Abstract
Post-transcriptional regulation of HIV-1 gene expression is mediated by interactions between viral transcripts and viral/cellular proteins. For HIV-1, post-transcriptional nuclear control allows for the export of intron-containing RNAs which are normally retained in the nucleus. Specific signals on the viral RNAs, such as instability sequences (INS) and Rev responsive element (RRE), are binding sites for viral and cellular factors that serve to regulate RNA-export. The HIV-1 encoded viral Rev protein binds to the RRE found on unspliced and incompletely spliced viral RNAs. Binding by Rev directs the export of these RNAs from the nucleus to the cytoplasm. Previously, Rev co-factors have been found to include cellular factors such as CRM1, DDX3, PIMT and others. In this work, the nuclear matrix protein Matrin 3 is shown to bind Rev/RRE-containing viral RNA. This binding interaction stabilizes unspliced and partially spliced HIV-1 transcripts leading to increased cytoplasmic expression of these viral RNAs.
Keywords: Matrin 3, HIV-1, Rev, RNA export, nuclear matrix protein
Background
The nucleus is a highly organized structure. Chromosomes occupy discrete regions, and specific proteins and nucleic acids are enriched in subnuclear structures such as nuclear lamina, nucleoli, Cajal bodies, nuclear speckles, and paraspeckles [1-6]. The nuclear matrix, a network of underlying filaments in the cell nucleus, shapes the nuclear architecture and functions in genome maintenance, transcription and RNA metabolism [7-17]. Accordingly, the nuclear matrix has important roles in tissue development and cellular proliferation; and the disruption of nuclear organization is often correlated with disease states such as the loss of subnuclear promyelocytic leukemia bodies in acute promyelocytic leukemia [18-21].
HIV-1 gene expression and replication are regulated at transcriptional and post-transcriptional steps including the transactivation of the HIV-1 LTR by Tat [22] and the export of unspliced or partially spliced viral RNAs from the nucleus to the cytoplasm by Rev [23-26]. Rev is a trans-acting viral protein which binds to a cis-acting Rev responsive element (RRE) present in unspliced and partially spliced HIV transcripts. Rev has been shown to interact with cellular proteins CRM1, DDX3, PIMT and others to mediate the export of unspliced and singly spliced viral RNAs [27-30]. The mechanism of viral RNA export by Rev is discrete from the export pathways used by fully spliced HIV-1 mRNAs, CTE- (constitutive transport element) dependent RNAs, and cellular mRNAs [31-43].
Recently, numerous studies have implicated the nuclear matrix in gene transcription, RNA splicing, and transport of cellular RNAs [5,7,9,44,45]; however, the role of the nuclear matrix in HIV-1 gene expression has been poorly explored [46-48]. Here, we identify Matrin 3 as a key component of factors that mediate the post-transcriptional regulation of HIV-1. Matrin 3 is a highly conserved inner nuclear matrix protein which has been previously shown to play a role in transcription [49-52]. It interacts with other nuclear matrix proteins to form the internal fibrogranular network; it acts in the nuclear retention of promiscuously A-to-I edited RNAs in cooperation with p54(nrb) and PSF [53,54]; it participates in NMDA-induced neuronal death; it modulates the promoter activity of genes proximal to matrix/scaffold attachment region (MAR/SAR) [55]; and it is involved in the repair of double strand breaks [56]. Our current findings implicate that Matrin 3 also influences the post-transcriptional expression of a subset of HIV-1 mRNAs.
Results
Matrin 3 enhances Rev/RRE directed gene expression
We identified Matrin 3 as a PTB-1 (polypyrimidine tract binding protein -1) interacting protein in a yeast 2 hybrid assay (Table 1). PTB -1 plays a role in the alternative splicing of cellular mRNAs and has been described to promote the expression of fully spliced HIV-1 transcripts (our unpublished results and [57]). A "PTB-1 associated splicing factor" [58] named PSF has been proposed to inhibit the expression of HIV-1 unspliced/spliced transcripts [59]. We reasoned that like PSF, Matrin 3 through its association with PTB-1 might modulate HIV-1 gene expression.
Table 1.
PTB-1 interacting proteins identified by yeast 2 hybrid assay | Other names/synonyms | Accession # |
---|---|---|
A) Interacting with Human PTB-1 | ||
Aladin | AAAS; adracalin | NP_056480 |
Calcium and integrin binding 1 | CIB1; CIB; kinase-interacting protein 1; KIP1 | NP_006375 |
Cleavage stimulation factor, 3' pre-RNA, subunit 2, 64 kD, tau | CSTF2T; KIAA0689 | NP_056050 |
Homeodomain-interacting protein kinase 1 isoform1 | HIPK1; KIAA0630 | NP_938009 |
Matrin 3 | MATR3 | NP_001181883 |
poly(rC) binding protein 1 | PCBP1 | NP_006187 |
RNA binding motif protein 10 | RBM10 | NP_005667 |
Exportin 1 | CRM1; XPO1 | NP_003391 |
heterogeneous nuclear ribonucleoprotein K, isoform b | HNRPK | NP_112552 |
heterogeneous nuclear ribonucleoprotein L | HNRPL | NP_001524 |
Raver1 | Raver1 | NP_597709 |
A) Interacting with Mouse PTB-1 | ||
arylhydrocarbon receptor nuclear translocator | ARNT, hypoxia-inducible factor 1, beta subunit; dioxin receptor | NP_001659 |
Calcium and integrin binding 1 | CIB1; CIB; KINASE-INTERACTING PROTEIN 1; KIP1 | NP_006375 |
DAZ associated protein 2 | DAZAP2 | NP_055579 |
nuclear receptor coactivator 6 | NCOA6 | NP_054790 |
Raver1 | Raver1 | NP_597709 |
Matrin 3 | MATR3 | NP_001181883 |
RNA binding motif protein 10 | RBM10 | NP_005667 |
fibrosin-1-like protein | KIAA1545; FBRSL1 | NP_001136113 |
protein BAT2-like 1 | KIAA0515; BAT2L1 | NP_037450 |
hexaribonucleotide binding protein 3 | HRNBP3; RBFOX3; FOX3 | NP_001076044 |
G protein pathway suppressor 2 | GPS2 | NP_004480 |
proline rich 3 | PRR3 | NP_079539 |
tripartite motif-containing 8 | TRIM8 | NP_112174 |
zinc finger, CCHC domain containing 2 | ZCCHC2; | NP_060212 |
zinc finger protein 36, C3H type, homolog | ZFP36A, tristetraprolin; NUP475 | NP_003398 |
neuro-oncological ventral antigen 1 | NOVA1 | NP_002506 |
neuro-oncological ventral antigen 2 | NOVA2 | NP_002507 |
Matrin 3 was identified to interact with both Human and Mouse PTB-1 (indicated in bold and italics. The yeast 2 hybrid screening was performed at Myriad Pronet (Utah, USA) using human and mouse PTB-1 as bait. PTB-1 interacting proteins were identified using activation domain fused libraries obtained from human spleen, brain and heart.
To explore a role for Matrin 3 in HIV-1 replication, we measured the effect of over expressed Matrin 3 on viral Tat and Rev mediated gene expression. We expressed Matrin 3 and Tat, either separately or together, in HeLa cells with an HIV-1 LTR luciferase plasmid and measured reporter-expression. As shown in Figure 1A, Matrin 3 did not influence either basal LTR expression or Tat activated expression, suggesting that it does not act at the step of transcription.
We next investigated if Matrin 3 acts at steps post transcription. Rev is required for the cytoplasmic localization of unspliced and partially spliced HIV-1 mRNAs that encode for viral Gag, Env, Vif and Vpu proteins. Rev binds to an RRE-RNA motif in these RNAs [60,61]. Unlike fully spliced viral RNAs, these transcripts contain cis-inhibitory RNA elements which restrict their export from the nucleus into the cytoplasm in the absence of Rev binding to the RRE motif. The binding of Rev to the RRE frees this restriction, and Gag protein expression is thus increased by several fold compared to its expression in the absence of Rev [60,61].
We checked if Matrin 3 affects Rev-mediated post-transcriptional processes by using a CMV-promoter driven Gag-Pol-RRE expression plasmid as a reporter. HeLa cells were transfected with wild type and mutant Matrin 3 together with pCMV Gag-Pol RRE, as indicated; and 24 hours later, cells were harvested and cell lysates were analyzed by Western blotting. Figure 1B (lanes 1 and 2) shows that Matrin 3 did not alter the expression of Gag in the absence of Rev; however, in the presence of Rev, Matrin 3 increased Gag expression by approximately 10 fold (Figure 1B, lanes 3 and 4). These results support a role for Matrin 3 in Rev-dependent expression of RRE-containing HIV-1 transcripts.
The CTE is a cis-motif found in RNAs from simple type D retroviruses [32]. It recruits cellular RNA-binding proteins that act to export unspliced or partially spliced viral mRNAs from the nucleus into the cytoplasm [39,41]. Artificial placement of the CTE into HIV-1 Gag RNA facilitates its cytoplasmic export and expression, independent of Rev/RRE function [32]. Indeed, CTE and Rev/RRE describe two separate pathways such that the inhibition of either pathway does not affect the export of RNA through the other pathway [34,35]. We next assayed a Gag expression vector in which the RRE was replaced with a CTE. Unlike the results from Gal-Pol-RRE (Figure 1b), we found that the over expression of Matrin 3 had no effect on Gag-Pol-CTE expression (Figure 1C, lanes 5 and 6).
It would be physiologically important to replicate the observations made on the Gag-Pol reporters using a full length HIV-1 infectious molecular clone, pNL4-3. We thus transfected HeLa cells with pNL4-3 and either a control vector or a Matrin 3 expressing vector. One day after transfection, cell lysates were immunoblotted for p24 Gag; and we found that Matrin 3 increased p24 Gag level by approximately 10 fold (Figure 2A). In a complementary experiment, Matrin 3 RNA was knocked down using specific siRNAs (Figure 2B). siRNA-mediated knock down of Matrin 3 decreased HIV-1 p24 Gag expression from pNL4-3 by 3 to 4 fold (Figure 2B). On the other hand, when Matrin 3 expression in knocked down cells was reconstituted (Additional file 1, Figure S1), HIV-1 gene expression was restored. Collectively, the results are consistent with Matrin 3 selectively acting on HIV-1 Rev/RRE - dependent post-transcriptional events.
Matrin 3 interacts with Rev
How does Matrin 3 affect Rev/RRE-dependent expression? We wondered if Rev, Matrin 3 and RRE-containing RNA are together in a ribonucleoprotein complex. To check this possibility, we transfected and immunoprecipitated HeLa cells with EGFP-Rev with or without Matrin 3 along with versions of HIV-1 Gag p37 constructs (Figure 3A) with or without RRE or CTE [62-64]. The immunoprecipitates were then analyzed by Western blotting using either anti-HA or anti-GFP. Figure 3 shows that there was no interaction between Rev and Matrin 3 (Figure 3B, lanes 7, 9, 10, 11, 12), except when a p37-RRE plasmid was expressed (p37RRE; Figure 3B, lane 8; top). This interaction was not seen when a p37CTE plasmid was used in place of p37RRE (Figure 3B, lanes 9) or when the p37 Gag sequences were codon optimized to make the expression of the RNA transcripts Rev-independent (Figure 3B, lanes 10-12) [62-64]. Thus, our interpretation currently favors that the interaction of Matrin 3 and Rev specifically requires the presence of a Rev-dependent RRE-containing RNA (p37-RRE), but not a Rev-independent RRE-containing RNA (p37-M1-10-RRE). In our experiments, the p37 protein expression levels are similar between p37-RRE, p37-CTE, (Figure 3B, lanes 8-9) and p37M1-10, p37M1-10-RRE and p37-M1-10-CTE (Figure 3B, lanes 10-12); hence, the Matrin 3 - Rev interaction is not influenced by the amount of p37 protein.
Matrin 3 RNA recognition motifs (RRM) 3 are required for activity on Rev/RRE
The above results are consistent with Matrin 3 associating with Rev and RRE-RNA to facilitate expression. A prediction from these results is that an RNA-binding competent Matrin 3 is needed for its activity on HIV-1 RNAs. To address this notion, we constructed two Matrin 3 deletion mutants as indicated in Figure 4A. Matrin 3 is an 847-amino acid protein with two RNA recognition motifs (RRM) contained in amino acids 399 to 567, and a bipartite NLS in amino acids 586 - 612. The RRMs are required for Matrin 3 to bind RNA. The two Matrin 3 deletion mutants expressed well in human cells (Figure 4B). When both were assayed in co-transfections with pNL4-3 (Figure 4C) and compared to the activity of wild type Matrin 3, neither mutant was proficient in activating HIV-1 as measured by Gag p24 expression (Figure 4C). The mutants showed expected localization in the nucleus (Additional file 2 Figure S2). The results from the RRM mutants are consistent with the notion that RNA-binding by Matrin 3 is required for its HIV-1 function.
Matrin 3 increases the stability and nuclear export of HIV-1 RRE-containing transcripts
One consequence of Matrin 3 binding to RNA could be the stabilization of RRE-containing transcript. To check this possibility, we compared the expression of RRE containing transcripts in HeLa cells transfected with HA-Matrin 3 (Figure 5). In HIV-1, the unspliced, partially spliced and fully spliced RNAs can be categorized into three groups based on their sizes. The ~ 9 kb unspliced RNA serves as the genomic RNA and also encodes the Gag, Gag-Pol fusion proteins. A set of ~ 4 kb, singly spliced mRNAs encode for Env, Vpr, Vif and Vpu. A group of fully spliced ~ 1.8 kb mRNAs encode Tat, Rev and Nef. The 9 kb and 4 kb classes of mRNAs contain the RRE element while the 1.8 kb mRNAs do not. We analyzed the effect of Matrin 3 on the expression of the 9 kb and 4 kb transcripts compared to the Rev/RRE independent 1.8 kb group of RNA. HeLa cells were transfected with pNL4-3 and Matrin 3 for this analysis, and we analyzed 20 μg of total RNA by Northern blotting (Figure 5A). There was an increase, in the HA-Matrin 3 transfected cells, in the 9 kb unspliced and 4 kb singly-spliced RNA transcripts (which contain RRE; ratios of 1:2.9 and 1:2.3 respectively; Figure 5A, bottom), compared to the fully spliced 1.8 kb RNA (which does not contain RRE; a ratio of 1:1.2; Figure 5A, bottom).
We next investigated the consequence of increased Matrin 3 expression on cytoplasmic distribution of unspliced versus spliced viral RNAs. We co-transfected HeLa cells with pNL4-3 and Matrin 3, and fractionated cellular RNAs into total, cytoplasmic, or nuclear constituents. We isolated the RNAs from these fractions and analyzed them by qRT-PCR for the levels of unspliced and spliced RNAs using primers specific for the 9 kb or the 1.8 kb viral RNA. We used GAPDH as a normalization control for our fractionation (GAPDH; Figure 5B). Consistent with the Northern blot results, there was a 3 fold increase in expression of unspliced viral RNA in the cells (total 9 kb; Figure 5B), but interestingly the amount of 9 kb viral RNA distributed into the cytoplasm of pCMV-HA-Matrin 3 expressing cells was 10 fold higher than that found in pCMV-HA expressing cells (cytoplasmic 9 kb; Figure 5B; also see Additional file 3, Figure S3). By contrast, the distribution and expression of spliced RNA remained unchanged in the presence of increased Matrin 3 expression (1.8 kb; Figure 5B). These results are consistent with the interpretation that Matrin 3 can selectively stabilize and increase the nuclear to cytoplasmic distribution of unspliced 9 kb vs. spliced 1.8 kb HIV-1 RNAs.
Discussion
Here, we have shown that nuclear matrix protein Matrin 3 influences the expression of HIV-1 RRE-containing mRNAs. Matrin 3 acts post-transcriptionally via Rev/RRE to increase the expression of HIV-1 Rev/RRE dependent unspliced or partially spliced transcripts. This activity requires Matrin 3 to bind Rev-dependent RRE-containing RNA and appears to lead to the stabilization and nuclear to cytoplasmic export of RRE-containing HIV-1 transcripts.
Previously it was shown that Matrin 3 exists in cells complexed with PSF (PTBP associated splicing factor) and nrbp54 [53,65-67]. Others have found that PSF binds to instability elements (INS) contained within the HIV-1 transcripts and suppresses the expression of these RNAs [59]. The INS elements are primarily present in the RRE-containing unspliced and partially spliced viral transcripts [31,64,68-72]. It is possible that some of the effects that we have observed from Matrin 3 may be due to its interaction with PSF and p54nrb. That Matrin 3 might counter the reported PSF-suppression of RNA expression has not been explored here, but it remains important to establish and clarify this mechanistic interaction in the future.
Our results are compatible with a model in which Matrin 3 binds to RRE containing transcripts and stabilizes them in the presence of Rev, which then directs these viral transcripts for export out of the nucleus. This interpretation is supported by our observation that Rev - Matrin 3 interaction is RRE-RNA dependent, and Matrin 3 activity requires the presence of Rev and RRE-containing RNA. Further experiments are needed to answer the mechanistic details of how Matrin 3 and Rev cooperate in their interactions with RRE-containing RNA. One intriguing finding is that Matrin 3 has been identified as a constituent of the nuclear pore proteomes [73]; this localization would be compatible with Matrin 3 being a part of an RNP-complex that exits the nucleus into the cytoplasm through the nuclear pore. Also of interest, Bushman et al. [74] recently performed a meta-analysis of published genome-wide siRNA screening of cellular factors important for HIV-1 replication. They used a graph theory clustering algorithm (MCODE) to assemble a HIV-1 host interactome in which nuclear matrix structure (Matrin 3) was identified as an interactor with the molecular chaperone cluster identified by siRNA-screening as involved in the assembly of viral proteins. Our evidence here for a role of Matrin 3 in HIV-1 post-transcriptional RNA expression is consistent with the above analysis. In conclusion, the implication of Matrin 3 as an additional Rev co-factor adds further complexity to the understanding of post-transcriptional regulation of unspliced/partially spliced HIV-1 RNA. Although it remains to be established, Matrin 3 may be a cellular factor that counters the nuclear retention through INS elements of HIV-1 unspliced/partially spliced RNAs.
Materials and methods
Plasmids
Full-length Matrin 3 clone was purchased from Open Biosystems and cloned into pCMV-HA vector (Clontech) by PCR. HIV-1 LTR luciferase plasmid, pCMV-NL-GagPol-RRE and pCMV-NL-GagPol-CTE were from E. Freed and D. Rekosh. Plasmids p37 and p37RRE were kindly provided by B. Felber [64] and cloned into pcDNA3.
Cell Culture, Transfection, and Reporter Assays
Cell propagation, transfection, qRT-PCR and reporter assays were as described previously [28,29]. All transfections were repeated three or more times and were normalized to β-galactosidase activity expressed from a co-transfected pCMV-β (Clontech).
Antibodies
Mouse monoclonal anti-HA (Sigma Chemical); mouse monoclonal Matrin 3, (Abcam) and rabbit anti-GFP and anti-HA (Cell Sciences) are commercially available.
Western Blotting, and Immunoprecipitation
Western blotting and immunoprecipitation were performed as described previously [28,29]. Briefly, the cells were washed twice with PBS and lysed with sample buffer [100 mMTris (pH6.8), 4%SDS, 20% glycerol, 5% β-mercaptoethanol, and 0.05% bromophenol blue]. Cell lysates were boiled for 10 minutes, and loaded onto a SDS/PAGE gel and electrophoresed. The gel was electroblotted onto Immobilon-P membranes (Millipore) and probed with the primary antibodies, followed by incubation with anti-rabbit, anti-mouse, or anti-human alkaline phosphatase-conjugated secondary antibody and detected using a chemiluminescence substrate (Applied Biosystems).
RNA isolation, Northern blotting and qRT-PCR
Total RNA from cells was extracted with Tri-Reagent (Sigma-Aldrich). Nuclear and cytoplasmic RNAs were isolated by cell fractionation (Paris Kit; Applied Biosystems), and RNA was isolated with Tri-Reagent. Northern blots were performed as described previously [28]. Extracted RNA was analyzed by qRT-PCR using the iScript One-Step RT-PCR Kit with SYBR Green (Bio-Rad) according to manufacturer's instructions. Samples were reverse-transcribed at 50°C for 30 minutes, and amplification was performed after an initial step at 95°C for 10 minutes, followed by 20-40 cycles at 95°C for 30 s, 55°C for 30 s, and 72°C for 60 s. The primers and their sequences used in the analyses have been previously described [29]. Primers for unspliced transcripts were Primer A 5′-GTCTCTCTGGTTAGACCAG-3′, Primer C 5′-CTAGTCAAAATTTTTGGCGTACTC-3′ and primer A and sj4.7A 5′- TTGGGAGGTGGGTTGCTTTGATAGAG-3 for spliced 2 Kb transcript. For GAPDH forward 5′ CTCTGCTCCTCCTGTTCGAC 3′ and GAPDH reverse 5′ TTAAAAGCAGCCCTGGTGAC 3′ primers were used.
Co-immunoprecipitation
Co-immunoprecipitation assay has been described previously [28,29]. Cell lysates were prepared in RIPA buffer [Tris-buffered saline (pH 8.0) containing 1% Triton X-100 or Nonidet P-40, 1 mg of BSA/mL, and 1 mM EDTA] containing (phenylmethylsulfonyl fluoride and aprotinin 10 μg/mL), 0.5% sodium deoxycholate, and 0.1% SDS. Cell lysates were prepared and incubated at 4°C overnight with the indicated antibodies and immune complexes were pulled down using protein G-agarose beads and analyzed by Western blotting.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
VSY performed all the experiments. VSY and KTJ designed the experiments and wrote the manuscript. Both authors read and approved the final manuscript.
Supplementary Material
Contributor Information
Venkat SRK Yedavalli, Email: vyedavalli@mail.nih.gov.
Kuan-Teh Jeang, Email: kjeang@niaid.nih.gov.
Acknowledgements
Work in KTJ's laboratory was supported in part by Intramural funds from NIAID, and by the Intramural AIDS Targeted Antiviral Program (IATAP) from the office of the Director, NIH. We thank members of KTJ's laboratory for reading and commenting on the manuscript, and Barbara Felber for sharing several critical reagents. We are grateful to Anna Kula and Alessandro Marcello for sharing data in their paper prior to publication [75].
References
- Vlcek S, Dechat T, Foisner R. Nuclear envelope and nuclear matrix: interactions and dynamics. Cell Mol Life Sci. 2001;58:1758–1765. doi: 10.1007/PL00000815. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Baxter J, Merkenschlager M, Fisher AG. Nuclear organisation and gene expression. Curr Opin Cell Biol. 2002;14:372–376. doi: 10.1016/S0955-0674(02)00339-3. [DOI] [PubMed] [Google Scholar]
- Stein GS, Lian JB, Montecino M, Stein JL, van Wijnen AJ, Javed A, Pratap J, Choi J, Zaidi SK, Gutierrez S. et al. Nuclear microenvironments support physiological control of gene expression. Chromosome Res. 2003;11:527–536. doi: 10.1023/A:1024943214431. [DOI] [PubMed] [Google Scholar]
- Stein GS. Gene expression in nuclear microenvironments for biological control and cancer. Cancer Biol Ther. 2007;6:1817–1821. doi: 10.4161/cbt.6.11.5294. [DOI] [PubMed] [Google Scholar]
- Stein GS, Davie JR, Knowlton JR, Zaidi SK. Nuclear microenvironments and cancer. J Cell Biochem. 2008;104:1949–1952. doi: 10.1002/jcb.21846. [DOI] [PubMed] [Google Scholar]
- Fedorova E, Zink D. Nuclear architecture and gene regulation. Biochim Biophys Acta. 2008;1783:2174–2184. doi: 10.1016/j.bbamcr.2008.07.018. [DOI] [PubMed] [Google Scholar]
- Berezney R, Coffey DS. Nuclear protein matrix: association with newly synthesized DNA. Science. 1975;189:291–293. doi: 10.1126/science.1145202. [DOI] [PubMed] [Google Scholar]
- Cook PR. The nucleoskeleton: artefact, passive framework or active site? J Cell Sci. 1988;90(Pt 1):1–6. doi: 10.1242/jcs.90.1.1. [DOI] [PubMed] [Google Scholar]
- Nickerson JA. Nuclear dreams: the malignant alteration of nuclear architecture. J Cell Biochem. 1998;70:172–180. doi: 10.1002/(SICI)1097-4644(19980801)70:2<172::AID-JCB3>3.0.CO;2-L. [DOI] [PubMed] [Google Scholar]
- Wei X, Samarabandu J, Devdhar RS, Siegel AJ, Acharya R, Berezney R. Segregation of transcription and replication sites into higher order domains. Science. 1998;281:1502–1506. doi: 10.1126/science.281.5382.1502. [DOI] [PubMed] [Google Scholar]
- Berezney R. Regulating the mammalian genome: the role of nuclear architecture. Adv Enzyme Regul. 2002;42:39–52. doi: 10.1016/s0065-2571(01)00041-3. [DOI] [PubMed] [Google Scholar]
- Stein GS, Zaidi SK, Braastad CD, Montecino M, van Wijnen AJ, Choi JY, Stein JL, Lian JB, Javed A. Functional architecture of the nucleus: organizing the regulatory machinery for gene expression, replication and repair. Trends Cell Biol. 2003;13:584–592. doi: 10.1016/j.tcb.2003.09.009. [DOI] [PubMed] [Google Scholar]
- Zaidi SK, Young DW, Choi JY, Pratap J, Javed A, Montecino M, Stein JL, van Wijnen AJ, Lian JB, Stein GS. The dynamic organization of gene-regulatory machinery in nuclear microenvironments. EMBO Rep. 2005;6:128–133. doi: 10.1038/sj.embor.7400337. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Misteli T. Beyond the sequence: cellular organization of genome function. Cell. 2007;128:787–800. doi: 10.1016/j.cell.2007.01.028. [DOI] [PubMed] [Google Scholar]
- Lanctot C, Cheutin T, Cremer M, Cavalli G, Cremer T. Dynamic genome architecture in the nuclear space: regulation of gene expression in three dimensions. Nat Rev Genet. 2007;8:104–115. doi: 10.1038/nrg2041. [DOI] [PubMed] [Google Scholar]
- Malyavantham KS, Bhattacharya S, Barbeitos M, Mukherjee L, Xu J, Fackelmayer FO, Berezney R. Identifying functional neighborhoods within the cell nucleus: proximity analysis of early S-phase replicating chromatin domains to sites of transcription, RNA polymerase II, HP1gamma, matrin 3 and SAF-A. J Cell Biochem. 2008;105:391–403. doi: 10.1002/jcb.21834. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cohen TV, Hernandez L, Stewart CL. Functions of the nuclear envelope and lamina in development and disease. Biochem Soc Trans. 2008;36:1329–1334. doi: 10.1042/BST0361329. [DOI] [PubMed] [Google Scholar]
- Nelson WG, Pienta KJ, Barrack ER, Coffey DS. The role of the nuclear matrix in the organization and function of DNA. Annu Rev Biophys Biophys Chem. 1986;15:457–475. doi: 10.1146/annurev.bb.15.060186.002325. [DOI] [PubMed] [Google Scholar]
- Pederson T. Half a century of "the nuclear matrix". Mol Biol Cell. 2000;11:799–805. doi: 10.1091/mbc.11.3.799. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Coffey DS. Nuclear matrix proteins as proteomic markers of preneoplastic and cancer lesions: commentary re: G. Brunagel et al., nuclear matrix protein alterations associated with colon cancer metastasis to the liver. Clin. Cancer Res., 8: 3039-3045, 2002. Clin Cancer Res. 2002;8:3031–3033. [PubMed] [Google Scholar]
- Sjakste N, Sjakste T, Vikmanis U. Role of the nuclear matrix proteins in malignant transformation and cancer diagnosis. Exp Oncol. 2004;26:170–178. [PubMed] [Google Scholar]
- Berkhout B, Silverman RH, Jeang KT. Tat trans-activates the human immunodeficiency virus through a nascent RNA target. Cell. 1989;59:273–282. doi: 10.1016/0092-8674(89)90289-4. [DOI] [PubMed] [Google Scholar]
- Malim MH, Hauber J, Le SY, Maizel JV, Cullen BR. The HIV-1 rev trans-activator acts through a structured target sequence to activate nuclear export of unspliced viral mRNA. Nature. 1989;338:254–257. doi: 10.1038/338254a0. [DOI] [PubMed] [Google Scholar]
- Zapp ML, Green MR. Sequence-specific RNA binding by the HIV-1 Rev protein. Nature. 1989;342:714–716. doi: 10.1038/342714a0. [DOI] [PubMed] [Google Scholar]
- Hope TJ, McDonald D, Huang XJ, Low J, Parslow TG. Mutational analysis of the human immunodeficiency virus type 1 Rev transactivator: essential residues near the amino terminus. J Virol. 1990;64:5360–5366. doi: 10.1128/jvi.64.11.5360-5366.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nekhai S, Jeang KT. Transcriptional and post-transcriptional regulation of HIV-1 gene expression: role of cellular factors for Tat and Rev. Future Microbiol. 2006;1:417–426. doi: 10.2217/17460913.1.4.417. [DOI] [PubMed] [Google Scholar]
- Cochrane A. Inhibition of HIV-1 gene expression by Sam68 Delta C: multiple targets but a common mechanism? Retrovirology. 2009;6:22. doi: 10.1186/1742-4690-6-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yedavalli VS, Neuveut C, Chi YH, Kleiman L, Jeang KT. Requirement of DDX3 DEAD box RNA helicase for HIV-1 Rev-RRE export function. Cell. 2004;119:381–392. doi: 10.1016/j.cell.2004.09.029. [DOI] [PubMed] [Google Scholar]
- Yedavalli VS, Jeang KT. Trimethylguanosine capping selectively promotes expression of Rev-dependent HIV-1 RNAs. Proc Natl Acad Sci USA. 2010;107:14787–14792. doi: 10.1073/pnas.1009490107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yedavalli VS, Jeang KT. Rev-ing up post-transcriptional HIV-1 RNA expression. RNA Biol. 2011;8:(2):195–9. doi: 10.4161/rna.8.2.14803. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Felber BK, Hadzopoulou-Cladaras M, Cladaras C, Copeland T, Pavlakis GN. rev protein of human immunodeficiency virus type 1 affects the stability and transport of the viral mRNA. Proc Natl Acad Sci USA. 1989;86:1495–1499. doi: 10.1073/pnas.86.5.1495. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bray M, Prasad S, Dubay JW, Hunter E, Jeang KT, Rekosh D, Hammarskjold ML. A small element from the Mason-Pfizer monkey virus genome makes human immunodeficiency virus type 1 expression and replication Rev-independent. Proc Natl Acad Sci USA. 1994;91:1256–1260. doi: 10.1073/pnas.91.4.1256. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Neville M, Stutz F, Lee L, Davis LI, Rosbash M. The importin-beta family member Crm1p bridges the interaction between Rev and the nuclear pore complex during nuclear export. Curr Biol. 1997;7:767–775. doi: 10.1016/S0960-9822(06)00335-6. [DOI] [PubMed] [Google Scholar]
- Pasquinelli AE, Ernst RK, Lund E, Grimm C, Zapp ML, Rekosh D, Hammarskjold ML, Dahlberg JE. The constitutive transport element (CTE) of Mason-Pfizer monkey virus (MPMV) accesses a cellular mRNA export pathway. EMBO J. 1997;16:7500–7510. doi: 10.1093/emboj/16.24.7500. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Saavedra C, Felber B, Izaurralde E. The simian retrovirus-1 constitutive transport element, unlike the HIV-1 RRE, uses factors required for cellular mRNA export. Curr Biol. 1997;7:619–628. doi: 10.1016/S0960-9822(06)00288-0. [DOI] [PubMed] [Google Scholar]
- Fornerod M, Ohno M, Yoshida M, Mattaj IW. CRM1 is an export receptor for leucine-rich nuclear export signals. Cell. 1997;90:1051–1060. doi: 10.1016/S0092-8674(00)80371-2. [DOI] [PubMed] [Google Scholar]
- Fukuda M, Asano S, Nakamura T, Adachi M, Yoshida M, Yanagida M, Nishida E. CRM1 is responsible for intracellular transport mediated by the nuclear export signal. Nature. 1997;390:308–311. doi: 10.1038/36894. [DOI] [PubMed] [Google Scholar]
- Askjaer P, Jensen TH, Nilsson J, Englmeier L, Kjems J. The specificity of the CRM1-Rev nuclear export signal interaction is mediated by RanGTP. J Biol Chem. 1998;273:33414–33422. doi: 10.1074/jbc.273.50.33414. [DOI] [PubMed] [Google Scholar]
- Bear J, Tan W, Zolotukhin AS, Tabernero C, Hudson EA, Felber BK. Identification of novel import and export signals of human TAP, the protein that binds to the constitutive transport element of the type D retrovirus mRNAs. Mol Cell Biol. 1999;19:6306–6317. doi: 10.1128/mcb.19.9.6306. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Strasser K, Bassler J, Hurt E. Binding of the Mex67p/Mtr2p heterodimer to FXFG, GLFG, and FG repeat nucleoporins is essential for nuclear mRNA export. J Cell Biol. 2000;150:695–706. doi: 10.1083/jcb.150.4.695. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stutz F, Bachi A, Doerks T, Braun IC, Seraphin B, Wilm M, Bork P, Izaurralde E. REF, an evolutionary conserved family of hnRNP-like proteins, interacts with TAP/Mex67p and participates in mRNA nuclear export. RNA. 2000;6:638–650. doi: 10.1017/S1355838200000078. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Clouse KN, Luo MJ, Zhou Z, Reed R. A Ran-independent pathway for export of spliced mRNA. Nat Cell Biol. 2001;3:97–99. doi: 10.1038/35050625. [DOI] [PubMed] [Google Scholar]
- Bolinger C, Boris-Lawrie K. Mechanisms employed by retroviruses to exploit host factors for translational control of a complicated proteome. Retrovirology. 2009;6:8. doi: 10.1186/1742-4690-6-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Agutter PS, Richardson JC. Nuclear non-chromatin proteinaceous structures: their role in the organization and function of the interphase nucleus. J Cell Sci. 1980;44:395–435. doi: 10.1242/jcs.44.1.395. [DOI] [PubMed] [Google Scholar]
- Nickerson JA, Krockmalnic G, Wan KM, Penman S. The nuclear matrix revealed by eluting chromatin from a cross-linked nucleu. Proc Natl Acad Sci USA. 1997;94:4446–4450. doi: 10.1073/pnas.94.9.4446. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marcello A, Ferrari A, Pellegrini V, Pegoraro G, Lusic M, Beltram F, Giacca M. Recruitment of human cyclin T1 to nuclear bodies through direct interaction with the PML protein. EMBO J. 2003;22:2156–2166. doi: 10.1093/emboj/cdg205. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Marcello A, Lusic M, Pegoraro G, Pellegrini V, Beltram F, Giacca M. Nuclear organization and the control of HIV-1 transcription. Gene. 2004;326:1–11. doi: 10.1016/j.gene.2003.10.018. [DOI] [PubMed] [Google Scholar]
- Dieudonne M, Maiuri P, Biancotto C, Knezevich A, Kula A, Lusic M, Marcello A. Transcriptional competence of the integrated HIV-1 provirus at the nuclear periphery. EMBO J. 2009;28:2231–2243. doi: 10.1038/emboj.2009.141. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Belgrader P, Dey R, Berezney R. Molecular cloning of matrin 3. A 125-kilodalton protein of the nuclear matrix contains an extensive acidic domain. J Biol Chem. 1991;266:9893–9899. [PubMed] [Google Scholar]
- Nakayasu H, Berezney R. Nuclear matrins: identification of the major nuclear matrix proteins. Proc Natl Acad Sci USA. 1991;88:10312–10316. doi: 10.1073/pnas.88.22.10312. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hisada-Ishii S, Ebihara M, Kobayashi N, Kitagawa Y. Bipartite nuclear localization signal of matrin 3 is essential for vertebrate cells. Biochem Biophys Res Commun. 2007;354:72–76. doi: 10.1016/j.bbrc.2006.12.191. [DOI] [PubMed] [Google Scholar]
- Zeitz MJ, Malyavantham KS, Seifert B, Berezney R. Matrin 3: chromosomal distribution and protein interactions. J Cell Biochem. 2009;108:125–133. doi: 10.1002/jcb.22234. [DOI] [PubMed] [Google Scholar]
- Zhang Z, Carmichael GG. The fate of dsRNA in the nucleus: a p54(nrb)-containing complex mediates the nuclear retention of promiscuously A-to-I edited RNAs. Cell. 2001;106:465–475. doi: 10.1016/S0092-8674(01)00466-4. [DOI] [PubMed] [Google Scholar]
- DeCerbo J, Carmichael GG. Retention and repression: fates of hyperedited RNAs in the nucleus. Curr Opin Cell Biol. 2005;17:302–308. doi: 10.1016/j.ceb.2005.04.008. [DOI] [PubMed] [Google Scholar]
- Giordano G, Sanchez-Perez AM, Montoliu C, Berezney R, Malyavantham K, Costa LG, Calvete JJ, Felipo V. Activation of NMDA receptors induces protein kinase A-mediated phosphorylation and degradation of matrin 3. Blocking these effects prevents NMDA-induced neuronal death. J Neurochem. 2005;94:808–818. doi: 10.1111/j.1471-4159.2005.03235.x. [DOI] [PubMed] [Google Scholar]
- Salton M, Lerenthal Y, Wang SY, Chen DJ, Shiloh Y. Involvement of matrin 3 and SFPQ/NONO in the DNA damage response. Cell Cycle. 2010;9 doi: 10.4161/cc.9.8.11298. [DOI] [PubMed] [Google Scholar]
- Lassen KG, Ramyar KX, Bailey JR, Zhou Y, Siliciano RF. Nuclear retention of multiply spliced HIV-1 RNA in resting CD4+ T cells. PLoS Pathog. 2006;2:e68. doi: 10.1371/journal.ppat.0020068. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Patton JG, Porro EB, Galceran J, Tempst P, Nadal-Ginard B. Cloning and characterization of PSF, a novel pre-mRNA splicing factor. Genes Dev. 1993;7:393–406. doi: 10.1101/gad.7.3.393. [DOI] [PubMed] [Google Scholar]
- Zolotukhin AS, Michalowski D, Bear J, Smulevitch SV, Traish AM, Peng R, Patton J, Shatsky IN, Felber BK. PSF acts through the human immunodeficiency virus type 1 mRNA instability elements to regulate virus expression. Mol Cell Biol. 2003;23:6618–6630. doi: 10.1128/MCB.23.18.6618-6630.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Lever AM, Jeang KT. Replication of human immunodeficiency virus type 1 from entry to exit. Int J Hematol. 2006;84:23–30. doi: 10.1532/IJH97.06112. [DOI] [PubMed] [Google Scholar]
- Lever AM, Jeang KT. Insights into Cellular Factors That Regulate HIV-1 Replication in Human Cells. Biochemistry. 2011;50:920–931. doi: 10.1021/bi101805f. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schwartz S, Campbell M, Nasioulas G, Harrison J, Felber BK, Pavlakis GN. Mutational inactivation of an inhibitory sequence in human immunodeficiency virus type 1 results in Rev-independent gag expression. J Virol. 1992;66:7176–7182. doi: 10.1128/jvi.66.12.7176-7182.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schwartz S, Felber BK, Pavlakis GN. Distinct RNA sequences in the gag region of human immunodeficiency virus type 1 decrease RNA stability and inhibit expression in the absence of Rev protein. J Virol. 1992;66:150–159. doi: 10.1128/jvi.66.1.150-159.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Schneider R, Campbell M, Nasioulas G, Felber BK, Pavlakis GN. Inactivation of the human immunodeficiency virus type 1 inhibitory elements allows Rev-independent expression of Gag and Gag/protease and particle formation. J Virol. 1997;71:4892–4903. doi: 10.1128/jvi.71.7.4892-4903.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shav-Tal Y, Zipori D. PSF and p54(nrb)/NonO--multi-functional nuclear proteins. FEBS Lett. 2002;531:109–114. doi: 10.1016/S0014-5793(02)03447-6. [DOI] [PubMed] [Google Scholar]
- Kameoka S, Duque P, Konarska MM. p54(nrb) associates with the 5' splice site within large transcription/splicing complexes. EMBO J. 2004;23:1782–1791. doi: 10.1038/sj.emboj.7600187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Buxade M, Morrice N, Krebs DL, Proud CG. The PSF.p54nrb complex is a novel Mnk substrate that binds the mRNA for tumor necrosis factor alpha. J Biol Chem. 2008;283:57–65. doi: 10.1074/jbc.M705286200. [DOI] [PubMed] [Google Scholar]
- Schwartz S, Felber BK, Benko DM, Fenyo EM, Pavlakis GN. Cloning and functional analysis of multiply spliced mRNA species of human immunodeficiency virus type 1. J Virol. 1990;64:2519–2529. doi: 10.1128/jvi.64.6.2519-2529.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cochrane AW, Jones KS, Beidas S, Dillon PJ, Skalka AM, Rosen CA. Identification and characterization of intragenic sequences which repress human immunodeficiency virus structural gene expression. J Virol. 1991;65:5305–5313. doi: 10.1128/jvi.65.10.5305-5313.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Maldarelli F, Martin MA, Strebel K. Identification of posttranscriptionally active inhibitory sequences in human immunodeficiency virus type 1 RNA: novel level of gene regulation. J Virol. 1991;65:5732–5743. doi: 10.1128/jvi.65.11.5732-5743.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nasioulas G, Zolotukhin AS, Tabernero C, Solomin L, Cunningham CP, Pavlakis GN, Felber BK. Elements distinct from human immunodeficiency virus type 1 splice sites are responsible for the Rev dependence of env mRNA. J Virol. 1994;68:2986–2993. doi: 10.1128/jvi.68.5.2986-2993.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Shav-Tal Y, Cohen M, Lapter S, Dye B, Patton JG, Vandekerckhove J, Zipori D. Nuclear relocalization of the pre-mRNA splicing factor PSF during apoptosis involves hyperphosphorylation, masking of antigenic epitopes, and changes in protein interactions. Mol Biol Cell. 2001;12:2328–2340. doi: 10.1091/mbc.12.8.2328. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Cronshaw JM, Krutchinsky AN, Zhang W, Chait BT, Matunis MJ. Proteomic analysis of the mammalian nuclear pore complex. J Cell Biol. 2002;158:915–927. doi: 10.1083/jcb.200206106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Bushman FD, Malani N, Fernandes J, D'Orso I, Cagney G, Diamond TL, Zhou H, Hazuda DJ, Espeseth AS, König R, Bandyopadhyay S, Ideker T, Goff SP, Krogan NJ, Frankel AD, Young JA, Chanda SK. Host cell factors in HIV replication: meta-analysis of genome-wide studies. PLoS Pathog. 2009;5(5):e1000437. doi: 10.1371/journal.ppat.1000437. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kula A, Guerra J, Knezevich A, Kleva D, Myers MP, Marcello A. Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function. Retrovirology. 2011;8:60. doi: 10.1186/1742-4690-8-S1-A60. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.