Abstract
Purpose
To determine the contribution of copy number variation (CNV) in the regulation of complement activation (RCA) locus to the development of age-related macular degeneration (AMD).
Methods
A multiplex ligation-dependent probe amplification assay was developed to quantify the number of copies of CFH, CFHR3, CFHR1, CFHR4, CFHR2, and CFHR5 in humans. Subjects with (451) and without (362) AMD were genotyped using the assay, and the impact on AMD risk was evaluated.
Results
Eight unique combinations of copy number variation were observed in the 813 subjects. Combined deletion of CFHR3 and CFHR1 was protective (OR=0.47, 95% confidence interval 0.36–0.62) against AMD and was observed in 88 (82 [18.6%] with one deletion, 6 [1.4%] with two deletions) subjects with AMD and 127 (108 [30.7%] with one deletion, 19 [5.4%] with two deletions) subjects without AMD. Other deletions were much less common: CFH intron 1 (n=2), CFH exon 18 (n=2), combined CFH exon 18 and CFHR3 (n=1), CFHR3 (n=2), CFHR1 (n=1), combined CFHR1 and CFHR4 (n=15), and CFHR2 deletion (n=7, 0.9%). The combined CFHR3 and CFHR1 deletion was observed on a common protective haplotype, while the others appeared to have arisen on multiple different haplotypes.
Conclusions
We found copy number variations of CFHR3, CFHR1, CFHR4, and CFHR2. Combined deletion of CFHR3 and CFHR1 was associated with a decreased risk of developing AMD. Other deletions were not sufficiently common to have a statistically detectable impact on the risk of AMD, and duplications were not observed.
Introduction
Complement factor H (gene, CFH; protein, factor H) is the main inhibitor of the alternative pathway of the complement system [1]. Dysfunction of factor H is associated with increased liability to infections and chronic diseases, such as type II membranoproliferative glomerulonephritis, atypical hemolytic uremic syndrome, and age-related macular degeneration (AMD) [2].
The 300,000 bp regulation of complement activation (RCA) locus on chromosome 1q32 contains CFH and five ancestrally related genes that lie in a head-to-tail arrangement (Figure 1). The five genes code for proteins that show sequence and structural homology to CFH and factor H. They are referred to as complement factor H-related (CFHR) genes and are numbered one through five. CFH and the five CFHR genes are thought to have developed by successive duplications within the RCA locus.
Figure 1.
Multiplex ligation probe amplification strategy to quantify copy number variation across the regulation of complement activation locus, which is shown in panel A. It comprises complement factor H (CFH) and the five CFH related genes (CFHR1–CFHR5). Panels B to H describe the MLPA assays. The forward primer (FWP) is attached to the left oligonucleotide (LO), while the right oligonucleotide (RO) is attached to the reverse primer (RVP). The oligonucleotide pairs were designed to hybridize specifically to intron 1 of CFH (B), exon 18 of CFH (C), exon 3 of CFHR3 (D), exon 3 of CFHR1 (E), exon 2 of CFHR4 (F), intron 3B of CFHR2 (G), and exon 7 of CFHR5 (H). Capital letters in the wild-type sequence from the National Center for Biotechnology Information (NCBI) correspond to exons, while lower case indicates introns. The MLPA procedure was described previously [12].
Genetic variation in genes encoding proteins for the alternative pathway of complement plays a major role in the development of AMD [3-8], which is the leading cause of vision loss in elderly individuals of the developed world [9]. Copy number variations in the form of deletions of CFHR3 and CFHR1 within the RCA locus have been reported to contribute to the development of AMD [10-13]. Because of the extensive linkage disequilibrium in the RCA locus, it has been difficult to determine if the CFHR proteins have a role in AMD independent of factor H, using statistical genetic approaches.
The amino acid sequence of the CFHR proteins is homologous to factor H, with the main difference being the presence or absence of different protein domains in the full length factor H. For example, CFHR3 is similar to factor H, except that it lacks the N-terminal protein domains that downregulate the alternative pathway. Thus, the protective effect of the common combined deletion of CFHR3 and CFHR1 is thought to occur through decreased competition of CFHR3 with factor H for binding to complement proteins [11,13]. CFHR1 was reported to inhibit the terminal complement pathway and thus might be involved in the pathogenesis of AMD [14]. CFHR4 interacts with native C-reactive protein (CRP), thereby enhancing opsonization via binding to CRP, which is elevated in the choroid and blood of subjects with AMD [15]. Also, variants in CFHR2 and CHR5 [16] have been demonstrated to be associated with AMD [17].
We report an analysis of copy number variation across the entire RCA locus and its possible contribution to the development of AMD. To overcome the extensive homology between the five CFHR genes, we developed an assay (Figure 1) using the multiplex ligation-dependent probe amplification (MLPA) technique [12,18-20]. We demonstrated that eight deletions of the CFHR genes segregate in the Caucasian population and we describe the haplotype backgrounds on which these deletions occur and their association with AMD.
Methods
Subjects
The study followed the tenets of the Declaration of Helsinki, was approved by the institutional review board of the Mayo Clinic (Rochester, MN), and written informed consent was obtained from all subjects after explanation of the nature and possible consequences of the study. The subjects were composed of the 813 self-reported Caucasian individuals described in Table 1. The ascertainment and characterization of the subjects has been reported [21]. Diagnosis was determined by review of fundus photographs as described previously [8,12,22-24]. Briefly, all subjects diagnosed with AMD had large drusen (≥125 µ) with sufficient drusen area to fill a 700-µ circle or more advanced findings. Controls had five or fewer hard drusen (<63 µ) without pigment changes or more advanced findings. Geographic atrophy and exudation were defined using the Wisconsin age-related maculopathy grading system [25]. Subjects have been graded multiple independent times by two individual highly qualified retina specialists [21]. Subjects with both neovascular and primary geographic atrophy, namely the development of geographic atrophy before the onset of exudation, were included in the analysis for each subtype. When a unique grade for each subject was required, the subjects graded “both” were added to the grade with a smaller number of subjects (geographic atrophy) to increase power [12,21,26].
Table 1. Demographic and clinical features of the subjects.
| Subjects | Number | Age (mean±standard deviation) | Male:Female ratio |
|---|---|---|---|
| Controls |
362 |
70.4±8.1 |
0.74 |
| AMD subtotal |
451 |
77.6±8.8 |
0.46 |
| Early AMD |
210 |
75.1±9.4 |
0.43 |
| Geographic atrophy* |
84 |
80.1±5.7 |
0.65 |
| Exudative AMD |
157 |
79.5±8.5 |
0.43 |
| Total subjects | 813 | 74.4±9.2 | 0.58 |
Twenty-two subjects who had both primary geographic atrophy and exudative age related macular degeneration (AMD; category “Both”) were included in the geographic atrophy group as described in methods.
Multiplex ligation-dependent probe amplification
Design of oligonucleotides
Oligonucleotides for MLPA were designed to bind specifically to CFH (intron 1), CFH (exon 18), CFHR3 (exon 3), CFHR1 (exon 3), CFHR4 (exon 2), CFHR2 (intron 3), and CFHR5 (exon 7); Figure 1. Control oligonucleotides binding to the apoptosis-inducing factor mitochondrion-associated 1 (PDCD8 (AIFM1)) on the X chromosome and synovial sarcoma translocation chromosome 18 (SS18) on chromosome 18 were also designed and included. The oligonucleotide pairs consisted of a left oligonucleotide (LO) and a right oligonucleotide (RO). The pairs were designed 1) to have their ligation point specifically at a known sequence variation of the homologous genes as described in Figure 1, 2) to have a 4-bp difference in length for each gene of interest, ranging from 100 to 132 bp, and 3) to have a GC content of 40%–60%. To allow quantitative analysis with capillary electrophoresis, the forward primer in the PCR was labeled with a fluorescent 6-carboxy-fluorescine (FAM) marker at the 5′ end. To avoid quenching of the fluorescent FAM marker by the G base, the standard MLPA forward primer [18,20] was redesigned and the sequence is shown in Figure 1. The oligonucleotides and the primers were obtained from Integrated DNA Technology (Coralville, IA; Table 2).
Table 2. Target sequences of the oligonucleotides used in the MLPA assay.
| Target Gene | Oligonucleotide side | MLPA Oligonucleotides (5′ - 3′) hybridization sequences* | Product length (bp) |
|---|---|---|---|
|
CFH |
LO |
gcctccttgttttaacagtctggct |
100 |
| (Intron 1) |
RO |
P-cagggggtcactgcaggctactaagaattgggt |
|
|
CFHR3 |
LO |
CAAAAGCGCAGACCACAGTTACATGTAC |
104 |
| (Exon 3) |
RO |
P-GGAGAAAGGCTGGTCTCCTACTCCCAGATGCATC |
|
|
CFH |
LO |
GTCAGACAGTTATCAGTATGGAGAAGAAGTTAC |
108 |
| (Exon 18) |
RO |
P-GTACAAATGTTTTGAAGGTTTTGGAATTGATGG |
|
|
CFHR1 |
LO |
CAACATTTCATGTGTAGAACGGGGCTGGTCCACC |
112 |
| (Exon 3) |
RO |
P-CCTCCCAAATGCAGGTCCACTGgtaagtacaatgct |
|
|
CFHR4 |
LO |
CAGAAATTCAACATGGAGGTCTATATTATAAGAGTT |
116 |
| (Exon 2) |
RO |
P-TGCGTAGACTATACTTTCCAGCAGCTGCAGGACAATCT |
|
|
CFHR2 |
LO |
cagggattagtacagtgcaatctctgggggctgttattcc |
120 |
| (Intron 3B) |
RO |
P-gtttacaacaccatgcaataaccttatatgaataaagc |
|
|
CFHR5 |
LO |
CAACACACCAACTTAAGAGGTGCAAAATAGCAG |
124 |
| (Exon 7) |
RO |
P-GAGTTAATATAAAAACATTACTCAAGCTATCTGGGAAAGAATTTAATCA |
|
|
PDCD8 |
LO |
CGCAAATACAACAGGTATCAGAACTGCTGGCCCCAGATTAAG |
128 |
| (Exon 8) |
RO |
P-CTTCAGATGGTGAACTCTGTGCACTTCCACCCATGCAGTCACCT |
|
|
SS18 |
LO |
GGCAATCATATGATGGGTCAGAGACAGATTCCTCCCTATAGAC |
132 |
| (Exon 6) | RO | P-CTCCTCAACAGGgtaagattccatttggaaaatttgctacttaatgt |
*Sequences within an exon are shown in upper case, while sequences in introns are presented in lower case. The LO begins with the forward primer sequence 5′-TGG GTC CCT AAG GGT TGG A-3′ followed by the sequence shown in the table. The 5′-end of the RO is phosphorylated (P) and the sequence shown in the table is followed by the complement of the reverse primer 5′-TCT AGA TTG GAT CTT GCT GGC AC-3′. Figure 1 and the methods provide additional details.
Assay conditions for MLPA
We performed MLPA according to the MLPA protocol using the MLPA EK kit (MRC-Holland, Amsterdam, Netherlands) and 50 ng DNA per sample. Four control samples (two male and two female) without deletions of CFH and CFHR1–5, based on the MLPA assay, and a water (no DNA) control were included in each experiment. Hybridization, ligation, and the setup for amplification of the MLPA assay were performed as described previously [12]. Amplification conditions were 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 60 s, followed by 20 min at 72 °C and a hold at 4 °C.
Assay conditions for capillary electrophoresis
Two microliters of the amplified products were diluted (1:30) in 58 µl of distilled water, of which 2 µl was plated into a well with 18 µl of a mixture of 1 part formamide Hi-Di (Applied Biosystems, Foster City, CA) and 0.015 parts GeneScan 120 LIZ size standard (Applied Biosystems). Capillary electrophoresis was performed on an Applied Biosystems 3730 DNA Analyzer (Applied Biosystems) as described previously [12]. If the detection threshold was crossed, the amplified product was diluted in distilled water (1:50) and 2 µl of the dilution was used for capillary electrophoresis. If the fluorescent intensities were too low, 2 µl of the pure amplified product was used for capillary electrophoresis.
Data analysis
GeneMapper Software v4.0 (Applied Biosystems) was used to perform fragment sizing with the internal 120 LIZ size standard, automated peak calling, and peak normalization [27]. The nine peak heights of the nine probes (CFH1 [CFH intron 1], CFH18 [CFH exon 18], CFHR3, CFHR1, CFHR4, CFHR2, CFHR5, PDCD8, and SS18) of each sample were exported for further data analysis. The peak heights were normalized by dividing each peak height by the sum of all nine peak heights in each sample. Each normalized peak height was divided by the means of that peak height in the four control samples to standardize the peak heights to the control samples included in every run. The ratio for the probes CFH1, CFH18, CFHR3, CFHR1, CFHR4, CFHR2, CFHR5, and PDCD8 of every sample was generated by dividing the normalized and standardized peak heights of the probe by the normalized and standardized peak height of the control probe SS18 in that sample. The probe of the X chromosome (PDCD8) was used as a control for unintended interchange of samples and as a model of deletions. Each assay run was calculated separately due to possible interassay variations, as recommended [18]. The person performing the assay and the calculations was masked to the ophthalmologic diagnosis of the subjects [12].
Replication of MLPA assay results
The MLPA assay was performed three times on all samples. A sample was defined as having “failed” if i) a result was not repeated a second time, ii) the SS18 control probe did not result in two alleles, and iii) the gender of the sample did not match the number of alleles of the control probe PDCD8 (i.e., a male subject should only have one copy, while a female subject should have at least two copies of the PDCD8 gene). Selected samples were repeated using the TaqMan quantitative PCR assay (Applied Biosystems).
TaqMan assay
A TaqMan assay was performed to independently confirm the copy number variation of eight randomly selected samples. Specific genomic targets in CFH (intron 1), CFH (intron 18), CFHR3 (exon 3), CFHR1 (exon 3), CFHR4 (intron 2), CFHR2 (intron 3), and CFHR5 (exon 7) were amplified using the TaqMan Gene Expression Master Mix (Applied Biosystems) combined with the specific target gene assay mix consisting of a 0.25-mM TaqMan MGB probe and 0.9 mM of each PCR primer [12]. Forward primer 5′-TGT TTT GCC AAC GGA CCT ATT TAG T-3′ and reverse primer 5′-GCC CAT TAA TAG GAG CAT TTA TTT TGC T-3′ was employed for CFHR3. Forward primer 5′-ACA TCT CCA ATT TAG ATC CTT TGA TTA ACC A-3′ and reverse primer 5′-GCA TTT TCT TAG TGA ATA AGC AAA GAT TTA AAA ACA-3′ was used for CFHR1. The TaqMan assay used for CFH (intron 1) was localized at 194890541; for CFH (exon 18) it was localized at intron 18 at 194976628; for CFHR4 it was at intron 2 at 195139068; for CFHR2 it was at intron 3 at 195188714; and for CFHR5 it was at exon 7 at 195234027. TaqMan probes and primers were obtained from Applied Biosystems. All reactions were performed in triplicate, as described previously [12]. The values obtained for CFH1, CFH18, CFHR3, CFHR1, CFHR4, CFHR2, and CFHR5 copy numbers were normalized to the endogenous control gene RNase P and quantified relative to the copy number of control samples using the ΔΔCT method [28].
Genotyping
Single nucleotide polymorphisms (SNPs) tagging common haplotypes across the RCA locus were genotyped as described previously [8,12,24,26,29].
Statistical analyses
All SNPs and copy number variant assays were noted to be in Hardy–Weinberg equilibrium (p>0.05). Single variant analyses on genotype distributions were performed in SAS version 9.13 (SAS institute, Cary, NC) using logistic regression assuming a log-additive genetic model where variants were coded as 0, 1, or 2 for the number of minor alleles or deletions. Fisher’s exact tests were performed also on genotype distributions. Haplotype analyses on SNPs across the RCA locus and the occurrence of CFHR3, CFHR1, CFHR4, and CFHR2 copy number variation was performed using haplo.stats packages (Mayo Foundation for Medical Education and Research) in R. To investigate the effect of polymorphisms on AMD subtypes, each subtype was compared to the control. Age is confounded with diagnosis (i.e., the cases are older than the controls and age is a risk for AMD), thus correction for age might have unpredictable effects; all analyses were performed with and without correction for age and gender [26]. Nominal p-values are reported.
Results
Development of a new MLPA assay
Ten samples from our previous paper [12] and an additional two male and two female control samples were chosen for evaluating the new MLPA assay (Figure 1). The new MLPA assay gave the same results for the four loci in our previous assay (CFHR3, CFHR1, SS18, and PDCD8) [12], which was reproducible upon running the assay three times. The reproducibility of the capillary electrophoresis was demonstrated by repeating this step twice. MLPA was also performed on the four control samples with different oligonucleotide combinations, and no unwanted probe amplification (e.g., from the CFHR loci omitted from a given assay) was observed. The products amplified by each of the nine amplicons in the MLPA assay were electrophoresed on agarose gels, and single bands of the expected product sizes were observed.
Validation of ratio change thresholds for copy number variation in the MLPA assay
Scatter plot diagrams comparing the second and third independent assays of CFHR3, CFHR1, and CFHR4 of all samples were used to define our MLPA ratio criteria (Figure 2). Based on this evidence and the replication using TaqMan assays, the standard MLPA ratio criteria for homozygous deletion (≤0.40), heterozygous deletion (≤0.80), and heterozygous duplication (>1.60) were employed throughout the study. Examples of raw data are shown in Figure 3.
Figure 2.
Scatter plots comparing the copy number estimates determined for the second and third MLPA assay on all subjects. Panel A shows the results for CFHR3, Panel B for CFHR1, and Panel C for CFHR4. The scatter plots show that the MLPA ratio criteria for homozygous deletion is 0.00 to 0.40, for heterozygous deletion is 0.41 to 0.80, for wild-type is 0.81 to 1.60, and for heterozygous duplication is >1.60. The largest cluster in each panel represents two copies, the second largest cluster one copy, and the subjects on the y-axis in panels A and B zero copies.
Figure 3.
Example of an MLPA copy number assay. Raw fluorescent intensity (y-axis, relative fluorescence units) observed during capillary electrophoresis are illustrated. The first peak represents the amplicon of CFH intron 1 with a product size of 100 bp (x-axis, bp), followed by the other probes as illustrated. The ratio of peak height of all probes to SS18 determines the copy number (see methods). CFHR2 always has a high peak, which is taken into account with normalization. Therefore, this does not show a duplication of CFHR2. Panel A shows a wild-type subject, panel B a subject heterozygous for deletion of both CFHR3 and CFHR1, and panel C a subject homozygous for deletion of both CFHR3 and CFHR1. The X-chromosome marker (PDCD8) shows that all three subjects are females.
Copy number variation observed and association with AMD
Eight unique combinations of deletions were observed. The most common was the previously reported combined deletion of CFHR3 and CFHR1 (Table 3). The second most common was the combined deletion of CFHR1 and CFHR4 (Table 3). More rare deletions are presented in Table 4. Unexpectedly, no duplications were observed. We observed a significant protective effect of the combined deletions of CFHR3 and CFHR1 on risk of having AMD in both adjusted for age and gender and unadjusted calculations (OR=0.47, 95% CI 0.36–0.62). The effect was similar among different AMD subtypes compared to the controls (OR=0.51, 95% CI 0.36–0.73 for early AMD, and OR=0.43, 95% CI 0.31–0.62 for advanced AMD). The 15 observed combined deletions of CFHR1 and CFHR4 (eight cases and seven controls) did not show a significant impact on risk of having AMD (Table 3 and Table 4). The other deletions were also observed in a similar proportion of cases and controls, except for CFHR2 which was seen in six cases and one control (Table 4).
Table 3. Common copy number variation observed and the association with AMD.
| Deletion | Minor allele frequency in all 813 subjects (%) | Final deletion count | Number subjects (%) | Control n (%) | AMD cases n (%) | Early AMD n (%) | Geographic atrophy n (%) | Exudative AMD n (%) | Advanced AMD‡ n (%) | OR (95% CI) § | Log-additive p-value | Log-additive p-value age, gender adjusted |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
CFHR3 and CFHR1 |
15 |
2 |
25 (3.1) |
19 (5.4) |
6 (1.4) |
5 (2.4) |
0 (0) |
1 (0.7) |
1 (0.4) |
0.47 (0.36–0.62) |
1.35E-07 |
1.24E-07 |
| |
|
1 |
190 (23.9) |
108 (30.7) |
82 (18.6) |
37 (17.9) |
11 (13.1) |
34 (22.5) |
45 (19.1) |
|
|
|
| |
|
0 |
579 (72.9) |
225 (63.9) |
354 (80.1) |
165 (79.7) |
73 (86.9) |
116 (76.8) |
189 (80.4) |
|
|
|
| |
|
Total |
794* (100) |
352 (100) |
442 (100) |
207 (100) |
84 (100) |
151 (100) |
235 (100) |
|
|
|
|
CFHR1 and CFHR4 |
1.3 |
2 |
0 (0) |
0 (0) |
0 (0) |
0 (0) |
0 (0) |
0 (0) |
0 (0) |
0.73 (0.26–2.04) |
0.5498 |
0.8081 |
| |
|
1 |
15 (2.5) |
7 (3) |
8 (2.2) |
3 (1.8) |
0 (0) |
5 (4.1) |
5 (2.6) |
|
|
|
| |
|
0 |
582 (97.5) |
227 (97) |
355 (97.8) |
165 (98.2) |
73 (100) |
117 (95.9) |
190 (97.4) |
|
|
|
| Total | 597† (100) | 234 (100) | 363 (100) | 168 (100) | 73 (100) | 122 (100) | 195 (100) |
* The total for combined deletions of CFHR3 and CFHR1 is 794, because 19 subjects had other copy number variations and are not included in this analysis. †The total for combined deletions of CFHR1 and CFHR4 is 597, because 216 subjects had other copy number variations. ‡Advanced AMD is all subjects with geographic atrophy and/or exudative AMD. § This is the odds ratio (OR) for being a case rather than a control by adding one more deletion, assuming additivity on the log scale. Thus, the OR for two deletions compared to no deletion is the square of the OR for one deletion.
Table 4. Subjects with CFH intron 1 and exon 18, CFH exon 18 with CFHR3, CFHR3 only, CFHR1 only, combined CFHR1 and CFHR4, and CFHR2 deletions.
| Final deletion count | Demographics | Diagnosis | |||||||
|---|---|---|---|---|---|---|---|---|---|
|
CFH intron 1 |
CFH exon 18 |
CFHR3 |
CFHR1 |
CFHR4 |
CFHR2 |
Gender |
Age |
Affectation |
Subtype |
| 1 |
0 |
0 |
0 |
0 |
0 |
F |
77 |
Control |
|
| 1 |
0 |
0 |
0 |
0 |
0 |
F |
66 |
AMD |
Early |
| 0 |
1 |
0 |
0 |
0 |
0 |
M |
82 |
AMD |
Exudative |
| 0 |
1 |
0 |
0 |
0 |
0 |
M |
72 |
Control |
|
| 0 |
1 |
1 |
0 |
0 |
0 |
F |
69 |
Control |
|
| 0 |
0 |
1 |
0 |
0 |
0 |
M |
65 |
Control |
|
| 0 |
0 |
1 |
0 |
0 |
0 |
M |
85 |
AMD |
Exudative |
| 0 |
0 |
0 |
1 |
0 |
0 |
F |
70 |
Control |
|
| 0 |
0 |
0 |
1 |
1 |
0 |
F |
66 |
AMD |
Exudative |
| 0 |
0 |
0 |
1 |
1 |
0 |
F |
43 |
AMD |
Early |
| 0 |
0 |
0 |
1 |
1 |
0 |
F |
79 |
AMD |
Early |
| 0 |
0 |
0 |
1 |
1 |
0 |
F |
89 |
AMD |
Exudative |
| 0 |
0 |
0 |
1 |
1 |
0 |
M |
68 |
AMD |
Exudative |
| 0 |
0 |
0 |
1 |
1 |
0 |
M |
88 |
AMD |
Exudative |
| 0 |
0 |
0 |
1 |
1 |
0 |
F |
63 |
Control |
|
| 0 |
0 |
0 |
1 |
1 |
0 |
F |
71 |
AMD |
Early |
| 0 |
0 |
0 |
1 |
1 |
0 |
M |
66 |
Control |
|
| 0 |
0 |
0 |
1 |
1 |
0 |
F |
86 |
AMD |
Exudative |
| 0 |
0 |
0 |
1 |
1 |
0 |
F |
82 |
Control |
|
| 0 |
0 |
0 |
1 |
1 |
0 |
F |
61 |
Control |
|
| 0 |
0 |
0 |
1 |
1 |
0 |
F |
65 |
Control |
|
| 0 |
0 |
0 |
1 |
1 |
0 |
F |
71 |
Control |
|
| 0 |
0 |
0 |
1 |
1 |
0 |
M |
79 |
Control |
|
| 0 |
0 |
0 |
0 |
0 |
1 |
M |
81 |
AMD |
Early |
| 0 |
0 |
0 |
0 |
0 |
1 |
F |
90 |
AMD |
Exudative |
| 0 |
0 |
0 |
0 |
0 |
1 |
M |
78 |
AMD |
Exudative |
| 0 |
0 |
0 |
0 |
0 |
1 |
F |
84 |
AMD |
Early |
| 0 |
0 |
0 |
0 |
0 |
1 |
F |
65 |
AMD |
Early |
| 0 |
0 |
0 |
0 |
0 |
1 |
M |
68 |
Control |
|
| 0 | 0 | 0 | 0 | 0 | 1 | M | 71 | AMD | Exudative |
Haplotype studies
Six common haplotypes were observed in the RCA locus, following previous reports [10-12,30]. Three haplotypes carried the Y402H polymorphism and increased the risk of AMD (R1, R2, and R3), one haplotype was neutral for AMD risk (N), and two haplotypes were protective (P1 and P2). The deletion of CFHR3 and CFHR1 was always present on a haplotype most similar to P2 (Appendix 1 and Appendix 2). SNP rs6677604 tagged the combined deletion of CFHR3 and CFHR1, as reported previously [12]. The rs6677604 GG genotype occurred in 571 of 579 (99%) subjects without the combined deletion, the GA genotype in 189 of 189 (100%) subjects heterozygous for the combined deletion, and the AA genotype in 25 of 25 (100%) subjects homozygous for the combined deletion. The combined CFHR1 and CFHR4 deletions and the CFRH2 only deletions occurred on multiple independent haplotypes and were not tagged by a single SNP.
Discussion
We developed and validated a new MLPA assay to enable determination of the frequency and patterns of copy number variation in CFH and the five CFHR genes across the RCA locus. The MLPA assay was performed on 813 subjects with and without AMD. The well known combined deletion of CFHR3 and CFHR1 was observed on 15% of chromosomes in this study and was highly protective for AMD as reported by us and others previously (Table 3) [10-13,30]. We were able to verify that rs6677604 tags the combined CFHR3 and CFHR1 deletion in a larger group of subjects than reported previously [10,12,30]. So far no other tagging SNP has been found for these copy number variations.
Copy number variation in the human genome is associated with many diseases [31-36]. It has been suggested that copy number variations account for more nucleotide variations than do SNPs [37]. Due to their size copy number variations often encompass functional DNA sequences and can sometimes disrupt them [38] or lead to a protective effect. The combined deletion of CFHR3 and CFHR1 that is protective in AMD [10-13,30] is associated with an increased risk for atypical hemolytic uremic syndrome [14,39,40]. The combined deletion of CFHR1 and CFHR4 has only been described as an increased risk for the atypical hemolytic uremic syndrome [40]. Apart from the combined deletion of CFHR3 and CFHR1 and of CFHR1 and CFHR4, we observed an additional six patterns of deletions. However, these were not sufficiently common to have a detectable effect on AMD risk. Deletion of each CFHR gene was observed, except for CFHR5. No duplications were detected, as would be expected if the recombination events were common recurrent events.
Zhang et al. [17] also reported that there was a significant association between variants of CFHR2 and CFHR5 and AMD risk and showed that a haplotype spanning CFH (including the Y402H CFH variant), CFHR4, and CFHR2 was associated with the greatest risk of neovascular AMD (p<10−6). Narendra et al. [16] identified five different heterozygous sequence changes in CFHR5 and suggested that the mutant T allele in exon 4, which was significantly higher in controls than in AMD patients (p<0.0001) and leads to a codon change at Asp169Asp, might be associated with a reduced risk of developing AMD. In a study of renal disease (with persistent microscopic hematuria, recurrent macroscopic hematuria, glomerulonephritis, and progressive renal failure), Gale et al. [41] found a rare internal duplication of exon 2 and exon 3 in CFHR5 that may account for the substantial proportion of renal disease in Cyprus and called it “CFHR5 nephropathy” [41]. We designed our oligonucleotide pair for MLPA within exon 7 of CFHR5 and did not observe copy number variation within this region of CFHR5 in our subjects. Narendra et al. [16] would not have detected duplication of exons 2 and 3, and the effect of this duplication on AMD is as yet unknown. Thus, variation in the copy number of the CFHR genes is associated with atypical hemolytic uremic syndrome and the CFHR5 nephropathy, but a definitive association with AMD is still lacking.
We have observed extensive association between SNPs across the RCA locus, including each of the CFHR genes, since our original report in 2005 [8]. However, we have been unable to demonstrate an effect independent of CFH using statistical genetic approaches. The mechanism through which the genetic variation across the RCA contributes to AMD remains a subject of active investigation. Because of the tendency of polymorphisms across this 300,000-bp and six-gene region to be co-inherited (linkage disequilibrium), independent effects of the genetic variation in this region is difficult to assess using statistical genetic approaches. However, haplotypes can be estimated across the region, and the functional evaluation of these ancestral blocks of DNA has proven insightful [24].
A small number of common haplotypes are found across the CFH gene (Appendix 1) [6-8,12,42,43]. Depending on the number of polymorphisms included in the estimation of haplotypes, there is a group of risk haplotypes (R1, R2, and R3) that contain the Y402H polymorphism and increase the risk of AMD. Two of these haplotypes (R1, R2) appear identical across the CFH gene, while R3 has some differences after exon 14. The protective haplotypes (P1 and P2) appear to protect against AMD, while the neutral (N) haplotype does not have an impact on AMD risk.
We previously reported that each of the common haplotypes (R1, P1, P2, and N) had a distinct influence on the activation and levels of complement in human blood [24]. Notably, the P1 haplotype which carries the I62V polymorphism reduced complement activation in human blood [24] and biochemical functional studies [44,45], while the R1, P2, and N haplotypes had no effect on blood levels of complement activation [24]. These two observations are consistent with a local role for the combined deletion of CFHR3 and CFHR1 in decreased complement activation in Bruch’s membrane and the choroid. Experimental studies are needed to confirm the hypothesis noted earlier that deletion of CFHR3 reduces competition with factor H inhibition of the alternative pathway of complement. Our results suggest that any such effect may occur on the surface of molecules of the RPE, Bruch’s membrane, and choroid.
The combined deletion of CFHR3 and CFHR1 was a consistent feature of the P2 haplotype. The combined deletion of CFHR3 and CFHR1 appears to have arisen on the P2 haplotype, which can be defined by a C at rs3766404 and an A at rs6677604 (Appendix 1 and Appendix 2). All but 22% of the combined deletion of CFHR3 and CFHR1 reside on this haplotype. The combined deletion of CFHR3 and CFHR1 was always observed on a core region of the P2 haplotype TAGAAGG from rs1061170 through rs1065489 (Appendix 2). The less common haplotypes on which the combined deletion of CFHR3 and CFHR1 reside could have arisen through recombination on the 5′ region of CFH (e.g., rs800292 or the functional I62V polymorphism) and SNPs far downstream of CFH. Notably, the results provide further evidence that the protective effect mediated by the combined deletion of CFHR3 and CFHR1 is independent of the enhanced cofactor activity of the P1 haplotype provided by the I62V polymorphism [24,44,45]. We found that the full P2 haplotype was found in combined deletion homozygotes of CFHR3 and CFHR1 with a frequency of 53%, similar to reports by Spencer et al. [30] (47%) and Hageman et al. [11] (63%).
Raychaudhuri et al. [42] showed that Y402H is in linkage disequilibrium with rs10737680 and the combined CFHR3 and CFHR1 deletion. By univariate analysis, they showed that each marker has a significant association with AMD. When they conditioned on Y402H alone, they demonstrated that the combined deletion effect was still present. However, when they conditioned on rs10737680, the statistical strength of the protective effect of the combined deletion was alleviated. Also, Neale et al. performed logistic regression to test if copy number variations are associated with disease and found that the CFHR1 deletion has a strong association with AMD but that it does not describe an independent association [46]. However, Hughes et al. confirmed by logistic regression analysis that the protective haplotype, which includes the combined CFHR3 and CFHR1 deletion, confers a significant independent effect on AMD [10]. Li et al. [47] demonstrated that dissection of complex disease susceptibility loci is very challenging and that even if the Y402H variant is strongly associated with AMD, it is unlikely to be the only major determinant of disease susceptibility in this region. The strong linkage disequilibrium in this region limits statistical methods to distinguish between alternative sets of associated SNPs. The important question that we are trying to address is does the P2 haplotype confer a protective effect beyond not having the Y402H polymorphism. The P2 haplotype has no residual impact on disease risk after statistical analysis conditioning on the risk haplotype [42,46]; however, we know from functional studies (e.g., the clear impact of I62V on complement levels) [24] that statistical analysis does not always capture the functional variants. Thus, a definitive answer cannot be excluded without functional studies.
In summary, we observed that the combined deletion of CFHR3 and CFHR1 is the most common copy number variation across the RCA locus. The deletion is found on the protective P2 haplotype, and we have confirmed that it can be efficiently tagged by the single nucleotide polymorphism rs6677604. The seven other deletions we observed are rare and appear to have arisen on different haplotypes, suggesting that direct genotyping of the deletions is needed for their detection.
Acknowledgments
We thank Daniel Kluge and the Mayo Advanced Genomics Technology Center for assistance with the capillary electrophoresis. The research was supported by the Max Kade Foundation, New York, NY, National Eye Institute (EY014467), Bethesda, MD, the Foundation Fighting Blindness, Owing Mills, MD, the American Health Assistance Foundation, Clarksburg, MD, unrestricted departmental grants from Research to Prevent Blindness, New York, NY, and the Mayo Foundation, Rochester, MN. The authors have no commercial interests. The data was presented as a poster at the ARVO Meeting 2011 in Fort Lauderdale.
Appendix 1. Common haplotypes across the RCA locus and haplotypes on which deletions were observed.*
*The combined CFHR1 and CFHR4 deletion was observed in 15 subjects on the following haplotypes in descending frequency: a recombinant haplotype between R3 and either R1, R2 or P2, a recombinant R1/P1 haplotype, P1, and a recombinant N/P1. The seven subjects with R2 deletions occurred on 4 different haplotypes: P1, R1, a recombinant N/R3, and R3. Note that 1 means present and 0 deleted. † The combined CFHR3 and CFHR1 deletion is a consistent feature of the P2 haplotype. ‡ The haplotype frequencies represent the absolute frequency of the haplotype in the samples. To access the data, click or select the words “Appendix 1.” This will initiate the download of a compressed (pdf) archive that contains the file.
Appendix 2. Common haplotypes across the RCA locus and haplotypes in combined deletion homozygotes of CFHR3 and CFHR1.
* This is the P2 haplotype as described in Appendix 1. To access the data, click or select the words “Appendix 2.” This will initiate the download of a compressed (pdf) archive that contains the file.
References
- 1.Rodríguez de Cordoba S, Esparza-Gordillo J, Goicoechea de Jorge E, Lopez-Trascasa M, Sanchez-Corral P. The human complement factor H: functional roles, genetic variations and disease associations. Mol Immunol. 2004;41:355–67. doi: 10.1016/j.molimm.2004.02.005. [DOI] [PubMed] [Google Scholar]
- 2.Boon CJ, Klevering BJ, Leroy BP, Hoyng CB, Keunen JE, den Hollander AI. The spectrum of ocular phenotypes caused by mutations in the BEST1 gene. Prog Retin Eye Res. 2009;28:187–205. doi: 10.1016/j.preteyeres.2009.04.002. [DOI] [PubMed] [Google Scholar]
- 3.Maller JB, Fagerness JA, Reynolds RC, Neale BM, Daly MJ, Seddon JM. Variation in complement factor 3 is associated with risk of age-related macular degeneration. Nat Genet. 2007;39:1200–1. doi: 10.1038/ng2131. [DOI] [PubMed] [Google Scholar]
- 4.Gold B, Merriam JE, Zernant J, Hancox LS, Taiber AJ, Gehrs K, Cramer K, Neel J, Bergeron J, Barile GR, Smith RT, Hageman GS, Dean M, Allikmets R. Variation in factor B (BF) and complement component 2 (C2) genes is associated with age-related macular degeneration. Nat Genet. 2006;38:458–62. doi: 10.1038/ng1750. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Yates JR, Sepp T, Matharu BK, Khan JC, Thurlby DA, Shahid H, Clayton DG, Hayward C, Morgan J, Wright AF, Armbrecht AM, Dhillon B, Deary IJ, Redmond E, Bird AC, Moore AT. Complement C3 variant and the risk of age-related macular degeneration. N Engl J Med. 2007;357:553–61. doi: 10.1056/NEJMoa072618. [DOI] [PubMed] [Google Scholar]
- 6.Klein RJ, Zeiss C, Chew EY, Tsai JY, Sackler RS, Haynes C, Henning AK, Sangiovanni JP, Mane SM, Mayne ST, Bracken MB, Ferris FL, Ott J, Barnstable C, Hoh J. Complement factor H polymorphism in age-related macular degeneration. Science. 2005;308:385–9. doi: 10.1126/science.1109557. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Haines JL, Hauser MA, Schmidt S, Scott WK, Olson LM, Gallins P, Spencer KL, Kwan SY, Noureddine M, Gilbert JR, Schnetz-Boutaud N, Agarwal A, Postel EA, Pericak-Vance MA. Complement factor H variant increases the risk of age-related macular degeneration. Science. 2005;308:419–21. doi: 10.1126/science.1110359. [DOI] [PubMed] [Google Scholar]
- 8.Edwards AO, Ritter R, 3rd, Abel KJ, Manning A, Panhuysen C, Farrer LA. Complement factor H polymorphism and age-related macular degeneration. Science. 2005;308:421–4. doi: 10.1126/science.1110189. [DOI] [PubMed] [Google Scholar]
- 9.Klein R, Peto T, Bird A, Vannewkirk MR. The epidemiology of age-related macular degeneration. Am J Ophthalmol. 2004;137:486–95. doi: 10.1016/j.ajo.2003.11.069. [DOI] [PubMed] [Google Scholar]
- 10.Hughes AE, Orr N, Esfandiary H, Diaz-Torres M, Goodship T, Chakravarthy U. A common CFH haplotype, with deletion of CFHR1 and CFHR3, is associated with lower risk of age-related macular degeneration. Nat Genet. 2006;38:1173–7. doi: 10.1038/ng1890. [DOI] [PubMed] [Google Scholar]
- 11.Hageman GS, Hancox LS, Taiber AJ, Gehrs KM, Anderson DH, Johnson LV, Radeke MJ, Kavanagh D, Richards A, Atkinson J, Meri S, Bergeron J, Zernant J, Merriam J, Gold B, Allikmets R, Dean M. Extended haplotypes in the complement factor H (CFH) and CFH-related (CFHR) family of genes protect against age-related macular degeneration: characterization, ethnic distribution and evolutionary implications. Ann Med. 2006;38:592–604. [PMC free article] [PubMed] [Google Scholar]
- 12.Schmid-Kubista KE, Tosakulwong N, Wu Y, Ryu E, Hecker LA, Baratz KH, Brown WL, Edwards AO. Contribution of copy number variation in the regulation of complement activation locus to development of age-related macular degeneration. Invest Ophthalmol Vis Sci. 2009;50:5070–9. doi: 10.1167/iovs.09-3975. [DOI] [PubMed] [Google Scholar]
- 13.Fritsche LG, Lauer N, Hartmann A, Stippa S, Keilhauer CN, Oppermann M, Pandey MK, Kohl J, Zipfel PF, Weber BH, Skerka C. An imbalance of human complement regulatory proteins CFHR1, CFHR3 and factor H influences risk for age-related macular degeneration (AMD). Hum Mol Genet. 2010;19:4694–704. doi: 10.1093/hmg/ddq399. [DOI] [PubMed] [Google Scholar]
- 14.Heinen S, Hartmann A, Lauer N, Wiehl U, Dahse HM, Schirmer S, Gropp K, Enghardt T, Wallich R, Halbich S, Mihlan M, Schlotzer-Schrehardt U, Zipfel PF, Skerka C. Factor H-related protein 1 (CFHR-1) inhibits complement C5 convertase activity and terminal complex formation. Blood. 2009;114:2439–47. doi: 10.1182/blood-2009-02-205641. [DOI] [PubMed] [Google Scholar]
- 15.Hebecker M, Okemefuna AI, Perkins SJ, Mihlan M, Huber-Lang M, Jozsi M. Molecular basis of C-reactive protein binding and modulation of complement activation by factor H-related protein 4. Mol Immunol. 2010;47:1347–55. doi: 10.1016/j.molimm.2009.12.005. [DOI] [PubMed] [Google Scholar]
- 16.Narendra U, Pauer GJ, Hagstrom SA. Genetic analysis of complement factor H related 5, CFHR5, in patients with age-related macular degeneration. Mol Vis. 2009;15:731–6. [PMC free article] [PubMed] [Google Scholar]
- 17.Zhang H, Morrison MA, Dewan A, Adams S, Andreoli M, Huynh N, Regan M, Brown A, Miller JW, Kim IK, Hoh J, Deangelis MM. The NEI/NCBI dbGAP database: genotypes and haplotypes that may specifically predispose to risk of neovascular age-related macular degeneration. BMC Med Genet. 2008;9:51. doi: 10.1186/1471-2350-9-51. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Schouten JP, McElgunn CJ, Waaijer R, Zwijnenburg D, Diepvens F, Pals G. Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acids Res. 2002;30:e57. doi: 10.1093/nar/gnf056. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.González JR, Carrasco JL, Armengol L, Villatoro S, Jover L, Yasui Y, Estivill X. Probe-specific mixed-model approach to detect copy number differences using multiplex ligation-dependent probe amplification (MLPA). BMC Bioinformatics. 2008;9:261. doi: 10.1186/1471-2105-9-261. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Shen Y, Wu BL. Designing a simple multiplex ligation-dependent probe amplification (MLPA) assay for rapid detection of copy number variants in the genome. J Genet Genomics. 2009;36:257–65. doi: 10.1016/S1673-8527(08)60113-7. [DOI] [PubMed] [Google Scholar]
- 21.Park KH, Ryu E, Tosakulwong N, Wu Y, Edwards AO. Common variation in the SERPING1 gene is not associated with age-related macular degeneration in two independent groups of subjects. Mol Vis. 2009;15:200–7. [PMC free article] [PubMed] [Google Scholar]
- 22.Klein ML, Schultz DW, Edwards A, Matise TC, Rust K, Berselli CB, Trzupek K, Weleber RG, Ott J, Wirtz MK, Acott TS. Age-related macular degeneration. Clinical features in a large family and linkage to chromosome 1q. Arch Ophthalmol. 1998;116:1082–8. doi: 10.1001/archopht.116.8.1082. [DOI] [PubMed] [Google Scholar]
- 23.Majewski J, Schultz DW, Weleber RG, Schain MB, Edwards AO, Matise TC, Acott TS, Ott J, Klein ML. Age-related macular degeneration–a genome scan in extended families. Am J Hum Genet. 2003;73:540–50. doi: 10.1086/377701. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Hecker LA, Edwards AO, Ryu E, Tosakulwong N, Baratz KH, Brown WL, Charbel Issa P, Scholl HP, Pollok-Kopp B, Schmid-Kubista KE, Bailey KR, Oppermann M. Genetic control of the alternative pathway of complement in humans and age-related macular degeneration. Hum Mol Genet. 2010;19:209–15. doi: 10.1093/hmg/ddp472. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Klein R, Davis MD, Magli YL, Segal P, Klein BE, Hubbard L. The Wisconsin age-related maculopathy grading system. Ophthalmology. 1991;98:1128–34. doi: 10.1016/s0161-6420(91)32186-9. [DOI] [PubMed] [Google Scholar]
- 26.Park KH, Fridley BL, Ryu E, Tosakulwong N, Edwards AO. Complement component 3 (C3) haplotypes and risk of advanced age-related macular degeneration. Invest Ophthalmol Vis Sci. 2009;50:3386–93. doi: 10.1167/iovs.08-3231. [DOI] [PubMed] [Google Scholar]
- 27.Jankowski S, Currie-Fraser E, Xu L, Coffa J. Multiplex ligation-dependent probe amplification analysis on capillary electrophoresis instruments for a rapid gene copy number study. J Biomol Tech. 2008;19:238–43. [PMC free article] [PubMed] [Google Scholar]
- 28.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Methods. 2001;25:402–8. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 29.Edwards AO, Fridley BL, James KM, Sharma AS, Cunningham JM, Tosakulwong N. Evaluation of clustering and genotype distribution for replication in genome wide association studies: the age-related eye disease study. PLoS ONE. 2008;3:e3813. doi: 10.1371/journal.pone.0003813. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Spencer KL, Hauser MA, Olson LM, Schmidt S, Scott WK, Gallins P, Agarwal A, Postel EA, Pericak-Vance MA, Haines JL. Deletion of CFHR3 and CFHR1 genes in age-related macular degeneration. Hum Mol Genet. 2008;17:971–7. doi: 10.1093/hmg/ddm369. [DOI] [PubMed] [Google Scholar]
- 31.Redon R, Ishikawa S, Fitch KR, Feuk L, Perry GH, Andrews TD, Fiegler H, Shapero MH, Carson AR, Chen W, Cho EK, Dallaire S, Freeman JL, Gonzalez JR, Gratacos M, Huang J, Kalaitzopoulos D, Komura D, MacDonald JR, Marshall CR, Mei R, Montgomery L, Nishimura K, Okamura K, Shen F, Somerville MJ, Tchinda J, Valsesia A, Woodwark C, Yang F, Zhang J, Zerjal T, Armengol L, Conrad DF, Estivill X, Tyler-Smith C, Carter NP, Aburatani H, Lee C, Jones KW, Scherer SW, Hurles ME. Global variation in copy number in the human genome. Nature. 2006;444:444–54. doi: 10.1038/nature05329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Aitman TJ, Dong R, Vyse TJ, Norsworthy PJ, Johnson MD, Smith J, Mangion J, Roberton-Lowe C, Marshall AJ, Petretto E, Hodges MD, Bhangal G, Patel SG, Sheehan-Rooney K, Duda M, Cook PR, Evans DJ, Domin J, Flint J, Boyle JJ, Pusey CD, Cook HT. Copy number polymorphism in Fcgr3 predisposes to glomerulonephritis in rats and humans. Nature. 2006;439:851–5. doi: 10.1038/nature04489. [DOI] [PubMed] [Google Scholar]
- 33.Józsi M, Licht C, Strobel S, Zipfel SL, Richter H, Heinen S, Zipfel PF, Skerka C. Factor H autoantibodies in atypical hemolytic uremic syndrome correlate with CFHR1/CFHR3 deficiency. Blood. 2008;111:1512–4. doi: 10.1182/blood-2007-09-109876. [DOI] [PubMed] [Google Scholar]
- 34.Fellermann K, Stange DE, Schaeffeler E, Schmalzl H, Wehkamp J, Bevins CL, Reinisch W, Teml A, Schwab M, Lichter P, Radlwimmer B, Stange EF. A chromosome 8 gene-cluster polymorphism with low human beta-defensin 2 gene copy number predisposes to Crohn disease of the colon. Am J Hum Genet. 2006;79:439–48. doi: 10.1086/505915. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Yang Y, Chung EK, Wu YL, Savelli SL, Nagaraja HN, Zhou B, Hebert M, Jones KN, Shu Y, Kitzmiller K, Blanchong CA, McBride KL, Higgins GC, Rennebohm RM, Rice RR, Hackshaw KV, Roubey RA, Grossman JM, Tsao BP, Birmingham DJ, Rovin BH, Hebert LA, Yu CY. Gene copy-number variation and associated polymorphisms of complement component C4 in human systemic lupus erythematosus (SLE): low copy number is a risk factor for and high copy number is a protective factor against SLE susceptibility in European Americans. Am J Hum Genet. 2007;80:1037–54. doi: 10.1086/518257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.McKinney C, Merriman ME, Chapman PT, Gow PJ, Harrison AA, Highton J, Jones PB, McLean L, O'Donnell JL, Pokorny V, Spellerberg M, Stamp LK, Willis J, Steer S, Merriman TR. Evidence for an influence of chemokine ligand 3-like 1 (CCL3L1) gene copy number on susceptibility to rheumatoid arthritis. Ann Rheum Dis. 2008;67:409–13. doi: 10.1136/ard.2007.075028. [DOI] [PubMed] [Google Scholar]
- 37.Tuzun E, Sharp AJ, Bailey JA, Kaul R, Morrison VA, Pertz LM, Haugen E, Hayden H, Albertson D, Pinkel D, Olson MV, Eichler EE. Fine-scale structural variation of the human genome. Nat Genet. 2005;37:727–32. doi: 10.1038/ng1562. [DOI] [PubMed] [Google Scholar]
- 38.Ionita-Laza I, Rogers AJ, Lange C, Raby BA, Lee C. Genetic association analysis of copy-number variation (CNV) in human disease pathogenesis. Genomics. 2009;93:22–6. doi: 10.1016/j.ygeno.2008.08.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Zipfel PF, Edey M, Heinen S, Jozsi M, Richter H, Misselwitz J, Hoppe B, Routledge D, Strain L, Hughes AE, Goodship JA, Licht C, Goodship TH, Skerka C. Deletion of complement factor H-related genes CFHR1 and CFHR3 is associated with atypical hemolytic uremic syndrome. PLoS Genet. 2007;3:e41. doi: 10.1371/journal.pgen.0030041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Moore I, Strain L, Pappworth I, Kavanagh D, Barlow PN, Herbert AP, Schmidt CQ, Staniforth SJ, Holmes LV, Ward R, Morgan L, Goodship TH, Marchbank KJ. Association of factor H autoantibodies with deletions of CFHR1, CFHR3, CFHR4, and with mutations in CFH, CFI, CD46, and C3 in patients with atypical hemolytic uremic syndrome. Blood. 2010;115:379–87. doi: 10.1182/blood-2009-05-221549. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Gale DP, de Jorge EG, Cook HT, Martinez-Barricarte R, Hadjisavvas A, McLean AG, Pusey CD, Pierides A, Kyriacou K, Athanasiou Y, Voskarides K, Deltas C, Palmer A, Fremeaux-Bacchi V, de Cordoba SR, Maxwell PH, Pickering MC. Identification of a mutation in complement factor H-related protein 5 in patients of Cypriot origin with glomerulonephritis. Lancet. 2010;376:794–801. doi: 10.1016/S0140-6736(10)60670-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Raychaudhuri S, Ripke S, Li M, Neale BM, Fagerness J, Reynolds R, Sobrin L, Swaroop A, Abecasis G, Seddon JM, Daly MJ. Associations of CFHR1-CFHR3 deletion and a CFH SNP to age-related macular degeneration are not independent. Nat Genet. 2010;42:553–5. doi: 10.1038/ng0710-553. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Hageman GS, Anderson DH, Johnson LV, Hancox LS, Taiber AJ, Hardisty LI, Hageman JL, Stockman HA, Borchardt JD, Gehrs KM, Smith RJ, Silvestri G, Russell SR, Klaver CC, Barbazetto I, Chang S, Yannuzzi LA, Barile GR, Merriam JC, Smith RT, Olsh AK, Bergeron J, Zernant J, Merriam JE, Gold B, Dean M, Allikmets R. A common haplotype in the complement regulatory gene factor H (HF1/CFH) predisposes individuals to age-related macular degeneration. Proc Natl Acad Sci USA. 2005;102:7227–32. doi: 10.1073/pnas.0501536102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Tortajada A, Montes T, Martinez-Barricarte R, Morgan BP, Harris CL, de Cordoba SR. The disease-protective complement factor H allotypic variant Ile62 shows increased binding affinity for C3b and enhanced cofactor activity. Hum Mol Genet. 2009;18:3452–61. doi: 10.1093/hmg/ddp289. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Montes T, Tortajada A, Morgan BP, Rodriguez de Cordoba S, Harris CL. Functional basis of protection against age-related macular degeneration conferred by a common polymorphism in complement factor B. Proc Natl Acad Sci USA. 2009;106:4366–71. doi: 10.1073/pnas.0812584106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Neale BM, Fagerness J, Reynolds R, Sobrin L, Parker M, Raychaudhuri S, Tan PL, Oh EC, Merriam JE, Souied E, Bernstein PS, Li B, Frederick JM, Zhang K, Brantley MA, Jr, Lee AY, Zack DJ, Campochiaro B, Campochiaro P, Ripke S, Smith RT, Barile GR, Katsanis N, Allikmets R, Daly MJ, Seddon JM. Genome-wide association study of advanced age-related macular degeneration identifies a role of the hepatic lipase gene (LIPC). Proc Natl Acad Sci USA. 2010;107:7395–400. doi: 10.1073/pnas.0912019107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Li M, Atmaca-Sonmez P, Othman M, Branham KE, Khanna R, Wade MS, Li Y, Liang L, Zareparsi S, Swaroop A, Abecasis GR. CFH haplotypes without the Y402H coding variant show strong association with susceptibility to age-related macular degeneration. Nat Genet. 2006;38:1049–54. doi: 10.1038/ng1871. [DOI] [PMC free article] [PubMed] [Google Scholar]



