Molecular Characterization of Iranian Patients with Possible Familial Hypercholesterolemia

Abstract

Familial hypercholesterolemia (FH) is an autosomal dominant disorder of lipoprotein metabolism caused mainly by mutations in the low-density lipoprotein receptor (LDLR) and apolipoprotein B 100 (APOB) genes. Until now, the molecular basis of FH has been demonstrated in detail in many populations, but there is still very limited Molecular data concerning FH in Iran. The aim of this study was to characterize the LDLR and APOB gene mutations in an Iranian population. A total of 30 non-related Iranian possible FH subjects were studied. Diagnosis of FH was based on the Dutch Lipid Clinic Network diagnostic criteria. All samples were initially tested for three common APOB gene mutations including R3500Q, R3500 W and R3531C using PCR-RFLP assay. Subsequently, promoter and coding region of the LDLR gene was screened by PCR-SSCP analysis and positive results were confirmed by DNA sequencing. Four previously reported polymorphisms 1413G > A, 1725C > T, 1773T > C and 2140 + 5G > A were found in ~17% (5/30) of population studied. Moreover, no variation was found in APOB gene. Our data indicated that LDLR and APOB gene mutations have not contribution to possible FH in Iranian population studied here. However, we examined three common APOB mutations and LDLR in only 30 patients, and to determine the role of these genes in developing FH in Iran, more FH samples and populations needed to be investigated for the mutations of the related genes.

Introduction

Familial Hypercholesterolemia (FH; MIM# 143890) is a common autosomal dominant disorder of lipoprotein metabolism with a frequency of 1 in 500 of the heterozygous and 1 in a million of homozygous form. FH is characterized by elevations in LDL cholesterol, tendon xanthomata, arcus cornea and increased risk of coronary heart disease. The homozygous form of FH is much more severe and depending on the type of mutation may cause death in the early decades of life [1, 2]. Several different factors may affect the manifestation of FH such as age, gender, diet, type of LDLR mutations and other gene mutations [3–5].

Mutation in the gene encoding the low-density lipoprotein receptor (LDLR) is the most common genetic cause of FH (http://www.ucl.ac.uk/fh). The LDL receptor protein is a cell-surface protein which mediates specific uptake and degradation of LDL by its endocytosis, mainly in liver. A wide variety of mutations including insertions, deletions, nonsense and missense mutations has been described in patients with FH. LDLR gene (MIM# 606945) is located on chromosome 19 (19p13.3) and consists of 18 exons which spans ~45 kb with a mature protein of 860 amino acids [6, 7].

Mutation in apolipoprotein B-100 gene (APOB100; MIM 107730) is the second cause of the clinical FH phenotype. This gene is located on chromosome 2p24.1 that codes for the protein component of LDL particles [8, 9]. ApoB-100 is an integral component of LDL and functions as the ligand for the LDLR. Therefore mutations in the APOB 100 will drastically alter its functional activity leading to a decrease in its binding to LDLR, thereby delaying the clearance of LDL particles. The latter situation usually results in a mild or severe form of hypercholesterolemia together with an increased risk for early onset atherosclerosis [10, 11]. In contrast to LDLR, only a small number of functional mutations have been identified in APOB gene such as R3500Q [12], R3500 W [13], and R3531C [14]. There are very limited data regarding LDLR and APOB gene mutations in Iranian population [15, 16]. The aim of this study was to characterize the LDLR and three common apolipoprotein B 100 gene mutations in a group of 30 non-related Iranian possible FH patients.

Materials and Methods

Subjects

Thirty unrelated possible FH subjects were included based on the Dutch Lipid Clinic Network diagnostic criteria [17] from the 92 suspected FH individuals referred to our affiliated clinics in Shahrekord University of Medical Sciences in 2008. A total of 30 non-related Iranian possible FH subjects were studied. All patients were taking lipid-lowering drug. Subjects (21 males and 9 females) were from Chaharmahal va Bakhtiari province in southwest Iran with high serum cholesterol >240 mg/dl and LDL cholesterol >190 mg/dl aged between 29 and 73 years (mean: 55 years) (Table 1). All patients were clinically characterized and medical history were collected by a questionnaire. Secondary causes of hypercholesterolemia were excluded, such as diabetes mellitus (overnight fasting blood sugar >126 mg dl⁻¹), hypertension (systolic blood pressure/diastolic blood pressure >140/90 mmHg), family history of premature coronary artery disease in first degree relatives and smoking habit. Blood samples were collected after obtaining informed consent from all patients. Glucose, total cholesterol (TC) and triglycerides (TG) were assayed using standard enzymatic procedures. HDL-C and LDL-C were measured with direct method. The study protocol was approved by the Review Board of the University.

Table 1.

Clinical and biochemical characteristics of the patients studied

Parameters	Patients (N = 30) Mean ± SD	Men (N = 9) Mean ± SD	Women (N = 21) Mean ± SD
Age	55.10 ± 13.16	57.33 ± 17.93	54.14 ± 10.93
Sex	30	9	21
Total cholesterol (mg/dl)	302.93 ± 34.72	304.22 ± 47.27	302.38 ± 29.21
Triglycerides (mg/dl)	229.96 ± 112.05	242.55 ± 196.58	224.57 ± 51.46
HDL-cholesterol (mg/dl)	42.52 ± 13.07	40.00 ± 13.36	43.78 ± 13.25
LDL-cholesterol (mg/dl)	208.47 ± 26.59	210.50 ± 33.79	207.53 ± 24.12
Cholesterol/HDL ratio	7.47 ± 1.98	8.02 ± 2.44	7.19 ± 1.74

Molecular Analyses

Genomic DNA was extracted from peripheral blood using phenol–chloroform procedure.

All of the Primers for the LDLR and APOB gene were designed using primer3 software. To exclude the APOB mutations, all samples were initially tested for three APOB gene mutations including R3500Q, R3500 W and R3531C using PCR-RFLP assay. The Primer sequences and restriction enzymes used for each mutation are shown in Table 2.

Table 2.

PCR primers and restriction enzymes used for the APOB gene mutations analysis

Mutation	Forward primer 5′–3′	Reverse primer 5′–3′	Size (bp)	Res. enzyme
R3500Q	CTTACTTTTCCATTGAGTACTCTACC	AGTGCCCTGCAGCTTCACTGAGTAC	143	ScaI
R3500 W	CTTACTTTTCCATTGATGCATC	GTAAGTGGTTTTTCGTCATGTG	251	NlaIII
R3531C	CTTACTTTTCCATTGATGCATC	GTAAGTGGTTTTTCGTCATGTG	251	NsiI

The underlined nucleotides showing the mismatch bases created to introduce a new recognition site for each desired mutation providing a within-assay control for the exclusion of false negative results

The PCR amplification was performed at annealing temperature of 64°C using primers described in Table 2 in a total volume of 25 μl. Ten micro liters of each PCR product were digested overnight with 5 U (for NlaIII) and 10 U (for ScaI and NsiI) of restriction enzyme in a volume of 20 μl. The digested products were separated on 6% polyacrylamide gel at 40 mA for 1.5 h and visualized by silver staining method.

To exclude the LDLR mutations, all of the 18 exons and promoter region of the LDLR gene were PCR amplified at annealing temperature of 51–67°C. The Primer sequences used for exons and promoter will be available in request.

The amplified products were then separated on 6% polyacrylamide gel and visualized by silver staining method. Following PCR amplification, 5 μl of PCR product was mixed with 5 μl SSCP loading solution and was made single stranded by heating at 95°C for 10 min followed by rapid chilling on ice. PCR-SSCP was carried out using different gel concentration, component, current and gel temperature (LDLR primers and PCR-SSCP conditions will be available in request). Afterwards, the gels were visualized by silver staining method. Fragments showing mobility shifts of single strands were sequenced directly using an ABI 3100 DNA Sequencer (Applied Biosystems).

Results

A total of 92 suspected FH individuals were investigated, from which 30 possible FH subjects met the Dutch Lipid Clinic Network diagnostic criteria (Table 1). All samples were initially tested for three APOB gene mutations including R3500Q, R3500 W and R3531C using PCR-RFLP assay. None of the three APOB gene mutations (R3500Q, R3500 W and R3531C) were detected in possible FH patients using PCR-RFLP assay. To exclude the LDLR mutations, all of the 18 exons and promoter region of the LDLR gene were examined using PCR-SSCP strategy. However, four previously reported LDLR polymorphisms including 1413G > A, 1725C > T, 1773T > C and 2140 + 5G > A were found in 2, 1, 1 and 1 affected individuals respectively. A gel picture of SSCP of exon 10 is showed in Fig. 1.

Fig. 1.

Polyacrylamide gel of SSCP for exon 10. Lane 1 mobility shifts of single strands, Lane2–5 normal samples, Lane 6 double strand PCR product, Lane 7 size marker

The polymorphisms 1413G > A, 1725C > T, 1773T > C and 2140 + 5G > A were found in 17% of patients from which 1413G > A and 1773T > C were found in both allele in 6 of 60 chromosomes (Fig. 2).

Fig. 2.

Electropherograms of LDLR gene polymorphisms a 1413G > A polymorphism, b 1725 C > T polymorphism, c 1773 T > C polymorphism, d 2140 + 5G > A polymorphism

Discussion

The present study revealed four previously reported LDLR gene polymorphisms including 1413G > A, 1725C > T, 1773T > C and 2140 + 5G > A among 30 Iranian possible FH patients. LDLR gene polymorphisms were found in 17% of individuals studied. But no mutation was detected in promoter and coding region of the LDLR gene studied. Also none of the three APOB gene mutations including R3500Q, R3500 W and R3531C were detected using PCR-RFLP assay. This is similar to the very low detection rate reported by other investigators that examined only one exon [16] of the LDLR gene and one common mutation of APOB (R3500Q) in 30 FH Iranian patients [15]. They found one allelic variation (445G > T) suggesting to be possible mutation.

The frequency and variants of LDLR and APOB gene mutations are different in populations.

The frequency of familial detective apolipoprotein apoB100 (FDB) is estimated as (1/200) in central Europe (e.g. Switzerland), decreasing gradually in Mediterranean or Northern European populations. In Germany, UK and USA, prevalence ranges from 1/700 to 1/500 [18, 19]. In most countries in Europe in 3–5% of patients the hypercholesterolemia is caused by a single mutation in the gene for ApoB [20]. The R3500Q mutation could not be found in Lebanon [21], Russia [22] and Turkey [23].

Mutations in the APOB gene were not detected in any of our patients. A similar result was also obtained in a previous study in Iran [15]. Our finding about R3500Q mutation is quite expected to the geographic distribution of this mutation. In our present study, not finding any mutation in APOB gene may be due to its low frequency rate.

A frequency of FH ranging from 1/411 (0.24%) for North Karelians of Finland [24] to 1/67 (1.5%) for Ashkenazi Jew in South Africa [25]. The frequency of FH is 1/900 (0.11%) for Japanese in Asia [26]. Except one report in Iranian HF patients, there is no report about the molecular basis of FH in Iran. In this report [16] from 30 clinically diagnosed heterozygous FH patients, one new variant (445G > T) was reported. In a case report, an Iranian boy with autosomal recessive hypercholesterolemia was described too [27].

In present study, except four polymorphisms such as 1413G > A, 1725C > T, 1773C > T and 2140 + 5G > A, no mutation was found in exons studied. In total LDLR gene alterations (polymorphisms) were found in 17% of population studied. In our present study, not finding any mutation maybe due to some factors:

1. In present study, no finding any mutation maybe due to small number of patient. As we examined small sample size of 30 patients, more samples must be tested to reveal the contribution of this gene in causing FH in Iranian families particularly in Chaharmahal va Bakhtiari province.

2. In some patients, mutations may not be present in the LDLR or APOB gene but occur in other genes such as PCSK9 or in the unidentified FH3 gene on chromosome 1 [28].