Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Aug 15.
Published in final edited form as: Cancer Res. 2011 Jun 15;71(16):5387–5392. doi: 10.1158/0008-5472.CAN-11-0876

TMPRSS2-ERG-mediated feed-forward regulation of wild-type ERG in human prostate cancers

Ram-Shankar Mani 1,2, Matthew K Iyer 1,2, Qi Cao 1,2, J Chad Brenner 1,2,3, Lei Wang 1,2, Aparna Ghosh 1,2, Xuhong Cao 1,4, Robert J Lonigro 1,2, Scott A Tomlins 1,2, Sooryanarayana Varambally 1,2,5, Arul M Chinnaiyan 1,2,3,4,5,6
PMCID: PMC3156376  NIHMSID: NIHMS305600  PMID: 21676887

Abstract

Recurrent gene fusions involving ETS family genes are a distinguishing feature of human prostate cancers, with TMPRSS2-ERG fusions representing the most common subtype. The TMPRSS2-ERG fusion transcript and its splice variants are well characterized in prostate cancers, however not much is known about the levels and regulation of wild-type ERG. By employing an integrative approach, we demonstrate that the TMPRSS2-ERG gene fusion product binds to the ERG locus and drives the over-expression of wild-type ERG in prostate cancers. Knock-down of TMPRSS2-ERG in VCaP cells resulted in the down regulation of wild-type ERG transcription, while stable over-expression of TMPRSS2-ERG in the gene fusion-negative PC3 cells was associated with the up-regulation of wild-type ERG transcript. Further, androgen signaling-mediated up-regulation of TMPRSS2-ERG resulted in the concomitant up-regulation of wild-type ERG transcription in VCaP cells. The loss of wild-type ERG expression was associated with a decrease in the invasive potential of VCaP cells. Importantly, 38% of clinically localized prostate cancers and 27% of metastatic prostate cancers harboring the TMPRSS2-ERG gene fusions exhibited over-expression of wild-type ERG. Taken together, these results provide novel insights into the regulation of ERG in human prostate cancers.

Keywords: ERG, prostate cancer, gene fusion

Introduction

Recurrent gene fusions involving ETS family genes are observed in a majority of human prostate cancers and have potential implications for diagnosis, prognosis and therapy(1-3). These gene fusions typically result in the juxtaposition of the 5′-UTR of androgen-regulated genes to the oncogenic ETS family genes, resulting in their over-expression. The TMPRSS2-ERG fusions represent the most common subtype among ETS fusions, with a prevalence of ~50% in clinically localized prostate cancers(1, 4). Additional ETS family genes, which together account for ~10% of prostate cancer gene fusions, include ETV1(5), ETV4(6) and ETV5(7). TMPRSS2 is an androgen regulated gene located 3 Mb upstream of ERG in human chromosome 21q22.2, the upstream regulatory elements and promoter of which drive the over-expression of ERG upon the formation of gene fusion. Androgen signaling has been shown to induce the proximity of TMPRSS2 and ERG locus in androgen responsive cells, and in combination with agents causing DNA double strand breaks induces TMPRSS2-ERG gene fusions (8–10). In prostate cancer specimens, TMPRSS2-ERG gene fusions can be formed with the deletion of the intervening sequences (referred to as Edel) or without the deletion (11, 12). Castration-resistant metastatic prostate cancer sites harboring TMPRSS2-ERG are associated with Edel, suggesting that Edel is more aggressive (13). To date, multiple TMPRSS2-ERG isoforms and splice variants with variable biological activities have been described (14–17). For example, inclusion of a 72-bp exon has been reported to significantly enhance proliferation of prostate derived cells (17). However, not much is known about the levels and regulation of wild-type ERG in prostate cancers. By employing an integrative approach, we demonstrate that the TMPRSS2-ERG gene fusion product binds to the ERG locus and drives the over-expression of wild-type ERG in human prostate cancers, and suggest functional and clinical implications of this feed forward regulation of ERG expression.

Materials and Methods

Samples

Prostate tissues were from the radical prostatectomy series and the Rapid Autopsy Program, which are both part of the University of Michigan Prostate Cancer Specialized Program of Research Excellence (SPORE) Tissue Core. Samples were collected with informed consent and prior institutional review board approval. Total RNA was isolated with Trizol (Invitrogen) according to the manufacturer’s instructions.

Cell culture and cloning

VCaP cells were cultured in DMEM High Glucose medium containing 10% fetal bovine serum (FBS); LNCaP cells, PC3 cells stably over expressing TMPRSS2-ERG (PC3-TMPRSS2-ERG) and PC3 cells stably over expressing LacZ (PC3-LacZ) were cultured in RPMI 1640 medium containing 10% FBS in a 5% CO2 humidified incubator. Parental VCaP, LNCaP and PC3 cells were obtained from ATCC and were passaged for fewer than six months. Lentiviral LACZ and TMPRSS2:ERG-3xFLAG over-expression vectors were created by cloning into the pLL_ires_GFP backbone available from the University of Michigan vector core. Briefly, the coding sequence was amplified by PCR, digested with Xho1 and Xba1 and ligated into the pLL vector. The TMPRSS2-ERG variant used is the most prevalent gene fusion product (TMPRSS2 exon 1 fused to ERG exon 2 (NM_182918.3)). Lentivirus was created at the University of Michigan virus core and used to transduce PC3 cells in the presence of 4ug/ml polybrene (Sigma). PC3-LACZ and PC3-TMPRSS2-ERG cells were then sorted for green fluorescent protein (GFP) expression (top 25%) and used for subsequent assays. Genetic identity of the cells was confirmed by genotyping. GFP expression was monitored every three days and cells were kept in culture for no more than 4 weeks. The adenoviral constructs for ERG (exons 2 to 10) and LacZ are described elsewhere(4).

Chromatin Immunoprecipitation (ChIP) and ChIP-seq analysis

Published ChIP-seq sequence data were downloaded from the following GEO datasets: VCaP H3K36me3 (GSM353624), LNCaP H3K36me3 (GSM353627), VCaP ERG (GSM353647), LNCaP ERG (GSM353648), and VCaP Pan-H3 (GSM353622) (18). LNCaP Pan-H3 ChIP, VCaP Input DNA, and LNCaP Input DNA sequence data were prepared into libraries and sequenced using the Genome Analyzer (Illumina) following manufacturer’s protocols. The detailed ChIP procedure is described elsewhere(18). Reads were mapped to the human genome (hg19) using the BWA v0.5.8 (http://bio-bwa.sourceforge.net/) short read aligner (19). Only reads with a single best alignment were considered for further analysis. Enriched DNA-protein binding sites were determined using the MACS (version 1.4.0beta) peak-calling software using a threshold p-value of 1e−5 and default settings for all other parameters (20). Input DNA was used as a control for the ERG peak-calling analyses, and the Pan-H3 antibody ChIP-seq was used as a control for the H3K36me3 analyses. The ChIP quantitative real time PCR primers for amplifying wild-type ERG (NM_182918.3) promoter are: Forward: GTGCTTGCAGCCCGTGTGAA, Reverse: TGTCCAGCCCAAAGAAACAGGATA. The antibodies for ChIP assays are: rabbit IgG (Santa Cruz Biotechnology, #sc-2027), rabbit α-FLAG (Sigma, #F7425), rabbit α-ERG (Epitomics, #2805-1).

Results and Discussion

We first studied the ERG locus in the androgen sensitive VCaP and LNCaP cell lines using our previously published ChIP-seq compendium(18). Specifically, we analyzed the landscape of trimethylated lysine 36 of histone H3 (H3K36me3) enrichment and ERG binding in these cell lines. The genes actively transcribed by RNA polymerase II (Pol II) are marked by H3K36me3 enrichment along the length of the transcribed region(21). As VCaP cells endogenously harbor the TMPRSS2-ERG gene fusion which produces a chimeric transcript comprising of TMPRSS2 (exon 1) and ERG (exons 2 to 10), the ERG locus is enriched for the H3K36me3 mark in this cell line (Fig. 1A). By contrast, the LNCaP cells do not harbor the TMPRSS2-ERG gene fusion, lack ERG expression, and do not exhibit H3K36me3 enrichment at the ERG locus. Interestingly, the H3K36me3 epigenetic mark spanned the entire ERG locus (exons 1 to 10) in VCaP cells, even though gene fusion drives the over-expression of ERG exon 2 and beyond, indicating that the entire ERG locus is transcriptionally active in these cells. High expression levels of ERG exon1 was observed in VCaP cells, suggesting that in addition to the TMPRSS2-ERG chimeric transcript, these cells also express wild-type ERG (Supplementary Fig. 1). The results of 5′-RACE experiments indicated that Exon 1 of ERG represents bona fide wild-type ERG and its expression is not driven by fusion to any other gene (Supplementary Fig. 2). In addition, we observed strong binding of the ERG protein to the ERG locus in VCaP cells, but not in the LNCaP cells (Fig. 1B). The majority of the ERG enrichment peaks clustered near exon 1 of wild-type ERG. Taken together, these observations suggest that in addition to the TMPRSS2-ERG transcript, VCaP cells have high levels of wild-type ERG transcript, the expression of which is presumably regulated by ERG protein.

Figure 1.

Figure 1

ChIP-seq coverage data showing the H3K36me3 chromatin mark and the ERG transcription factor binding at the ERG locus in VCaP and LNCaP cells. An arrow denotes the direction of ERG transcription; vertical bars represent exons. In each coverage plot, the Y-axis represents the number of overlapping reads at each position, normalized to the Reads per Kilobase per Million (RPKM) metric. Significant enrichment (p < 10−5) is denoted by blue boxes below the raw data. A, The transcriptionally active ERG locus in VCaP cells is marked by significant enrichment of the H3K36me3 mark. The TMPRSS2-ERG gene fusion results in upregulation of ERG exon 2 (denoted by the red arrowhead) and beyond in VCaP cells. However, the H3K36me3 domain extends upstream of ERG exon 2, suggesting that the entire ERG locus is transcriptionally active (and not just the exons driven by gene fusion). By contrast, LNCaP cells lack H3K36me3 enrichment. B, The ERG protein binds to multiple locations within the ERG locus in VCaP cells but not LNCaP cells.

We next conducted gene silencing experiments to determine the role of TMPRSS2-ERG and wild-type ERG transcripts in VCaP cells. We designed siRNAs that specifically target (A) TMPRSS2-ERG transcript, (B) wild-type ERG transcript, or (C) both TMPRSS2-ERG and wild-type ERG transcripts. Specific knock-down of TMPRSS2-ERG transcript resulted in a reduction in levels of wild-type ERG transcript in addition to total ERG transcription as represented by ERG-ALL primers (Fig. 2A). However, specific knock-down of wild-type ERG transcript resulted in reduction of total ERG transcription without affecting the levels of TMPRSS2-ERG transcript. These results indicate that ERG protein can up-regulate the levels of wild-type ERG transcription, but not the levels of TMPRSS2-ERG transcript. Further support is obtained by the observation that PC3 cells stably over-expressing TMPRSS2-ERG show higher transcript levels of wild-type ERG as compared to LacZ controls (Fig. 2B). This up-regulation is associated with the binding of FLAG tagged ERG protein to the promoter of wild-type ERG (Fig. 2B). Similar results were obtained upon ectopic over-expression of the TMPRSS2-ERG gene fusion product in LNCaP cells (Supplementary Fig. 3).

Figure 2.

Figure 2

TMPRSS2-ERG mediated feed forward regulation of ERG. A, Schematic representation of the wild-type ERG (ERG-WT, accession: NM_182918.3) and TMPRSS2-ERG transcript (top panel). The locations of primers for gene expression analysis (solid line) and siRNA sequences (dotted line) are shown. The TMPRSS2-ERG siRNA and ERG-WT siRNA specifically target the TMPRSS2-ERG and wild-type ERG transcripts respectively. The ERG-ALL siRNA targets both these transcripts. The TMPRSS2-ERG and ERG-WT primers specifically detect TMPRSS2-ERG and wild-type ERG transcripts respectively; the ERG-ALL primers detect both these transcripts. Targeted knockdown of TMPRSS2-ERG transcript is associated with the down-regulation of wild-type ERG transcript. However, targeted knockdown of wild-type ERG does not lead to the down-regulation of the TMPRSS2-ERG transcript. * P-value < 0.01 by Student’s t-test. B, Lentivirus mediated stable over-expression of FLAG tagged TMPRSS2-ERG fusion product in PC3 cells results in the up-regulation of wild-type ERG transcript (top panel). ChIP assay with α-FLAG antibody shows binding of ERG protein to the promoter of wild-type ERG locus (bottom panel). C, Stimulation with 1 nM R1881, a synthetic androgen agonist for 24 hours resulted in the upregulation of both the TMPRSS2-ERG and wild-type ERG transcripts. D, Knock-down of TMPRSS2-ERG or wild-type ERG transcripts individually results in reduced ERG protein levels. Maximal reduction of ERG protein levels is observed with the ERG-ALL siRNA that targets both the TMPRSS2-ERG and wild-type ERG transcripts. Starvation or androgen deprivation also results in a significant reduction in ERG protein levels.

We next determined if androgen signaling could affect the levels of TMPRSS2-ERG and wild-type ERG in VCaP cells. Administration of synthetic androgen (R1881) resulted in robust up-regulation of both TMPRSS2-ERG and wild-type ERG transcription (Fig. 2C). Given the observation that ERG was not androgen responsive in a TMPRSS2-ERG negative setting (e.g. LNCaP cells) (2), we hypothesized that up-regulation of wild-type ERG by androgen is mediated by TMPRSS2-ERG. To study the effects of siRNA against different ERG transcripts and androgen depletion (starvation) in regulating ERG protein levels, immunoblot analysis was conducted (Fig. 2D). While siRNA against TMPRSS2-ERG or wild-type ERG reduced the levels of ERG protein, maximal reduction of ERG protein was obtained with ERG-ALL siRNA that targets all the ERG transcripts and also starvation or androgen deprivation. The proteins encoded by wild-type ERG and TMPRSS2-ERG transcripts are indistinguishable in terms of molecular weight. These results suggest that (A) both TMPRSS2-ERG and wild-type ERG transcripts contribute towards total ERG protein levels in VCaP cells, and (B) the protein product encoded by TMPRSS2-ERG up-regulates the levels of wild-type ERG.

To determine the functional consequence of the presence of wild-type ERG and TMPRSS2-ERG transcripts in VCaP cells, invasion assays were conducted. Knock-down of TMPRSS2-ERG and wild-type ERG individually or in a combined fashion with the ERG-ALL siRNA resulted in a significant loss of cell invasion (Fig. 3A). Although TMPRSS2-ERG siRNA and wild-type ERG siRNA individually do not result in maximal loss of ERG protein unlike ERG-ALL siRNA (Fig. 2D), the results of invasion assay indicate that VCaP cells are ultrasensitive to ERG levels. Given that wild-type ERG has functional relevance in cell based assays, we next determined if TMPRSS2-ERG gene fusion up-regulates wild-type ERG expression in clinical samples of prostate cancer. The expression levels of TMPRSS2-ERG, wild-type ERG and total ERG were measured in a panel of benign prostates (n=13), clinically localized prostate cancers (PCAs, n=67) and metastatic prostate cancers (MET, n=29) (Fig. 3B). None of the benign prostate tissues expressed either TMPRSS2-ERG or wild-type ERG transcripts. In clinically localized prostate cancers, 37.5 % (12/32) of TMPRSS2-ERG positive cases and none (0/35) of the TMPRSS2-ERG negative cases exhibited high levels of wild-type ERG (Fig. 3C, and Supplementary Table. 1). Similarly, 27.3% (3/11) of TMPRSS2-ERG positive metastatic prostate cancers expressed high levels of wild-type ERG, whereas none (0/18) of the TMPRSS2-ERG negative metastatic prostate cancers showed high wild-type ERG expression. By analyzing published prostate cancer array CGH datasets(22, 23), we could rule out ERG locus amplification as a possible cause of increased wild-type ERG expression (Supplementary Fig. 4). Taken together, these results suggest that TMPRSS2-ERG mediated up-regulation of wild-type ERG transcription occurs in a subset of gene fusion positive prostate cancers.

Figure 3.

Figure 3

Functional studies and clinical relevance of TMPRSS2-ERG mediated feed forward regulation of ERG. A, A reconstituted basement membrane invasion chamber assay (Boyden chamber assay) was used to assess the invasive potential of VCaP cells treated with siRNA’s against ERG isoforms. Representative fields of invaded and stained cells are shown (left panel). Invasion was quantified using colorimetry (absorbance at 560 nm, right panel). * P-value < 0.01 by Student’s t-test (right panel). B, Matrix representation of the transcript status of ERG isoforms in benign prostate, clinically localized prostate cancer (PCA) and metastatic prostate cancer (MET) as measured by quantitative reverse transcription PCR. Each column represents one case; the top, middle and bottom rows represent the status of wild-type ERG transcript (ERG-WT), TMPRSS2-ERG fusion transcript, and all ERG transcripts (ERG-ALL) respectively. A colored cell indicates that the tissue is positive for the corresponding transcript. C, Scatter plot representing the relative expression levels of wild-type ERG in TMPRSS2-ERG negative and positive clinically localized prostate cancers. Vertical axes represent the relative expression levels; the red bars represent the mean, dashed line represents the threshold used to classify samples as either wild-type ERG positive or negative. For clarity, points have been horizontally displaced within each sample class. D, Proposed model for TMPRSS2-ERG mediated feed forward regulation of ERG. Androgen signaling can increase the levels of TMPRSS2-ERG transcript, while anti-androgens have the opposite effect. The presence of TMPRSS2-ERG transcript results in the production of ERG protein, which then binds to the promoter of wild-type ERG to drive its transcription resulting in the production of wild-type ERG protein, which is functionally identical to the TMPRSS2-ERG gene product. This creates a feed forward loop that up-regulates wild-type ERG transcription.

TMPRSS2-ERG, the first recurrent gene fusion to be identified in human prostate cancers, is also the most prevalent. While it is apparent that the androgen responsive TMPRSS2 promoter drives the over-expression of ERG, we identified a novel TMPRSS2-ERG mediated feed forward loop that up-regulates wild-type ERG, thereby increasing the steady state levels of ERG protein (Fig. 3D). We have further sub-classified TMPRSS2-ERG positive prostate cancers in to two groups based on wild-type ERG expression. In the future, it will be interesting to determine if the two groups have distinguishing clinical features that are prognostically or therapeutically relevant. Why TMPRSS2-ERG mediated up-regulation of ERG gets selected in human prostate cancers is not very clear, however some possibilities do exist. Since ERG is a key driver of cancer progression, any change in cellular circuitry that increases the steady state ERG protein levels may be positively selected. This may also result in oncogene addiction and it will be interesting to test if prostate cancers with TMPRSS2-ERG and wild-type ERG represent a subtype that is ultrasensitive to ERG inhibition, as this appears to be the case with VCaP cells. Thus, by employing an integrative approach, we have identified a novel mechanism of regulation of ERG transcription that holds functional significance and clinical relevance.

Supplementary Material

1

Acknowledgments

We thank Ken Pienta for establishing the UM Rapid Autopsy Series, J. Yu for assistance with ChIP-seq experiments, S. Patel and M. Tran for technical assistance, and C. Maher for useful discussions. This work was supported in part by the National Institutes of Health Prostate SPORE P50CA69568, Early Detection Research Network U01 CA111275, R01CA132874, and the Prostate Cancer Foundation. A.M.C. is supported by a Burroughs Welcome Foundation Award in Clinical Translational Research, a Doris Duke Charitable Foundation Distinguished Clinical Investigator Award, and an American Cancer Society Research Professor Award. R.S.M. is supported by the Stewart Rahr–PCF Young Investigator Award from the Prostate Cancer Foundation.

References

  • 1.Kumar-Sinha C, Tomlins SA, Chinnaiyan AM. Recurrent gene fusions in prostate cancer. Nat Rev Cancer. 2008;8:497–511. doi: 10.1038/nrc2402. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, et al. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science. 2005;310:644–8. doi: 10.1126/science.1117679. [DOI] [PubMed] [Google Scholar]
  • 3.Clark JP, Cooper CS. ETS gene fusions in prostate cancer. Nat Rev Urol. 2009;6:429–39. doi: 10.1038/nrurol.2009.127. [DOI] [PubMed] [Google Scholar]
  • 4.Tomlins SA, Laxman B, Varambally S, Cao X, Yu J, Helgeson BE, et al. Role of the TMPRSS2-ERG gene fusion in prostate cancer. Neoplasia. 2008;10:177–88. doi: 10.1593/neo.07822. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Tomlins SA, Laxman B, Dhanasekaran SM, Helgeson BE, Cao X, Morris DS, et al. Distinct classes of chromosomal rearrangements create oncogenic ETS gene fusions in prostate cancer. Nature. 2007;448:595–9. doi: 10.1038/nature06024. [DOI] [PubMed] [Google Scholar]
  • 6.Tomlins SA, Mehra R, Rhodes DR, Smith LR, Roulston D, Helgeson BE, et al. TMPRSS2:ETV4 gene fusions define a third molecular subtype of prostate cancer. Cancer Res. 2006;66:3396–400. doi: 10.1158/0008-5472.CAN-06-0168. [DOI] [PubMed] [Google Scholar]
  • 7.Helgeson BE, Tomlins SA, Shah N, Laxman B, Cao Q, Prensner JR, et al. Characterization of TMPRSS2:ETV5 and SLC45A3:ETV5 gene fusions in prostate cancer. Cancer Res. 2008;68:73–80. doi: 10.1158/0008-5472.CAN-07-5352. [DOI] [PubMed] [Google Scholar]
  • 8.Mani RS, Tomlins SA, Callahan K, Ghosh A, Nyati MK, Varambally S, et al. Induced chromosomal proximity and gene fusions in prostate cancer. Science. 2009;326:1230. doi: 10.1126/science.1178124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Lin C, Yang L, Tanasa B, Hutt K, Ju BG, Ohgi K, et al. Nuclear receptor-induced chromosomal proximity and DNA breaks underlie specific translocations in cancer. Cell. 2009;139:1069–83. doi: 10.1016/j.cell.2009.11.030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Haffner MC, Aryee MJ, Toubaji A, Esopi DM, Albadine R, Gurel B, et al. Androgen-induced TOP2B-mediated double-strand breaks and prostate cancer gene rearrangements. Nat Genet. 2010 doi: 10.1038/ng.613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Perner S, Demichelis F, Beroukhim R, Schmidt FH, Mosquera JM, Setlur S, et al. TMPRSS2:ERG fusion-associated deletions provide insight into the heterogeneity of prostate cancer. Cancer Res. 2006;66:8337–41. doi: 10.1158/0008-5472.CAN-06-1482. [DOI] [PubMed] [Google Scholar]
  • 12.Iljin K, Wolf M, Edgren H, Gupta S, Kilpinen S, Skotheim RI, et al. TMPRSS2 fusions with oncogenic ETS factors in prostate cancer involve unbalanced genomic rearrangements and are associated with HDAC1 and epigenetic reprogramming. Cancer Res. 2006;66:10242–6. doi: 10.1158/0008-5472.CAN-06-1986. [DOI] [PubMed] [Google Scholar]
  • 13.Mehra R, Tomlins SA, Yu J, Cao X, Wang L, Menon A, et al. Characterization of TMPRSS2-ETS gene aberrations in androgen-independent metastatic prostate cancer. Cancer Res. 2008;68:3584–90. doi: 10.1158/0008-5472.CAN-07-6154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wang J, Cai Y, Ren C, Ittmann M. Expression of variant TMPRSS2/ERG fusion messenger RNAs is associated with aggressive prostate cancer. Cancer Res. 2006;66:8347–51. doi: 10.1158/0008-5472.CAN-06-1966. [DOI] [PubMed] [Google Scholar]
  • 15.Clark J, Merson S, Jhavar S, Flohr P, Edwards S, Foster CS, et al. Diversity of TMPRSS2-ERG fusion transcripts in the human prostate. Oncogene. 2007;26:2667–73. doi: 10.1038/sj.onc.1210070. [DOI] [PubMed] [Google Scholar]
  • 16.Hu Y, Dobi A, Sreenath T, Cook C, Tadase AY, Ravindranath L, et al. Delineation of TMPRSS2-ERG splice variants in prostate cancer. Clin Cancer Res. 2008;14:4719–25. doi: 10.1158/1078-0432.CCR-08-0531. [DOI] [PubMed] [Google Scholar]
  • 17.Wang J, Cai Y, Yu W, Ren C, Spencer DM, Ittmann M. Pleiotropic biological activities of alternatively spliced TMPRSS2/ERG fusion gene transcripts. Cancer Res. 2008;68:8516–24. doi: 10.1158/0008-5472.CAN-08-1147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yu J, Yu J, Mani RS, Cao Q, Brenner CJ, Cao X, et al. An integrated network of androgen receptor, polycomb, and TMPRSS2-ERG gene fusions in prostate cancer progression. Cancer Cell. 2010;17:443–54. doi: 10.1016/j.ccr.2010.03.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics. 2009;25:1754–60. doi: 10.1093/bioinformatics/btp324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhang Y, Liu T, Meyer CA, Eeckhoute J, Johnson DS, Bernstein BE, et al. Model-based analysis of ChIP-Seq (MACS) Genome Biol. 2008;9:R137. doi: 10.1186/gb-2008-9-9-r137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Mikkelsen TS, Ku M, Jaffe DB, Issac B, Lieberman E, Giannoukos G, et al. Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature. 2007;448:553–60. doi: 10.1038/nature06008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS, et al. Integrative genomic profiling of human prostate cancer. Cancer Cell. 2010;18:11–22. doi: 10.1016/j.ccr.2010.05.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Demichelis F, Setlur SR, Beroukhim R, Perner S, Korbel JO, Lafargue CJ, et al. Distinct genomic aberrations associated with ERG rearranged prostate cancer. Genes Chromosomes Cancer. 2009;48:366–80. doi: 10.1002/gcc.20647. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1

RESOURCES