), significantly decreased HC and STICs in human and monkey colonic SMC. C and D: Gd3+ also significantly decreased HC and STIC in human and monkey colonic SMC. E: summary of the effects of La3+ and Gd3+ on HC in colonic SMC (La3+ human, n = 5; La3+ monkey, n = 4; Gd3+ human, n = 4; Gd3+ monkey, n = 7). F: summary of the effect of La3+ and Gd3+ on STICs in colonic SMC (La3+ human, n = 5; La3+ monkey, n = 4; Gd3+ human, n = 4; Gd3+ monkey, n = 6). *P < 0.05 and ***P < 0.001. G: in current clamp (I = 0), application of the NSCC blocker, La3+ (10 μM), induced hyperpolarization in human colonic SMC (n = 4, P < 0.05). H: in monkey colonic SMC, Gd3+ (10 μM) induced membrane hyperpolarization (n = 4, P < 0.01).

From these data, we hypothesized that application of these NSCC blockers would significantly alter membrane potential as a result of inhibition of bINSCC. Under current-clamp conditions (I = 0), La3+ (1–10 μM) induced hyperpolarization in human SMC from −37 ± 6 mV to −48 ± 9 mV (n = 4, P < 0.05, Fig. 4G). In monkey colonic SMC, Gd3+ resulted in significant hyperpolarization from −21 ± 2 mV to −34 ± 5 mV (n = 4, P < 0.01, Fig. 4H). These data demonstrate that bINSCC are an important depolarizing influence in colonic SMC.

The effects of divalent cations and TRPM4 blocker on bINSCC.

Replacement of external Ca2+ (2 mM) with equimolar Mn2+ significantly decreased both components of bINSCC in human and monkey colonic SMC (Fig. 5, A–D). We also tested the effects of Mn2+ in the presence of Ca2+ (2 mM). Bath perfusion of Mn2+ (0.5–2 mM) inhibited STICs and HC (data not shown), suggesting that Mn2+ is a blocker of bINSCC. When external Ca2+ (2 mM) was replaced with equimolar Ba2+ (BaPSS, see materials and methods), STICs and HC in monkey colonic SMC were not affected (n = 4, Fig. 5E). We also tested whether Ca2+ influx via voltage-dependent Ca2+ channels affects bINSCC. Blockade of low-threshold voltage-activated Ca2+ channels with Ni2+ (50 μM) had no significant effect on HC or STICs in human SMC (data not shown). The L-type Ca2+ channel blocker, nicardipine, also had no effect on bINSCC in monkey colonic SMC (data not shown). These data suggest that neither T-type nor L-type Ca2+ channels are sources of Ca2+ that contribute to bINSCC activity.

Fig. 5.

Fig. 5.

The effects of divalent cations and transient receptor potential (TRP)M4 blocker on bINSCC. A and B: under voltage clamp, replacement of external Ca physiological salt solution (CaPSS) with MnPSS significantly reduced HC and STIC activity in human and monkey colonic SMC. C: summary of the effect of MnPSS on HC in human and monkey SMC (human, n = 4; monkey, n = 7). D: summary of the effect of MnPSS on STICs in human and monkey SMC (human, n = 4; monkey, n = 4). E: replacement of CaPSS with BaPSS had no effect on bINSCC in monkey SMC. F: representative trace illustrating that the TRPM4 blocker, 9-phenanthrol (100 μM), significantly reduced bINSCC in monkey colonic SMC (n = 4). *P < 0.05 and ***P < 0.001.

It is now well established that TRP channel proteins underlie many NSCC (29). One of the unitary conductances in human and monkey colonic SMC is ∼25 pS (see Figs. 6 and 7). This unitary conductance is similar to TRPM4 channels (23), which are also expressed in human and monkey colonic SMC (see Fig. 8). Thus we tested the effects of the hydroxytricyclic compound, 9-phenanthrol, a selective blocker of TRPM4 currents (15, 16). Application of 9-phenanthrol (100 μM) significantly reduced HC (from −49 ± 9 mV to −29 ± 9 mV, n = 4, P < 0.05) and STICs (from −15 ± 2 pA to −6 ± 1 pA, n = 4, P < 0.05) in monkey colonic SMC (Fig. 5F). These data suggest that TRPM4 currents may be important contributors to bINSCC and setting membrane potential in colonic SMC.

Fig. 6.

Fig. 6.

Single-channel conductances recorded in human colonic SMC. A–C: using the inside-out configuration with symmetrical Cs+ (140 mM, ECl = −40 mV), 3 conductances were recorded in human colonic SMC. A: at a holding potential of −20 mV, single-channel openings were recorded that were −0.8 pA in amplitude (see all-points amplitude histogram, middle). A conductance of 27 pS was calculated by plotting peak channel amplitude at different voltages and fit with linear regression (top, right) (n = 5 of 26 patches). B: at a holding potential of −60 mV, single-channel openings were recorded that had an amplitude of −1.4 pA (middle). The calculated single conductance was 7.5 pS (right) (n = 6 of 26 patches). C: small-conductance single-channel activity revealed noisy-like openings at −60 mV but no channel openings at 0 mV (right) (n = 25 of 26 patches). HP, holding potential.

Fig. 7.

Fig. 7.

Single-channel conductances recorded in monkey colonic SMC. A–C: using the inside-out configuration with symmetrical Cs+ (140 mM), 3 conductances were recorded in monkey colonic SMC. A: at a holding potential of −60 mV, single-channel openings were recorded that were −1.5 pA in amplitude (see all-points amplitude histogram, middle). A conductance of 25 pS was calculated by plotting peak channel amplitude at different voltages and fit with linear regression (top, right) (n = 12 of 68 patches). B: at a holding potential of −80 mV, single-channel openings were recorded that had an amplitude of −0.6 pA (middle). The calculated single conductance was 5 pS (right) (n = 19 of 68 patches). C: small-conductance single-channel activity revealed noisy-like openings. Bottom: expanded time scale from box in top (n = 65 of 68 patches).

Fig. 8.

Fig. 8.

TRP channels expressed in human and monkey colonic tissue and SMC. A and B: RT-PCR analysis was performed on human and monkey colonic tissue and SMC using TRP isoform specific primers for members of the TRPC, TRPM, and TRPV subfamilies. β-2-Macroglobulin (B2M) was used as a control. A and B, top: representative agarose gels illustrating TRP transcripts present in human and monkey colonic tissue, respectively (human tissue, n = 4; monkey tissue, n = 4). A and B, bottom: representative agarose gels of TRP transcripts expressed in human and monkey colonic SMC, respectively. In human colonic tissue TRPC1, -C3, -C4, -C6, -C7, -M2, -M3, -M4, -M6, -M7, -V1, -V2, -V3, -V4, and -V5 transcripts were detected, whereas in human colonic SMC, TRPC6, -M3, -V3, -V4, and -V5 were not expressed. An identical pattern of TRP transcript expression was found in monkey colonic SMC (human colonic SMC samples, n = 4; monkey colonic SMC samples, n = 4). (Note: other bands on gels are primer dimers.)

Single-channel conductances recorded in human and monkey colonic SMC.

Inside-out single-channel recordings were performed to identify single-channel conductances that may be responsible for bINSCC recorded at the whole cell level. Symmetrical Cs+ (140/140 mM, ECl = −40 mV) was used to amplify NSCC (because they are highly permeable to Cs+) and block contamination from K+ conductances. Figure 6A shows single-channel openings recorded at −20 mV in a human colonic SMC. The current-voltage (I-V) relationship was constructed using the all-points amplitude histogram (Fig. 6A, middle and right). The calculated single-channel conductance by linear regression was 27 ± 0.9 pS and reversed at ∼0 mV (n = 5 of 26 patches, Fig. 6A, right). In addition, a 7.5 ± 0.5 pS channel (n = 6 of 26 patches) was recorded at −60 mV (Fig. 6B) as well as noisy small-conductance NSCC channels (n = 25 of 26 patches, Fig. 6C). Because the small-conductance NSCC did not exhibit clear channel openings at −60 mV, an amplitude histogram could not be constructed. No channel openings were found at 0 mV (Fig. 6C, right).

Single channels with conductances similar to those in human SMC were recorded in monkey colonic SMC. Figure 7A demonstrates single-channel openings recorded at −60 mV (−1.5 ± 0.2 pA at −60 mV), which had a slope conductance of 25 ± 0.8 pS (n = 12 of 68 patches). We also recorded 5 ± 0.3 pS channels (n = 19 of 68 patches, Fig. 7B) and small-conductance NSCC channels with indiscrete channel openings (n = 65 of 68 patches, Fig. 7C).

TRP channels expressed in human and monkey colonic tissue and SMC.

We investigated transcriptional expression of TRPC, M and V subfamily members in human and monkey colonic tissue. In Fig. 8, A and B, representative gels show TRP-subfamily member transcripts present from homogenates of muscularis tissues (human samples, n = 4; monkey samples, n = 4). TRP family members found at the tissue level in preliminary experiments (data not shown) were probed and included in representative gels in Fig. 8, A and B (top). Because transcripts at the tissue level could include genes expressed in a variety of cell types (e.g., neurons, ICC, etc), we also examined transcript expression in SMC collected by micropipette (∼200 cells) following enzyme dispersion (see materials and methods). Kit (ICC marker) and PGP9.5 (neuron marker) transcripts were not detected in these cells. In isolated human colonic SMC, TRPC1, C3, C4, C7, V1, V2, M2, M4, M6, and M7 were resolved (bottom, n = 4, Fig. 8A), and the same compliment of TRP channels was expressed in monkey SMC (bottom, n = 4, Fig. 8B). These data indicate that expression of specific TRPC, TRPV, and TRPM subfamily members in SMC is a subset of the total TRP channel expression in the whole muscularis.

DISCUSSION

RMP plays a critical role in setting the basal excitability of GI smooth muscles. The RMP of colonic muscles in humans and nonhuman primates is regulated to be within the range of membrane potentials in which the open probability of voltage-dependent Ca2+ is regulated dynamically (32). Thus small changes in membrane potential can alter Ca2+ entry and affect SMC contraction dramatically. Responses to all other regulatory mechanisms (e.g., ICC pacemaker activity and SMC responses to inflammatory mediators) are superimposed upon this basic, intrinsic property of GI SMC; thus understanding regulation of RMP and the open probability of basally active NSCC is fundamental to understanding colonic motility and the changes in motility that might occur in disease, pregnancy, and aging. In the present study we have shown that NSCC, possibly encoded by specific TRP channel genes, are expressed by human and nonhuman primates.

Studies of vascular smooth muscles and a few visceral muscles have suggested that the relatively positive potentials of SMCs may be related to the balance between basal activation of K+ channels and inward conductances (2, 26). Previous reports have suggested that basally activated NSCC are involved in regulating the RMP in some SMC (1, 2, 26, 27). In the present study, basally activated inward currents reversed at 0 mV in human and monkey SMC (ECl- = −40 mV), suggesting that these currents were nonselective cation conductances (bINSCC). bINSCC were composed of two major types of current: 1) HC, which was a tonic inward current observed at negative holding potentials; 2) STICs, which were transient in nature, but summation of STICs, occurring independently in myriad SMCs within a physiological muscle, could yield a tonic depolarizing influence on the tissue. In voltage-clamp experiments, replacement of external Na+ with equimolar TEA or NMDG significantly reduced STICs and HC, suggesting that Na+ is a major charge carrier for bINSCC. Thus bINSCC raises the net permeability of colonic SMC to Na+ ions, resulting in ongoing Na+ entry. In current-clamp (I = 0), decreasing the influx of Na+ through bINSCC caused significant hyperpolarization of the RMP. Taken together, bINSCC contributes significantly to the regulation of RMP in human and monkey SMC. In addition to the depolarizing influence of constant Na+ entry, this ionic flux would necessitate ongoing Na+/K+ ATPase activity and energy expenditure to continuously maintain the Na+ gradient that powers NSCC. Na+/K+ ATPase has been shown to be independently electrogenic in a variety of smooth muscles, (6, 19); thus this is a secondary regulatory mechanism of RMP in GI SMC that might depend upon bINSCC.

Replacement of Ca2+ with equimolar Mn2+ inhibited bINSCC, suggesting that Ca2+ could be a charge carrier contributing to bINSCC. However, additional studies showed that Mn2+ added in the presence of CaPSS also inhibited bINSCC, suggesting that Mn2+ blocks bINSCC. Further experiments demonstrated that Ni2+ (low-voltage-activated Ca2+ channel blocker), nicardipine (high-voltage-activated Ca2+ channel blocker), and Ba2+ replacement did not affect the magnitude of bINSCC. These data, together with the effects of Na+ replacement, which totally blocked bINSCC, suggest that Ca2+ is only a minor charge carrier in bINSCC. Furthermore, we found that Gd3+ and La3+, which are used to block a variety of NSCC in SMC (24, 26), decreased HC and STICs and induced hyperpolarization. These data support the view that bINSCC play an important role in setting RMP to levels significantly less negative than EK.

TRP channel proteins are widely accepted as molecular candidates for NSCC (31). Several TRP channels have been proposed to play important roles in the regulation of RMP in certain cell types (11, 12). In the present study, analysis of human and monkey colonic SMC revealed TRPC1, C3, C4, C7, M2, M4, M6, M7, V1, and V2 transcript expression. Single-channel experiments revealed three different unitary conductances in human and monkey colonic SMC. Molecular analysis found that SMC from human and monkey expressed identical TRP channels (from the TRPC, M and V subfamilies). An important characteristic that the TRP candidates for these three unitary conductances must exhibit is constitutive activity. Among the TRP channels expressed in human and monkey SMC, TRPC3, C7, M4, M6, M7, and V2 (2, 7, 14, 22, 28) have been reported to exhibit basal activity.

In human colonic SMC, 27-pS, 7.5-pS, and “small” channels were recorded, and, interestingly, near identical conductances were recorded in monkey colonic SMC (25 pS, 5 pS, and small). The reported unitary conductances for TRPM2, C3, M6, M7, and V2 all exceed 40 pS (9). Therefore, on the basis of the two important parameters, single-channel conductance (≤27 pS) and constitutive activity, only TRPM4 and TRPC7 channels satisfy these two criteria. In the present study we found that 1) replacement of Na+ from the external solution inhibited bINSCC and caused hyperpolarization, 2) Ca2+ replacement with Ba2+ did not affect bINSCC activity, 3) 9-phenanthrol blocked HC and STICs in bINSCC of monkey colonic SMC, and 4) one of the single-channel conductances from both species was ∼25 pS. These properties are very similar to those exhibited by TRPM4 including Na+ permeability and divalent impermeability (15, 21), 9-phenanthrol sensitivity (15, 16), and unitary conductance (21). Thus these data suggest that TRPM4 is a major component of bINSCC.

Molecular identification of the two smaller conductances (7.5 pS and small in human; 5 pS and small in monkey) is harder to determine. If the TRP channels expressed in colonic SMC are homomultimers, the smallest conductance expected to be recorded is ∼16 pS through TRPC1 (9). However, specific TRP subunits can form heteromeric channels (8) and can have smaller conductances than their homomeric counterparts (i.e., ≤7.5 pS). Unfortunately few studies have determined the conductances of different combinations of TRP heteromultimers. Future studies will need to involve coimmunoprecipitation analysis of the specific TRP subunits present in colonic SMC.

In summary, our findings indicate that bINSCC play an important role in the maintenance of the RMP in human and monkey SMC. We have also identified that human and monkey SMC express identical TRPC, M and V channels. In particular, TRPM4 and specific TRPC heteromultimer combination(s) could be molecular candidates for bINSCC activity in colonic SMC.

GRANTS

This work was supported by DK 41315 NIH/NIDDK.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

REFERENCES

  • 1. Albert AP, Piper AS, Large WA. Properties of a constitutively active Ca2+-permeable non-selective cation channel in rabbit ear artery myocytes. J Physiol 549: 143–156, 2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Albert AP, Pucovský V, Prestwich SA, Large WA. TRPC3 properties of a native constitutively active Ca2+-permeable cation channel in rabbit ear artery myocytes. J Physiol 571: 361–369, 2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Bae YM, Park MK, Lee SH, Ho WK, Earm YE. Contribution of Ca2+-activated K+ channels and non-selective cation channels to membrane potential of pulmonary arterial smooth muscle cells of the rabbit. J Physiol 514: 747–758, 1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Bolton T. Calcium events in smooth muscles and their interstitial cells; physiological roles of sparks. J Physiol 570: 5–11, 2006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Borjesson L, Nordgren S, Delbro DS. K+-induced neurogenic relaxation of rat distal colon. J Pharmacol Exp Ther 291: 717–724, 1999 [PubMed] [Google Scholar]
  • 6. Burke EP, Sanders KM. Effects of ouabain on background and voltage-dependent currents in canine colonic myocytes. Am J Physiol Cell Physiol 259: C402–C408, 1990 [DOI] [PubMed] [Google Scholar]
  • 7. Cao G, van der Wijst J, van der Kemp A, Zeeland F, Bindels RJ, Hoenderop JG. Regulation of the epithelial Mg2+ channel TRPM6 by estrogen and the associated repressor protein of estrogen receptor activity (REA). J Biol Chem 284: 14788–14795, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Clapham DE. TRP channels as cellular sensors. Nature 426: 517–524, 2003 [DOI] [PubMed] [Google Scholar]
  • 9. Clapham DE, Runnels LW, Strubing C. The TRP ion channel family. Nat Rev Neurosci 2: 387–396, 2001 [DOI] [PubMed] [Google Scholar]
  • 10. Craven M, Sergeant GP, Hollywood MA, McHale NG, Thornbury KD. Modulation of spontaneous Ca2+-activated Cl- currents in the rabbit corpus cavernosum by the nitric oxide-cGMP pathway. J Physiol 15: 495–506, 2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Devi S, Kedlaya R, Maddodi N, Bhat KMR, Weber CS, Valdivia H, Setaluri V. Calcium homeostasis in human melanocytes: role of transient receptor potential melastatin 1 (TRPM1) and its regulation by ultraviolet light. Am J Physiol Cell Physiol 297: C679–C687, 2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Dietrich A, Mederos Y, Schnitzler M, Gollasch M, Gross V, Storch U, Dubrovska G, Obst M, Yildirim E, Salanova B, Kalwa H, Essin K, Pinkenburg O, Luft FC, Gudermann T, Birnbaumer L. Increased vascular smooth muscle contractility in TRPC6−/− mice. Mol Cell Biol 16: 6980–6989, 2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Farrugia G. Role of interstitial cells of Cajal in health and disease. Neurogastroenterol Motil 20: 54–63, 2008 [DOI] [PubMed] [Google Scholar]
  • 14. Fleig A, Penner R. The TRPM ion channel subfamily: molecular, biophysical and functional features. Trends Pharmacol Sci 25: 633–639, 2004 [DOI] [PubMed] [Google Scholar]
  • 15. Gonzales AL, Amberg GC, Earley S. Ca2+ release from the sarcoplasmic reticulum is required for sustained TRPM4 activity in cerebral artery smooth muscle cells. Am J Physiol Cell Physiol 299: C279–C288, 2010 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Grand T, Demion M, Norez C, Mettey Y, Launay P, Becq F, Bois P, Guinamard R. 9-Phenanthrol inhibits human TRPM4 but not TRPM5 cationic channels. Br J Pharmacol 153: 1697–1705, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Halaszovich CR, Zitt C, Jüngling E, Lückhoff A. Inhibition of TRP3 channels by lanthanides. J Biol Chem 275: 37423–37428, 2000 [DOI] [PubMed] [Google Scholar]
  • 18. Huizinga JD. Physiology and pathophysiology of the interstitial cell of Cajal: from bench to bedside. II. Gastric motility: lessons from mutant mice on slow waves and innervations. Am J Physiol Gastrointest Liver Physiol 281: G1129–G1134, 2001 [DOI] [PubMed] [Google Scholar]
  • 19. Janssen LJ, Nana R. Na+/K+ ATPase mediates rhythmic spontaneous relaxations in canine airway smooth muscle. Respir Physiol 108: 187–194, 1997 [DOI] [PubMed] [Google Scholar]
  • 20. Janssen LJ, Sims SM. Histamine activates Cl- and K+ currents in guinea-pig tracheal myocytes: convergence with muscarinic signalling pathway. J Physiol 465: 661–677, 1993 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Launay P, Fleig A, Perraud AL, Scharenberg AM, Penner R, Kinet JP. TRPM4 is a Ca2+-activated non-selective cation channel mediating cell membrane depolarization. Cell 109: 397–407, 2002 [DOI] [PubMed] [Google Scholar]
  • 22. Penna A, Juvin V, Chemin J, Compan V, Monet M, Rassendren FA. PI3-kinase promotes TRPV2 activity independently of channel translocation to the plasma membrane. Cell Calcium 39: 495–507, 2006 [DOI] [PubMed] [Google Scholar]
  • 23. Rae MG, Fleming N, McGregor DB, Sanders KM, Keef KD. Control of motility patterns in the human colonic circular muscle layer by pacemaker activity. J Physiol 510: 309–320, 1998 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Raingo J, Rebolledo A, Iveli F, Grassi de Gende AO, Milesi V. Non-selective cationic channels (NSCC) in smooth muscle cells from human umbilical arteries. Placenta 25: 723–729, 2004 [DOI] [PubMed] [Google Scholar]
  • 25. Sanders KM. Regulation of smooth muscle excitation and contraction. Neurogastroenterol Motil 20: 39–53, 2008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Terasawa K, Nakajima T, Iida H, Iwasawa K, Oonuma H, Jo T, Morita T, Nakamura F, Fujimori Y, Toyo-oka T, Nagai R. Nonselective cation currents regulate membrane potential of rabbit coronary arterial cell: modulation by lysophosphatidylcholine. Circulation 106: 3111–3119, 2002 [DOI] [PubMed] [Google Scholar]
  • 27. Thorneloe KS, Nelson MT. Properties of a tonically active, sodium-permeable current in mouse urinary bladder smooth muscle. Am J Physiol Cell Physiol 286: C1246–C1257, 2004 [DOI] [PubMed] [Google Scholar]
  • 28. Trebak M, Vazquez G, Bird GS, Putney JW., Jr The TRPC3/6/7 subfamily of cation channels. Cell Calcium 33: 451–461, 2003 [DOI] [PubMed] [Google Scholar]
  • 29. Unno T, Matsuyama H, Okamoto H, Sakamoto T, Yamamoto M, Tanahashi Y, Yan HD, Komori S. Muscarinic cationic current in gastrointestinal smooth muscles: signal transduction and role in contraction. Autonom Autocoid Pharmacol 26: 203–217, 2006 [DOI] [PubMed] [Google Scholar]
  • 30. Vazquez G, Wedel BJ, Aziz O, Trebak M, Putney JW., Jr The mammalian TRPC cation channels. Biochim Biophys Acta 1742: 21–36, 2004 [DOI] [PubMed] [Google Scholar]
  • 31. Venkatachalam K, Montell C. TRP channels. Annu Rev Biochem 76: 387–417, 2007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Ward SM, Sanders KM. Upstroke component of electrical slow waves in canine colonic smooth muscle due to nifedipine-resistant calcium current. J Physiol 455: 321–337, 1992 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Wood JD, Alpers DH, Andrews PLR. Fundamentals of Neurogastroenterology. Gut 45: II6–II16, 1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Yuan XJ. Voltage-gated K+ currents regulate resting membrane potential and [Ca2+]i in pulmonary arterial myocytes. Circulation 77: 370–378, 1995 [DOI] [PubMed] [Google Scholar]

Articles from American Journal of Physiology - Gastrointestinal and Liver Physiology are provided here courtesy of American Physiological Society

RESOURCES