Functional interrelationship between the WASF3 and KISS1 metastasis associated genes in breast cancer cells

Abstract

Loss of WASF3 function in breast cancer cells results in loss of invasion phenotypes and reduced metastatic potential. Using oligonucleotide arrays we now demonstrate that knockdown of WASF3 leads to the upregulation of the KISS1 metastasis suppressor gene with concomitant reduced invasion and loss of MMP9 activity. Using a luciferase reporter, KISS1 transcription is significantly increased in the absence of WASF3. Knockdown of KISS1 in WASF3 silenced cells resulted in the recovery of the invasion phenotype. WASF3 knockdown also resulted in elevated IκBα levels in the cytoplasm and reduced levels of NFκB p65/50 subunits in the nucleus. TNFα has been associated with cell invasion through induction of MMP9 production via KISS1 regulation of the NFκB pathway. When WASF3 knockdown cells are treated with TNFα, no effect is seen on invasion or nuclear translocation of NFκB. Thus, coordinated expression patterns of the WASF3 metastasis promoter gene and the KISS1 metastasis suppressor gene appear to exert their influence through inhibition of NFκB signaling which in turn regulates MMP9 production facilitating invasion.

Introduction

The Wiscott-Aldrich syndrome protein (WASP) was the founding member of a family of proteins that now includes N-WASP and three members of the WASF/WAVE family (1). This family of proteins is defined by a highly conserved group of motifs at their C-terminal ends; a WASP-homology-2 domain (WHD/V), a cofilin-homology domain (C) and an acidic domain (A). This VCA domain facilitates actin polymerization through binding monomeric actin and the ARP2/3 complex. We recently showed that inactivation of the WASF3/WAVE3 gene in breast cancer cells results in loss of cell motility and invasion in vitro (2) and metastasis in vivo (3). The loss of cell motility is accompanied by a reduction in lamellipodia formation, even in the presence of normal expression levels of the WAVE1/2 proteins. Thus, the metastasis-promoting function of the WASF3 gene plays a critical and distinct role in coordinating actin dynamics related to cell motility, invasion and metastasis independently of the other WASF family members (2-3). The WASF proteins are normally maintained in an inactivated state in resting cells through the binding of a protein complex including PIR121, HSPC300, Abi1, and Nap125 to the WHD (1). Upon stimulation with growth factors such as PDGF, the WASF complex breaks down allowing binding and activation of the Arp2/3 complex of proteins, resulting in actin polymerization (4-6).

Consistent with its role in promoting metastasis, WASF3 levels are elevated in advanced stage cancers compared to lower grade tumors and normal tissue, and knockdown of WASF3 in breast (7) and prostate cancer (8) cells results in decreased expression and activity of matrix metalloproteinases (MMP). These observations suggest a direct relationship between MMP activity and the metastasis promoting function of WASF3 (7), since in some tumors MMPs have been shown to be related to ECM degradation and cellular invasion (9-10). In particular, MMP9, a type IV collagenase, is essential for destruction of the basement membrane and is associated with tumor progression (11). Although MMP9 has been implicated in the invasion/metastatic phenotype of many cancers, and is regarded as a prognostic indicator in breast cancer patients, the regulation of its expression is still not fully understood (12) and neither is the role of WASF3 in the regulation of its activity.

To obtain a better understanding of molecular mechanisms of action of WASF3, we have undertaken a global survey of gene expression changes following WASF3 knockdown in MDA-MB-231 cells. These studies have shown altered expression levels in a wide range of genes known to be implicated in cell invasion and metastasis and, in particular, revealed an up regulation of KISS1 expression levels with a concomitant decrease in MMP9 levels. KISS1 is a member of the metastasis suppressor family of genes (13-17). Functional analysis now indicates that one of the molecular mechanisms driving WASF3-mediated breast cancer cell migration and invasion is through the suppression of KISS1-mediated, NFκB-dependent MMP9 activation.

MATERIALS AND METHODS

Cell culture and plasmids

MDA-MB-231, SkBr3, BT474, MCF7, MDA-MB-157 and PC3 cell lines were purchased from the American Type Culture Collection (Rockville, MD) and maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS). MDA-MB-231 cells were subjected to aCGH analysis (06/2009) and revealed copy number changes characteristic of this cell line. The full-length open reading frame of the human WASF3 gene was amplified and inserted into the pcDNA3.1 vector to generate the WASF3 overexpression vector. The 4kb KISS1 promoter was cloned from BAC clone RP11–203F10 (accession AL592114) and inserted upstream of a luciferase gene in pGL3 (Promega, Madison, WI) using Kpn I/Xho I sites. The primers used to construct the plasmid of pGL-KISS1₄₀₀₀ are as follows: forward- 5' GGGGTACCAGTTCGAGAACAGACTAGCC 3', reverse- 5' CCGCTCGAGGTTCTCCCCAGCTCCCT 3'. The pNFκB-TA-Luc vector (Clontech, NC) acts as a signal transduction reporter vector that monitors activation of NFκB signal transduction. Lipofectamine (Invitrogen, Carlsbad, CA) was used to deliver the vectors into cells.

Gene silencing by RNA interference

Cell lines were transiently transfected with small interfering RNA (siRNA) using DharmaFECT (Dharmacon RNA Technologies, Lafayette, CO). 21 bp siRNA duplexes targeting WASF1, WASF2, WASF3 (siWASF1, siWASF2 and siWASF3) and a standard control (Dharmacon siCONTROL non-targeting siRNA) were synthesized by Dharmacon. Stealth KISS1 siRNA (siKISS1, HSS142730) and the stealth RNAi negative control duplexes were purchased from Invitrogen (Carlsbad, CA). To generate WASF3 stable knockdown MDA-MB-231 cells, the pSM2 retroviral vectors containing a short hairpin RNA against WASF3 (shRNA1 - V2LHS 261688; shRNA2-V2LHS90825; Open Biosystems, Huntsville, AL) were used for infection. As controls the empty pSM2 vector and an shRNA targeting GFP, were used. Virally infected cells were selected in a medium containing 1.0 μg/ml puromycin (Sigma, NY) for 2 weeks and individual drug-resistant clones were collected and expanded.

Microarray hybridization and data analysis

RNAs were extracted using Trizol reagent (Invitrogen) and the Qiagen RNeasy kit (Qiagen, CA) according to manufacturer's instructions and then evaluated using a Bioanalyzer to assess the quality of the sample. All samples passing this quality control were hybridized to a GeneChip® Human Genome U133A 2.0 Array (Affymetrix, CA) probing 18,400 transcripts and variants. The probe was generated using the Affymetrix 3’ IVT Express protocol. Gene Expression values were created by normalizing the array data using a Quantile Normalization in Partek Genomics Suite and statistical analysis was performed using NIA Array Analysis (http://Igusun.grc.nia.nih.gov/ANOVA/). The log₂ ratios were converted to fold-change values and considered significant if the change from control cells was >2 or < -2 and statistical significance showed a p-value <0.05.

RT-PCR and quantitative RT-PCR (qRT-PCR)

Total RNA was extracted using Trizol (Invitrogen) according to the manufacturer's instructions. cDNA was synthesized using the SuperScript II RT-PCR kit (Invitrogen) with 3 μg of RNA and PCR was performed using gene specific primers (Supplemental Table S1). β-actin was used as a loading control. Quantitative real-time RT-PCR was performed using a BioRad iCycler (Bio-Rad, CA) using BioRad iQ SYBR Green Supermix (Bio-Rad). Gene expression levels were normalized against β-actin. In this assay, primers for human WASF3 were obtained from Sabiosciences (Frederick, MD).

Luciferase reporter gene analysis

Cells were co-transfected with pRL-TK and pGL-KISS1₄₀₀₀ or p-NF-kB-TA-Luc. After 24 or 48 hours, the expression of luciferase gene was determined and normalized using Dual-Luciferase reporter assays (Promega) according to the manufacturer's protocol. Luminescence was measured using a Synergy2 plate reader luminescence module (BioTek).

Matrigel invasion and chemoinvasion assay

Matrigel invasion assays were performed as described previously (18) using transwells (BD biosciences, CA) with 8-μm pore size filters. For the chemoinvasion assay, 5 × 10⁴ cells were placed in the upper chamber which had been precoated with gelatin (0.1%, w/v) and RPMI medium containing 5% FBS with or without TNFα (50 ng/ml, ProSec-TechnoGene Ltd.) was added to the lower chamber. After 20 hrs incubation, the cells were fixed, stained and counted. Each experiment was performed in triplicate.

Nuclear and cytoplasmic protein fractionation and immunoblotting

For nuclear and cytoplasmic extracts, cells were lysed in NE-PER extraction reagent (Pierce, IL) according to the manufacturer's protocol. Protein concentration was determined using the BCA assay. For immunoblotting, 50 μg of cell lysates were resolved in 8-12 % SDS-PAGE gels, and transferred to PVDF membranes (BioRad, CA). Membranes were incubated with the individual primary antibodies at 4°C overnight. Anti-WASF3, anti-MMP9 and anti-IκB were purchased from Cell Signaling Inc., anti-PCNA and anti-β-actin were purchased from Sigma. Anti-NF-κB p50 and anti-NF-κB p65 and anti-KISS1 were purchased from Santa Cruz Biotechnology. The KISS1 antibody recognizes the full length 145 amino acid protein giving a size of ~15 kD on Western blots. Equal protein loading was confirmed by probing for β-actin or PCNA. To remove bound antibody, membranes were incubated in Restore Western blot stripping buffer (Pierce) according to the manufacturer's protocol.

Immunofluorescence microscopy

Immunofluorescence staining was used to determine the translocation of p65 in MDA-MB-231 cells with or without WASF3 shRNA expression after 1 h post TNFα treatment. Briefly, cells were fixed with 4 % paraformaldehyde and permeabilized using 0.1% Triton X-100 in PBS. After washing and blocking, the cells were incubated with a primary antibody against p65 overnight at 4°C. After three washes with PBS, the cells were incubated with an Alexa-conjugated secondary antibody in the dark for 1 h. Slides were mounted with Vectashield mounting medium (Vector Laboratories, Burlingame, CA) containing the DAPI nuclear stain before examination under a fluorescence microscope.

Pro and active matrix metalloproteinase 9 (MMP9) detection

MDA-MB-231 cells were seeded in 12-well plates and grown to 70-80% confluence in 1 ml of DMEM with 2% FBS. After 24 hrs, the media were collected in tubes and centrifuged for 10 min at 10,000g. The pro and active forms of MMP-9 levels released into the media were measured using a Fluorokine MAP human MMP9 kit (R&D Systems, MN) according to the manufacturer's instructions. The fluorescent signal in the sample was determined using a BioRad analyzer at excitation/emission wavelengths of 340 nm/465 nm.

Results

Loss of WASF3 leads to a change in expression of genes associated with cell motility and metastasis

In a preliminary screen, we used two different WASF3 shRNA targeting constructs (see Materials and Methods). Both showed 60-70% knockdown of the WASF3 mRNA (Figure1) compared with cells expressing the empty vector or an shRNA targeting GFP. Stable clones expressing either shRNA1 or shRNA2 all showed WASF3 knockdown (Figure 1 and Supplemental figures S1 and S2). Boyden chamber invasion assays for individual clones from each shRNA series showed a proportional loss of invasion in the WASF3 knockdown cells (Supplemental Figures S1 and S2). These data demonstrate the specificity of the targeting shRNA constructs (which produce the same phenotype) making off-target effects unlikely. The knockdown of WASF3 protein was more pronounced in the clones from the shRNA1 series and so these were analyzed more extensively in subsequent experiments. In these clones, knockdown of WASF3 also showed reduced cell motility in the scratch wound assay and reduced anchorage independent growth ability compared with control clones (Supplemental Figure S1). Three shRNA1 clones (#3, #6, and #8) which did not show knockdown and three clones (#5, #12, and #18) which showed high level knockdown (Figure1) were then selected for gene expression analyses and subsequent studies.

Figure 1. Knockdown of WASF3 affects expression levels of genes associated with cell motility and metastasis.

(A) qRT-PCR analysis (left) of MDA-MB-231 cells transfected with two different shRNAs (shRNA1 and 2) show ~70% downregulation of WASF3 mRNA levels compared with cells transfected with the empty vector or an shRNA targeting GFP, which show the same expression levels at the parental (WT) cells. Both RT-PCR and Western blot analysis (right) confirmed the loss of

WASF3 RNA (above) and protein (below) in selected MDA-MB-231 stable knockdown cell clones (#5, #12, and #18) compared to WASF3-expressing control clones (#3, #6, and #8), and the parental cell lines (WT). β-actin was used as a loading control for both assays. (B) Summary of expression level changes for selected genes associated with cell movement in WASF3 knockdown cells. (C) RTPCR analysis of PDGFA, TFF1, TFF2, and IL8 confirms transcriptional down regulation in WASF3 knockdown clones compared with clones showing no knockdown (#3, #6, #8). (D) qRT-PCR analysis of KISS1 and TFF3 gene expression further demonstrates their altered expression levels in WASF3 knockdown clones which were identical to those seen in the microarray experiment. Relative expression levels (mean ± S.E. from three clones, three repeats for each clone) are presented as a percentage of control expression levels (**p<0.01).

To identify altered gene expression patterns in the knockdown cells, we compared gene expression levels between three different knockdown and three different control clones. 246 genes were identified that showed consistent +/- 2 fold expression level changes, of which, ~35 were associated with cell movement and migration (Figure 1B and Supplementary Table S2). For example, the three members of the trefoil factor family (TFF1, TFF2 and TFF3) were downregulated as well as MUC1. Downregulation of these genes was confirmed using semi-quantitative RT-PCR (Figure 1C) and QRT-PCR (Figure 1D, lower panel). Two other genes important in cell movement, IL8 and PDGFA, were also analyzed using RT-PCR (Figure1C), again confirming their decreased expression in the WASF3 knockdown cells. An especially intriguing observation was the 4-fold up regulation of the KISS1 gene (Figure 1D, upper panel), which has been defined as a metastasis suppressor gene because its overexpression reduces tumor metastasis in breast, ovarian and melanoma cancer cells (13-15).

KISS1 is down regulated in WASF3 knockdown breast and prostate cancer cell lines

The inverse relationship between expression of a metastasis suppressor gene, KISS1, and a metastasis promoter gene, WASF3, suggested a common regulatory interaction between these two genes. To determine whether the same inverse relationship in expression levels was more widespread, we compared endogenous WASF3 and KISS1 protein levels in four breast cancer cell lines (MDA-MB231, SkBr3, MDA-MB-157, and MCF-7). Both MDA-MB-231 and SkBr3 breast cancer cell lines expressed robust WASF3 protein levels compared to MDA-MB-157 and MCF-7 cells. MDA-MB-231 and SkBr3 cells showed relatively low KISS1 expression levels, whereas the MDA-MB-157 and MCF-7 cell lines expressed relatively stronger KISS1 protein levels (Figure 2A). To investigate this possibility further, we overexpressed WASF3 in MDA-MB-231 cells. As anticipated, increased WASF3 protein levels were accompanied by a corresponding reduction of KISS1 protein levels (Figure 2A). In the MCF7 breast cancer cell line, which expresses higher endogenous KISS1 levels (Figure 1A), overexpressing WASF3 leads to an even more pronounced downregulation (Figure 1A), demonstrating that this effect is not limited to the MDA-MB-231 cells. Knockdown of WASF3 in SkBR3 and BT474 cell lines also led to increased expression of KISS1 (Figure 2B). These observations confirmed the inverse relationship between WASF3 and KISS1 expression levels in a wider variety of breast cancer cell lines. We recently also showed that down regulation of WASF3 in prostate cancer cells leads to a loss of invasion and metastasis (8). Although the focus of the current study was breast cancer cells, we also examined this WASF3/KISS1 relationship in the PC3 prostate cancer cell line where, following WASF3 knockdown, KISS1 expression was even more upregulated (Figure 2B). To determine whether the reverse was true, we knocked down KISS1 in breast and prostate cancer cells but this did not result in any expression level changes of WASF3 in these cells (Supplemental Figure S3). Thus, while WASF can influence KISS1 expression, the reverse does not appear to be the case, implying that KISS1 lies downstream of the effects of WASF3.

Figure 2. KISS1 expression is inversely correlated with WASF3 expression in breast and prostate cancer cell lines.

(A) Western blot analyses show an inverse relationship between endogenous KISS1 and WASF3 protein levels in four breast cancer cell lines (left). Overexpression of WASF3 is coincident with down-regulation of KISS1 in both MCF7 and MDA-MB-231 cells (right). (B) Both qRT-PCR (left) and Western blot analysis (right) shows that siRNA silencing of WASF3 results in up-regulation of KISS1 expression in SkBr3 and BT474 breast cancer cells as well as PC3 prostate cancer cells. (C) When a KISS1 promoter reporter construct was introduced in cells expressing WASF3 (parental cells (WT) and a control (#8) clone), luciferase activity was low. In contrast, in cells (#12 and #18) where WASF3 was significantly downregulated, KISS1 promoter activity increased. Data presented are the mean ± S.E. of triplicate experiments (*p < 0.05 and **p<0.01 by Student's t-test). (D) To determine the consequences to KISS1 expression following WASF1 and WASF2 knockdown was assessed. In these experiments, in contrast to knockdown of WASF3 where KISS1 expression increases, there is no change in KISS1 expression following knockdown of WASF1 or WASF2.

Using RT-PCR we also demonstrated that cell lines used in this study all express the GPR54 KISS1 receptor gene (Supplemental Figure S3), and so are competent to respond to the KISS1 signal.

Upregulation of KISS1 transcription in WASF3 knockdown cells

To determine the mechanism of KISS1 upregulation in WASF3 knockdown cells, we introduced a luciferase reporter construct for the KISS1 promoter into MDA-MB-231 cells which showed stable knockdown of WASF3 and compared promoter activity to the parental cells and control clone #8. As shown in Figure 2C, KISS1 promoter activity in the absence of WASF3 is significantly increased compared with the parental cells and control clone #8. These experiments clearly demonstrate that the elevated KISS1 expression levels seen in this system are due to enhanced transcription, which is somehow influenced by WASF3.

KISS1 upregulation is specifically associated with knockdown of the WASF3 family member

The experiments described above demonstrate that knockdown of WASF3 leads to increased KISS1 expression. To determine whether this was specific to the WASF3 family member, we also knocked down the WASF1 and WASF2 genes in MDA-MB-231 cells using siRNA and measured KISS1 expression levels (Figure 2D). In these experiments it was clear that a significant change in KISS1 expression was only observed when WASF3 was down regulated, demonstrating the specificity of the relationship to this particular family member.

Knockdown of WASF3 is associated with reduced MMP9 expression

Our previous studies (2), demonstrated that knockdown of WASF3 was associated with loss of MMP9 activity. This relationship was confirmed in the present series of clones using RT-PCR analysis of MDA-MB-231 cells after stable shRNA knockdown of WASF3 (Figure 3A). Western blot analysis of the WASF3 knockdown clones (#12 and #18) also demonstrated a corresponding increase of KISS1 and decrease of MMP9 proteins (Figure 3B). To explore the potential role of MMP9 on the invasion phenotype of MDA-MB-231 cells, we determined the pro- and active levels of MMP9 secretion in cell supernatants from actively growing parental, control and knockdown cells. MMP9 enzyme concentration was reduced in supernatants from the WASF3 knockdown cells after 24 hours, indicating that knockdown of WASF3 expression is also associated with reduced MMP9 release from these cells (Figure 3C).

Figure 3. Effect of WASF3 on MMP9 and NFκB activity.

(A) RT-PCR analysis shows that knockdown of WASF3 results in reduced MMP9 expression levels. (B) Western blot analysis of representative WASF3-silenced clones (#12 and #18) shows reduced MMP9 protein levels with concomitant increases in KISS1 protein levels. β-actin was used as the loading control in this assay. (C) Quantification of the pro- and active forms of MMP9 in the supernatants of actively growing cells was determined using the Fluorokine MAP assay procedure. Cells showing knockdown of WASF3 expression (#12 and #18) show reduced MMP9 release from MDA-MB-231 cells. (D) Western blot analysis demonstrates increased IκBα levels in the cytoplasm of WASF3-knockdown cell clones (#12 and #18) compared to WASF3-expressing cells (#8). Western blot analysis of nuclear fractions from the same clones and parental cells (WT) demonstrates reduced nuclear levels of NFκB proteins (p50 and p65) in cells without WASF3 expression (below).

Knockdown of WASF3 is associated with higher cytoplasmic IκBα levels and reduced nuclear localization of the p65/p50 subunits of NFκB

KISS1 inhibits MMP9 activity by decreasing nuclear translocation of both the p50 and p65 subunits of NFκB, which bind to the MMP9 promoter (19). Our data suggests that WASF3 promotes MMP9 expression as a result of decreased KISS1 expression. We, therefore, examined how KISS1 expression is affected by NFκB in the stable WASF3 knockdown cells. IκBα (inhibitor of NFκB) is one of the NFκB inhibitory proteins, which functions by masking the nuclear localization signals of NFκB transcription factors and so blocking the ability to bind their target DNA (20-21). Elevated levels of IκBα lead to a reduction of p65/p50 in the nuclear fraction in KISS1 transfectants (20). In WASF3 knockdown cells, Western blot analysis revealed higher levels of cytoplasmic IκBα (Figure 3D). Based on this relationship, we next determined NFκB subunit protein levels in both the cytoplasmic and nuclear compartments in control and WASF3 knockdown cells. Little change was noted in either the p65 or p50 subunit levels in the cytoplasmic fraction in the control cells (Figure 3D), whereas, the levels of both the p65 and p50 subunits were greatly reduced in the nuclear compartment in WASF3 knockdown cells (Figure 3D).

Knockdown of KISS1 increases MMP9 expression and secretion while reversing the migration and invasive phenotype in WASF3 knockdown cells

We have clearly demonstrated that WASF3-depleted cells lose their ability to migrate and invade (Supplementary Figures S1 and S2), and it is known that KISS1 is an important tumor metastasis suppressor gene in a variety of cancer cells (13-15). Additionally, we have evidence that KISS1 blocks MMP9 activity by up-regulating IκB, which subsequently inhibits NFκB activation and nuclear translocation. Thus, it is possible that WASF3 and KISS1 may physically and/or functionally interact to regulate the invasion phenotype. To explore this potential functional relationship between WASF3 and KISS1 further, KISS1 expression was transiently knocked down in two of the stable WASF3-silenced clones (#12 and #18) using siRNA. As shown in Figure 4A, KISS1 expression and protein levels were significantly reduced in both of these clones following exposure to the KISS1 siRNA. Knockdown of KISS1 expression did not alter cell proliferation rate as determine by the MTT assay (data not shown). Using the wound closure assay, inhibiting KISS1 using siRNA had little effect on cell movement in control cells with normal WASF3 expression, although in WASF3 knockdown cells, loss of KISS1 expression significantly promoted cell motility (Figure 4B). This observation further suggests that WASF3 can suppress KISS1 function. The Matrigel Clustering Assay measures the ability of cells to form a homotypic cluster when embedded in Matrigel as a measure of invasion potential. Invasive cells will break down the cluster and cells will migrate from the edges. Cells lacking WASF3 could not break the cluster, unlike control cells. Knockdown of KISS1 in WASF3 knockdown cells also resulted in breakdown of the homotypic cluster and scattering of the cells beyond the colony (Supplementary Figure S3). Using the transwell invasion assay, loss of KISS1 in WASF3-silenced cells is accompanied by increased cell invasion (Figure 4B). Collectively, these results provide convincing evidence that loss of KISS1 enhances cell migration and invasive potential in WASF3-depleted cells, which is consistent with its role as a metastasis suppressor.

Figure 4. Knockdown of KISS1 in WASF3 depleted cells increases invasion and MMP activity.

(A) RT-PCR analysis of knockdown of KISS1 (left) demonstrates reduction to below detectable levels after 72 hours in parental cells. Under these conditions, western blot analysis of WASF3 knockdown cells shows significant loss of KISS1 protein (right). (B) Wound healing assays show increased mobility of WASF3 knockdown clones #12 and #18 after down regulation of KISS1 expression (left), while no significant change was found in control clone #8, with or without silencing KISS1 expression (* p<0.05). Transwell invasion assays show increased invasion after double knockdown of the KISS1 and WASF3 genes (right). (C) Loss of KISS1 in WASF3-depleted cells leads to increased transcription of MMP9 and increased activity of MMP9 in the supernatant. RT-PCR analysis shows that knockdown of KISS1 is associated with up-regulation of MMP9 expression levels in the WASF3-depleted cells (upper panel). Measurement of MMP9 concentration indicates increased pro- and active forms of MMP9 are secreted into the supernatant in WASF3 and KISS1 double knockdown cells compared with the single WASF3 knockdown cells (lower panel). (D) Using a luciferase reporter assay, knockdown of KISS1 in WASF3 depleted cells (#12 and #18) results in increased NFκB activity compared with WASF3-expressing clones (#8).

The observations described above raised the question whether the increased invasiveness associated with loss of KISS1 was related to MMP9 activity. We demonstrated earlier that WASF3 knockdown led to reduced MMP9 expression. To determined whether knockdown of KISS1 alone also affected MMP9 transcriptional levels, as well as the concentration of released MMP9 (activity) in the absence of WASF3, we used siRNA to inhibit KISS1 expression in WASF3 knockdown clones #12 and #18. In both clones, MMP9 expression (Figure 4C) as well as its concentration in the supernatant (Figure 4C) was increased following knockdown of KISS1. These observations further support the suggestion that KISS1 inhibits both MMP9 expression and its enzymatic activity in WASF3-silenced cells.

Next we used the pNFκB-TA-Luc signal transduction reporter vector to investigate the role of KISS1 in controlling NFκB signal transduction in cells with and without WASF3 knockdown. Knockdown of KISS1 in cells expressing WASF3 show no effect on the activation levels of NFκB. In contrast, in cells where WASF3 is knocked down, reduction in KISS1 levels result in a significant increase in NFκB activation (Figure 4D) which demonstrates the ability of KISS1 to control this signaling pathway.

WASF3 knockdown attenuates the migration and invasion response to TNFα

Treatment of various tumor cell lines with TNFα typically results in elevated levels of MMP9 (22). In the WASF3 expressing cell clone #8, TNFα-induced MMP9 transcription in a dose-dependent manner but, in WASF3-silenced cells (#12), TNFα treatment only raised MMP9 levels to minimally detectable levels (Figure 5A, upper panel). To determine whether TNFα treatment can induce cell invasion in WASF3-silenced cells, we used the chemo-invasion transwell assay (23) where cells are challenged to migrate through a gelatin matrix, an important substrate of MMP9. In WASF3 expressing cells (#8), exposure to TNFα significantly increased cell invasion (Figure 5A). In contrast, invasion of the WASF3 knockdown cells was not significant whether or not TNFα was added (Figure 5A), suggesting that, even though TNFα can still induce minimal MMP9 transcription levels after WASF3 knockdown, other mechanisms must be involved in mediating this inhibition of TNFα-induced cell migration. TNFα also induces NFκB activation in breast cancer cells (23). Since KISS1 inhibits this pathway and suppresses cell migration by inhibiting TNFα- induced NFκB nuclear translocation (20, 23, 24), it is possible that the relationship between WASF3 and KISS1 expression, and subsequently modulation of MMP9 transcription, is regulated through NFκB binding to the MMP9 promoter. This action is mediated through IκBα binding to NFκB. Western blot analysis of IkBα levels in the parental cells and control clone #8 following TNFα treatment demonstrates reduced protein levels (Figure 5B). In contrast, WASF3 knockdown cells (#12 and #18) show no change in IκBα levels following TNFα stimulation suggesting a reduced activity of NFκB in these cells and hence reduced MMP9 production. Using the p-NF-kB-TA-Luc reporter construct, cells expressing WASF3 show increased NFκB activity, whereas cells that do not express WASF3 show no significant change in NFκB activity. These data support the role of IκBα in the TNFα response only in WASF3 competent cells (Figure 5B).

Figure 5. Knockdown of WASF3 is associated with down regulation of MMP9 expression, as well as cell migration and invasion response to TNFα.

(A) RT-PCR analysis shows that MMP9 expression levels are up-regulated in a dose-dependent manner following TNFα stimulation in control clone #8, compared with WASF3 knockdown clone #12 (above). Using the chemoinvasion assay (below), TNFα-stimulated cell invasiveness was suppressed in cells showing knockdown of WASF3, whereas the TNFα stimulated control clone (#8) significantly promotes cell invasion. Data (mean ± S.E.) are expressed as the percentage of invasion rate of TNFα-untreated cells (**p<0.01). (B) Western blot analysis (upper panel) demonstrates a TNFα-induced reduction in IκBα levels in parental (WT) and control cells (#8), whereas no significant decrease in IκBα protein levels was seen in WASF3 knockdown cells (#12 and #18). Using a luciferase reporter for NFκB activity (lower panel), WASF3 expressing cells showing reduced IκBα show a concomitant increase in NFκB activity whereas WASF3 depleted cells do not. (C) The chemoinvasion assay indicates that double knockdown cells increase their invasion potential in response to TNFα stimulation. Results (mean ± S.E.) are expressed as the percentage of cell invasion rate of TNFα-untreated cells.

KISS1 blocks TNFα-induced NFκB nuclear translocation in MDA-MB-231 cells (23). Because KISS1 was up-regulated in the absence of WASF3, it was possible that KISS1 may regulate MMP9 through its action on NFκB. Immunofluorescence staining revealed a distinct reduction of p65 nuclear translocation in WASF3 knockdown clones (#12 and #18) compared to that seen in the parental cells and control clone #8 (Supplemental figure S4). If nuclear translocation of these subunits is reduced, then their activity on the MMP9 promoter could be compromised, possibly suggesting why up-regulation of KISS1 expression leads to loss of MMP9 expression following WASF3 knockdown.

Finally, we used the chemoinvasion assay to determine whether knockdown of both WASF3 and KISS1 affected TNFα-induced migration. As expected, in response to TNFα stimulation, cell invasion was increased after simultaneously downregulating both WASF3 and KISS1 (Figure 5C). Taken together, these data support the concept that up-regulation of KISS1 expression in WASF3 knockdown cells contributes to the inhibition of cell metastases and invasion in breast cancer cells, as an important example of the synchronization of interactions between metastasis suppressors and metastasis promoters, where an imbalance of either leads to abnormal cell behavior.

Discussion

The metastatic phenotype is clearly influenced by expression levels of individual genes (26). Since the demonstration that introduction of specific whole chromosomes from normal cells into cancer cells could suppress the invasion phenotype (26-27), an increasing number of genes have now been described that achieve the same outcome (28). These genes are described as metastasis suppressor genes (29). Other genes, such as WASF3, promote the invasion phenotype independently of the malignant phenotype (2) and their downregulation leads directly to a loss of the ability to metastasize (3). In many cases the action of these genes on metastasis has been studied in isolation in individual cell systems but, as we have shown here, and as previously described for the NM23 metastasis suppressor gene (30), it is likely that their influence on metastasis is exerted through the intersection of common pathways. Here we provide evidence supporting this idea, which links the different functions of the metastasis promoting WASF3 gene and the KISS1 metastasis suppressor gene to regulate MMP9 production through disregulation of the NFκB pathway. This model provides at least a partial explanation for the observed effect that WASF3 has on MMP9 expression. Down regulation of WASF3 leads to up regulation of KISS1, which suppresses the nuclear translocation of the NFκB subunits (p65/p50), through upregulation of IκBα, leading to reduced activation of NFκB responsive genes such as the MMP9. This effect has been shown to result from the reduced interaction of NFκB with the MMP9 promoter (20). Molecular and cellular analysis shows reduced nuclear trafficking of NFκB subunits in WASF3 knockdown cells. In HT-1080 cells, KISS1 overexpression also led to a decrease in nuclear translocation of NFκB leading to a specific down regulation of MMP9. This effect appears to be somewhat specific for MMP9, since in HT1080 cells (20) and MDA-MB-231 cells (7), MMP2 expression levels were unaffected by disregulation of either KISS1 or WASF3 respectively.

KISS1 was initially discovered as a tumor metastasis suppressor gene (13-15, 30-31) and overexpression of KISS1 reduces invasion and migration in MDA-MB-435 cells (13). Loss of KISS1 expression has been noted in metastatic breast, pancreatic, bladder, and esophageal cancers (30-32). In transient transfection assays using luciferase reporter constructs, KISS1 expression is driven through the binding of the AP-2α and SP1 transcription factors to its promoter (34). In our studies, using a promoter reporter construct, upregulation of KISS1 in WASF3 depleted cells resulted from increased transcription.

The primary KISS1 transcript produces a 145 amino acid protein known as Kisspeptin. Following proteolytic processing smaller peptides (Kp54, Kp14, and Kp13) are generated which are defined by their amino acid length and constitute the family of kisspeptins (32, 35). A synthetic peptide, Kp-10, which retains receptor binding activity (35) appears to inhibit tumor angiogenesis by blocking Sp1-mediated VEGF expression (36). The correlation between downregulation of WASF3 and upregulation of KISS1 suggests one mechanism for the control of VEGF. Knockdown of WASF3 was shown to result in reduced VEGF expression in vivo, where the number and size of microvessels in the tumors that formed from these cells were significantly reduced (3). This observation also provides an explanation for the reduced tumorigenicity in WASF3 depleted cells. Our gene expression analysis identified >35 disregulated genes involved in tumor invasion and metastasis as a result of knockdown of WASF3. Some of these events are probably consequences of the disruption of NFκB signaling. For example, IL8 is transcriptionally responsive to NFκB, and it is frequently up regulated in metastatic cells. Overexpression of exogenous IL8 promotes the metastatic phenotype in breast cancer cells (37). IL8 has other effects on tumor progression and has been shown to promote neovascularization in tumors, which may contribute to the hypovascularization in tumors from the WASF3 knock down cells. Loss of WASF3 showed significant changes in many other genes, some of which, such as ICAM1, IL8, IL1B, and TGM2, have been shown to be direct targets of NFκB (http://bioinfo.lifi.fr/NF-KB/) and these genes are also down regulated in the knockdown cells. Interestingly, IL11 is also a target of NFκB but shows up regulation, suggesting an independent control mechanism in this system. Other genes down regulated in response to WASF3 knockdown include the TFF family which have been shown to promote metastasis (38), in this case apparently independently of NFκB, and their down regulation may contribute to loss of invasion seen in WASF3 depleted MDA-MB-231 cells. The analysis of the TFF genes was beyond the scope of the present report.

TNFα is a proinflammatory cytokine, whose chronic elevated expression has been directly linked to the promotion and progression of human cancer (25). There is strong evidence implicating the chronic production of TNFα with invasion and motility of cancer cells through induction of MMP9 expression activated through the NFκB pathway (20, 25). TNFα is also highly expressed in the tumor microenvironment and modulates NFκB, transcriptional activation of apoptosis, angiogenesis, invasion, and metastasis (20). NFκB is found in a complex with IκB in the cytoplasm of unstimulated cells. Following stimulation with phorbol esters, or cytokines such as TNFα and interleukin 1, NFκB dissociates from IκB and can then migrate into the nucleus, where it regulates transcription of its target genes. Consistent with this observation is the upregulation of KISS1 in WASF3 knockdown cells, which in turn interferes with TNFα-induced NFκB nuclear translocation, resulting in a decrease in MMP9 promoter activation, which could account for the negligible change seen in cell invasion following TNFα stimulation in these cells. Interestingly, the KISS1 protein forms a complex with pro-MMP and, following activation cleaves the KISS1 protein (39) suggesting a feedback loop exists between these two factors.

As with its other family members, WASF3 has been implicated in actin cytoskeleton dynamics through exposure of the binding sites for the Arp2/3 complex following external stimulation by growth factors such as PDGF. As a result, monomeric actin is recruited, leading to actin polymerization. The WASP family of proteins are activated through the Rho/cdc42 intermediates. Activation of the WASF proteins is thought to be through activation of Rac (40), which for WASF3 results in increased lamellipodia formation facilitating cell movement or initiation of metastasis (2). It was recently shown that KISS1 inhibits TNFα-induced breast cancer cell invasion by suppressing RhoA-mediated NFκB activation (23), suggesting that WASF3 and KISS1 function may be mediated through activation of different signaling intermediates, although activation of the NFκB pathway is a common outcome.

WASF3 was shown to interact with the p85 component of PKC and evidence was presented to suggest downstream activation of the p38 pathway (2). Our current data show that knockdown of WASF3 inhibits JNK activation but, consistent with previous reports, had no effect on ERK (unpublished data). MMP9 has been shown to be regulated partly by both ERK and JNK-dependent signaling pathways (20, 41). We found that transcription of MMP9 is attenuated, although still responsive to, TNFα stimulation in WASF3-silenced cells, consistent with the existence of a redundant pathway controlling MMP9 expression, in addition to its regulation by KISS1. This observation raises the possibility that MMP9 expression can be promoted through TNFα-induced ERK activation when WASF3 levels are repressed. The high expression of IL-8 in invasive cancer cells requires a complex cooperation between NFκB and other transcription factors (37). The corresponding elevation of KISS1 expression seen in WASF3 stable knockdown MDA-MB-231 cells, supports the concept of a direct interplay between WASF3 and the regulation of MMP9 and other metastasis related genes through its effects on KISS1.