Skip to main content
Molecular Vision logoLink to Molecular Vision
. 2011 Aug 20;17:2255–2262.

A recurrent missense mutation in GJA3 associated with autosomal dominant cataract linked to chromosome 13q

Thomas M Bennett 1, Alan Shiels 1,2,
PMCID: PMC3164684  PMID: 21897748

Abstract

Purpose

To map and identify the genetic defect underlying autosomal dominant cataract segregating in a 5-generation Caucasian American family.

Methods

Genomic DNA was prepared from blood leukocytes, genotyping was performed using microsatellite markers, and logarithm of the odds (LOD) scores were calculated using the LINKAGE programs. Mutation profiling was performed using direct exon cycle-sequencing and restriction fragment analysis. Protein function effects were evaluated using in silico prediction algorithms.

Results

Significant evidence of linkage was obtained at marker D13S175 (maximum LOD score [Zmax]=3.67; maximum recombination fraction [θmax]=0.04) and D13S1316 (Zmax=2.80, θmax=0.0). Haplotyping indicated that the disease lay in the ~170 Kb physical interval between D13S1316 and D13S175, which contained the gene for gap-junction protein alpha-3 (GJA3) or connexin-46. Sequencing of GJA3 detected a heterozygous transition (c.130G>A) in exon-2 that resulted in gain of an Hsp92 II restriction site. Allele-specific PCR amplification and restriction analysis confirmed that the novel Hsp92 II site co-segregated with cataract in the family but was not detected in 192 normal unrelated individuals. The c.130G>A transition was predicted to result in a non-conservative substitution of valine-to-methionine at codon 44 (p.V44M) with damaging effects on protein function.

Conclusions

These data confirm GJA3 as one of the most frequently mutated genes that underlie autosomal dominant cataract in humans, and further emphasize the importance of connexin function in maintaining lens transparency.

Introduction

Inherited forms of cataract(s) constitute a clinically heterogeneous disorder of the ocular lens that usually present with an early-onset ranging from birth (congenital) through infancy into the fourth decade (Online Mendelian Inheritance in Man; OMIM). Congenital and infantile forms of cataract that cause blurring of images on the immature retina are a clinically important cause of impaired form vision development (deprivation amblyopia), and pediatric cataract surgery is associated with increased risk of aphakic glaucoma and lifelong visual impairment [1-3].

In addition to being found as a secondary feature of many genetic syndromes and metabolic disorders involving other ocular and/or systemic abnormalities (OMIM), cataract may be inherited as a primary or isolated lens phenotype [4,5]. All three classical forms of Mendelian inheritance have been described. However, most families reported exhibit autosomal dominant transmission with high penetrance. So far genetic linkage studies of around 180 families worldwide have mapped at least 35 independent loci and identified mutations in over 20 genes for phenotypically diverse forms of primary cataract involving total, nuclear, lamellar/zonular, sutural, and polar/sub-capsular lens opacities [6].

Approximately 55% of the known mutations underlying inherited forms of primary cataract have been detected in ten crystallin genes; alphaA-crystallin (CRYAA), alphaB-crystallin (CRYAB), betaB1-crystallin (CRYBB1), betaB2-crystallin (CRYBB2), betaB3-crystallin (CRYBB3), betaA1-crystallin (CRYBA1), bataA4-crystallin (CRYBA4), gammaC-crystallin (CRYGC), gammaD-crystallin (CRYGD), and gammaS-crystallin (CRYGS) that encode the major “refractive” proteins of the lens [7-15]. A further 20–25% of known mutations have been detected in two genes encoding gap-junction protein alpha 3 and alpha 8 (GJA3, GJA8) [16,17]. The remainder of underlying mutations occur in a group of functionally diverse genes including those for; heat-shock transcription factor 4 (HSF) [18], lens major intrinsic protein (MIP) [19], lens intrinsic membrane protein 2 (LIM2) [20], transmembrane protein 114 (TMEM114) [21], beaded filament structural protein 1 and protein 2 (BFSP1, BFSP2) [22,23], chromatin modifying protein 4B (CHMP4B) [24], Eph-receptor type A2 (EPHA2) [25], Tudor domain containing 7 (TDRD7) [26], and FYVE and coiled-coil domain containing 1 (FYCO1) [27]. Here we have mapped autosomal dominant cataract segregating in a Caucasian American family to chromosome 13q and identified a missense mutation in the gene for gap-junction protein alpha-3 (GJA3), or connexin-46.

Methods

Family participants

A 5-generation Caucasian pedigree (family Sh) from the midwestern United States was ascertained through ophthalmic records in the Department of Ophthalmology and Visual Sciences at Washington University School of Medicine, St. Louis MO. Blood samples were obtained from 22 family members including 11 affected individuals. Leukocyte genomic DNA was purified using the Gentra Puregene Blood kit (Qiagen, Valencia, CA), and quantified by absorbance at 260 nm (NanoDrop 2000; Thermo Fisher Scientific, Wilmington, DE). Ethical approval for this study was obtained from the Washington University Human Research Protection Office, and written informed consent was provided by all participants before enrollment in accordance with the tenets of the Declaration of Helsinki, and Health Insurance Portability and Accountability Act (HIPAA) regulations.

Genotyping and linkage analysis

Microsatellite markers from the National Center for Biotechnology Information (NCBI) combined Généthon, Marshfield, and deCODE genetic linkage maps were genotyped by means of a 4200 DNA analyzer running Gene ImagIR software (Li-Cor, Lincoln, NE) as described [28]. Pedigree and haploptype data were managed using Cyrillic (v.2.1) software (FamilyGenetix Ltd., Reading, UK), and two-point logarithm of the odds (LOD) scores (Z) calculated using the MLINK sub-program from the LINKAGE (5.1) package of programs [29]. Marker allele frequencies were assumed to be equal, and a gene frequency of 0.0001 with a penetrance of 100% were assumed for the disease locus.

Sequencing analysis

Genomic sequence for GJA3 was obtained from the Ensemble human genome browser, and gene-specific M13-tailed PCR primers (Table 1) were selected from the NCBI re-sequencing amplicon (RSA) probe database or custom designed (IDT Primer Quest). Genomic DNA (2.5 ng/μl, 20 μl reactions), was amplified (35–40 cycles) in a GeneAmp 9700 thermal cycler using AmpliTaq polymerase (Applied Biosystems, Foster City, CA) and gene-specific primers (10 pmol). Resulting PCR amplicons were either enzyme-purified with ExoSAP-IT (USB Corporation, Cleveland, OH) or gel-purified with the QIAquick gel-extraction kit (Qiagen). Purified amplicons were direct cycle-sequenced in both directions with BigDye Terminator Ready Reaction Mix (version 3.1) containing M13 forward or reverse sequencing primers then ethanol precipitated and detected by capillary electrophoresis on a 3130xl Genetic Analyzer running Sequence Analysis (version 5.2) software (Applied Biosystems), and Chromas (version 2.23) software (Technelysium, Tewantin, Queensland, Australia).

Table 1. PCR primers for mutation screening of GJA3.

Primer Location Strand Sequence (5′>3′) Amplicon (bp)
GJA3-Ex2F1
Codons 128–134
Antisense
CCCGCGACGAGGGATTGT
634
GJA3-Ex2R1
Intron-1
Sense
GACGCTTGCACTTGTGTAGTGCC
 
GJA3-Ex2F2
Codons 230–235
Antisense
CTGGTCACGCCCTGCTTGAG
512
GJA3-Ex2R2
Codons 77–83
Sense
TTCTGGGCGCTGCAGATCAT
 
GJA3-Ex2F3
Codons 429–436 (Stop)
Antisense
TAGATGGCCAAGTCCTCCGGTCT
737
GJA3-Ex2R3
Codons 203–210
Sense
TTCATCATCTTCATGCTGGCGGTG
 
GJA3-Ex2F4
3′-UTR
Antisense
GAGACAGCCCTCAGCGACCA
563
GJA3-Ex2R4 Codons 361–367 Sense ACTCGCGCACGAGGCTGA  

Primer pairs for amplification and sequencing of the coding region (exon-2) of GJA3 located on 13q.

Restriction analysis

Allele-specific restriction fragment length analysis was performed on gel-purified PCR amplicons, amplified with primers GJA3-Ex2F1 and GJA3-Ex2R1 (Table 1) using Hsp92 II at 37 °C for 1 h according to the manufacturer’s instructions (Promega, Madison, WI), and digestion products were visualized at 302 nm following electrophoresis in 3% agarose-gels stained with GelRed (Biotium, Hayward, CA). In addition to family Sh, we extended Hsp92 II restriction analysis to include 192 unrelated individuals from the European Collection of Animal Cell Cultures human random control (ECACC-HRC) DNA panel (Sigma, St. Louis, MO) to distinguish the predicted mutation, with 95% confidence, from a polymorphism with 1% frequency as recommended [30].

Mutation prediction analyses

Missense mutations in GJA3 were evaluated for pathogenicity using three in silico prediction algorithms: Position-Specific Scoring Matrix analysis (PSSM), Sorting Intolerant From Tolerant substitutions (SIFT) [31], and Polymorphism Phenotyping-2 (PolyPhen-2) [32]. GJA3 amino-acid sequences were retrieved from the Entrez protein database, and aligned by means of the ClustalW multiple sequence alignment web server [33]. The hydrophobicity profile of GJA3 was determined by means of the HMMTOP transmembrane topology prediction server [34], and structurally conserved domains located using the Conserved Domain Database (CDD) [35].

Results

Linkage analysis

We studied a 5-generation Caucasian American pedigree (family Sh) segregating autosomal dominant cataract in the absence of other ocular or systemic defects. Autosomal dominant inheritance was supported by the absence of gender bias or skipping of generations. Ophthalmic records described the cataract as congenital in at least four affected individuals (III:I, IV:2, IV:6, and IV:8); however, no slit-lamp images of the lens opacities pre-surgery were available. Twenty-two members of the family (Figure 1), including eleven affected individuals were genotyped with microsatellite markers at 11 candidate loci for autosomal dominant cataract on chromosomes 1q (GJA8), 2q (CRYGC, CRYGD), 3q (BFSP2), 11q (CRYAB), 12q (MIP), 13q (GJA3), 16q (HSF4), 17q (CRYBA1), 19q (LIM2), 21q (CRYAA), and 22q (CRYBB1–3, CRYBA4). Following exclusion of 10 of these loci (Z≤-2.0, θ=0.0–0.1), we obtained significant evidence of linkage (Table 2) for marker D13S175 (Zmax=3.67, θmax=0.04) and D13S1316 (Zmax=2.80, θmax=0.0) on 13q11-q12. Haplotyping of the pedigree (Figure 1) detected two affected females, IV:6 and IV:12, who were obligate recombinants at marker D13S1236. Individual IV:12 was also recombinant at D13S175. No other recombinant individuals were detected at the most centromeric marker D13S1316, suggesting that the disease locus lay in the physical interval, D13S1316-(0.17Mb)-D13S175, which contains the strong candidate gene GJA3.

Figure 1.

Figure 1

Linkage analysis of autosomal dominant cataract segregating in a 5-generation Caucasian American pedigree (family Sh). A: Pedigree and haplotype analysis showing segregation of 3 microsatellite markers on chromosome 13q listed in descending order from the centromere (13p-tel). Squares and circles denote males and females respectively. Filled symbols denote affected status. B: Ideogram of chromosome 13 showing the cytogenetic location of the cataract locus.

Table 2. Two-point Lod scores (Z) for linkage between the cataract locus and chromosome 13 markers.

 
 
 
Z at θ=
 
 
Marker Mb cM 0.00 0.05 0.10 0.20 0.30 0.40 Zmax θmax
D13S1316
20.68
0.00
2.80
2.50
2.20
1.58
0.95
0.35
2.80
0.00
GJA3 (c.130G>A)
20.71

6.55
6.02
5.46
4.24
2.88
1.35
6.55
0.00
D13S175
20.85
7.40
-∞
3.67
3.46
2.68
1.70
0.66
3.67
0.04
D13S1236 22.70 4.20 -∞ 1.48 1.72 1.57 1.11 0.49 1.74 0.12

Z values for markers on 13q listed in physical and genetic distances measured in Mb and cM, respectively, from the short-arm telomere (13p-tel).

Mutation detection

GJA3 (GeneID: 2700) comprises two exons with exon-2 containing the entire coding region for a 435-amino-acid protein. Sequencing of exon-2 including flanking 5′-intron and 3′-UTR boundaries in two affected relatives detected a heterozygous G-to-A transition (Figure 2) located at position 130 from the first base (A) of the translation start (ATG) codon (c.130G>A). This single nucleotide change was not present in the reference sequence and resulted in the gain of an Hsp92 II restriction site (5′CATG↓). PCR amplification and restriction fragment length analysis confirmed the presence of the heterozygous c.130G>A transition in all affected members of family Sh, and its absence in unaffected relatives (Figure 2). Moreover, when we tested the c.130G>A change as a bi-allelic marker with a notional frequency of 1%, in a two-point LOD score analysis of the cataract locus (Table 2) we obtained further compelling evidence of linkage to GJA3 (Zmax=6.55, θmax=0). Finally we excluded the c.130G>A transition as a single nucleotide polymorphism (SNP) in a panel of 192 normal unrelated control individuals (384 chromosomes) using allele-specific restriction analysis described in Figure 2 (data not shown). Taken overall our genotype and sequence data strongly suggested that the c.130G>A transition represented a causative mutation rather than a benign SNP in linkage disequilibrium with the cataract phenotype.

Figure 2.

Figure 2

Mutation analysis of GJA3 in family Sh. A: Sequence profile of the wild-type allele showing translation of valine (V) at codon 44 (GTG) in exon 2. B: Sequence trace of the mutant allele showing the heterozygous c.130G>A transition (denoted R by the International Union of Pure and Applied Chemistry [IUPAC] code) at the first base of codon 44 (ATG) that is predicted to result in a missense substitution of methionine (M) for valine (p.V44M). C: Restriction fragment length analysis on agarose gels showing gain of an Hsp92 II site (5′CATG↓) that co-segregated with affected individuals heterozygous for the mutant A-allele (167/174 bp) but not with unaffected individuals homozygous for the wild-type G-allele (341 bp).

Functional predictions

The c.130G>A transition occurred at the first base of codon 44 (GTG>ATG) and was predicted to result in the missense substitution of valine-to-mehionine (p.V44M) at the level of protein translation. The predicted p.V44M substitution represented a relatively conservative amino acid change, with the small non-polar side-group of valine (CH3-CH-CH3) replaced by the larger non-polar side-group of methionine (CH2-CH2-S-CH3). However, cross-species alignment of GJA3 amino-acid sequences revealed that p.V44 is phylogenetically conserved from Zebrafish to man (Figure 3).

Figure 3.

Figure 3

Schematic showing gene structure and protein domains of GJA3. A: Exon organization and mutation profile of GJA3. The entire coding region (435 amino-acids) is located in exon-2. Based on hydrophobicity analysis [34], GJA3 has nine structural domains including: a cytoplasmic N-terminus (NT), 4 transmembrane domains (TM-1 – TM-4); 2 extracellular loops (EC1, EC2), a cytoplasmic loop (CL), and a cytoplasmic C-terminus (CT). The relative locations, with respect to the translation start codon, of the p.V44M mutation and 19 other mutations associated with autosomal dominant cataract in humans are indicated. The rat p.E42K mutation associated with autosomal recessive cataract is also indicated. B: Amino-acid sequence alignment of the first extracellular (EC-1) domain (amino-acids 42–71) from human GJA3 and homologs from other species. Dots denote identical amino-acids. Cysteine residues involved in hemi-channel docking are underlined. Missense substitutions are shown in red.

Based on the hydrophobicity profile of GJA3, the p.V44M substitution is likely located in the first extracellular (EC-1) loop close to the boundary with the first transmembrane (TM-1) domain (Figure 3). To evaluate the functional consequences of the p.V44M substitution we compared it to all the other missense variations so far identified in GJA3 using three sequence homology based prediction algorithms (Table 3). PSSM analysis revealed a marked decline in value from +5 to −1 confirming that the predicted p.V44M substitution occurred less frequently than expected in proteins with the conserved connexin superfamily domain (CCD: pfam00029). SIFT analysis gave a score of 0.00 consistent with an “intolerant” amino-acid change, and PolyPhen-2 analysis gave a score of 1.00 consistent with a “probably damaging” change, further raising the likelihood of GJA3 dysfunction.

Table 3. Summary of mutations/variations found in GJA3 (exon 2) associated with autosomal dominant and age-related forms of cataract.

DNA change Coding change PSSM wt/mut SIFT PolyPhen2 Protein domain Cataract phenotype Origin References
c.-39C>G
-
-
-
-
-
Age-related nuclear
China
[41]
c.5G>A
p.G2D
-
0.00
1.000
NH2-Term
Nuclear pulverulent and posterior polar
China
[48]
c.7G>T
p.D3Y
+6/-4
0.00
1.000
NH2-Term
Zonular pulverulent
Honduras
[49]
c.32T>C
p.L11S
+6/-4
0.00
1.000
NH2-Term
“Ant egg”
Denmark
[50]
c.56C>T
p.T19M
+8/-3
0.00
1.000
NH2-Term
Posterior polar
India
[51]
c.82G>A
p.V28M
+6/-1
0.00
0.970
TM-1
“Total, anterior capsular, cortical”
India
[40]
c.96C>A
p.F32L
+9/-1
0.00
0.999
TM-1
Nuclear pulverulent
China
[52]
c.98G>T
p.R33L
+8/-4
0.00
1.000
TM-1
Granular embryonal
India
[53]
c.130G>A
p.V44M
+5/-1
0.00
1.000
EC-1
Nuclear
China
[36]
c.130G>A
p.V44M
+5/-1
0.00
1.000
EC-1
?
USA
This study
c.134G>C
p.W45S
+12/-4
0.00
1.000
EC-1
Nuclear
China
[54]
c.139G>A
p.D47N
+8/-1
0.01
1.000
EC-1
Nuclear
China
[55]
c.176C>T
p.P59L
+9/-5
0.00
1.000
EC-1
Nuclear punctate
USA
[37]
c.176C>T
p.P59L
+9/-5
0.00
1.000
EC-1
?
Denmark
[38]
c.188A>G
p.N63S
+8/+1
0.00
0.833
EC-1
Variable pulverulent
UK
[17]
c.226C>G
p.R76G
+8/-4
0.00
0.961
TM-2
Total
India
[40]
c.227G>A
p.R76H
+8/-2
0.00
1.000
TM-2
Nuclear lamellar pulverulent
Australia
[39]
c.227G>A
p.R76H
+8/-2
0.00
1.000
TM-2
?
Denmark
[38]
c.260C>T
p.T87M
+6/-2
0.00
1.000
TM-2
“Pearl-box”
India
[56]
c.415G>A
p.V139M
-
0.07
0.818
CL
Age-related cortical
China
[41]
c.560C>T
p.P187L
+8/-2
0.00
0.999
EC-2
Zonular pulverulent
UK
[57]
c.559C>T
p.P187S
+8/-2
0.00
0.961
EC-2
Nuclear pulverulent
China
[58]
c.563A>C
p.N188T
+6/-2
0.02
0.931
EC-2
Nuclear pulverulent
China
[59]
c.1137insC p.S380QfsX88 - - - COOH-Term Punctate UK [17]

SIFT scores <0.05 are intolerant and scores ≥0.05 are tolerant. PolyPhen-2 scores >0.85 are probably damaging and scores 0.15–0.85 are possibly damaging.

Discussion

Here we have identified a heterozygous transition (c.130G>A) in exon-2 of GJA3 co-segregating with autosomal dominant cataract linked to chromosome 13q in a Caucasian American family. This missense mutation was predicted to result in a conservative p.V44M substitution in the first extracellular domain of GJA3 with damaging effects on protein function. Recently, the same GJA3 mutation was detected by candidate-gene sequencing in a Han Chinese family segregating autosomal dominant cataract described as central nuclear with punctate cortical opacities [36]. However, no supporting linkage analysis or functional studies were performed. Our data confirm recurrent association of the p.V44M substitution in GJA3 with autosomal dominant cataract linked to 13q.

Currently, at least 19 different heterozygous coding mutations in GJA3 (Table 3) have been detected in 22 families worldwide making it one of the most frequently mutated genes associated with autosomal dominant cataract. The resulting opacities are usually described as nuclear or zonular/lamellar often with a pulverulent (dustlike) or punctate appearance. All but one of the known coding mutations in GJA3 are missense substitutions (Table 3) that are located toward the NH2-terminal end of the protein containing the conserved connexin domain (CCD: pfam00029) and the gap-junction channel protein cysteine-rich or conexin_CCC domain (CCD: pfam10582). Five of these missense substitutions, including p.V44M identified here, are believed to be located in the first extracellular (EC-1) domain of GJA3 (Figure 3). In addition to p.V44M, two other missense mutations in GJA3 are recurrent with autosomal dominant cataract. A p.P59L substitution in the first extracellular domain has been reported in American and Danish families [37,38], whereas, a p.R76H substitution in the second transmembrane domain has been detected in Australian and Danish families [38,39]. Furthermore, two other valine-to-methionine substitutions have been reported in GJA3. A p.V28M change in the first transmembrane domain has been associated with autosomal dominant cataract in an Indian family [40], and a p.V139M change in the cytoplasmic loop has been associated with age-related cortical cataract in a Chinese population [41]. Interestingly, both p.V28M and p.V44M were predicted to be probably damaging to GJA3 function, whereas, p.V139M was predicted to be a benign or possibly damaging variant (Table 3).

So far no mutations in the mouse Gja3 gene have been associated with spontaneous or chemically/radiologically induced forms of cataract. By contrast a homozygous missense substitution (p.E42K) in rat Gja3 underlies a spontaneous form of autosomal recessive nuclear cataract in the SHRSPwch1.9Cat strain [42]. Knockout mice lacking Gja3 as a result of gene disruption also develop nuclear cataract with severity of lens opacification influenced by genetic background [43,44]. However, hemizygous loss of Gja3 does not elicit cataract in mice.

Mouse Gja3 has been proposed to function in gap-junction coupling of lens fiber cells [45]; the primary target cells for cataract. In addition, Gja3 has been shown to form active hemi-channels in dissociated mouse lens fiber cells [46]. Structure-function prediction algorithms show that 18 of 19 reported missense substitutions in GJA3 are likely to be damaging to protein function (Table 3). Functional expression studies of one GJA3 missense mutant, p.N63S, in Xenopus oocytes revealed that it exhibited impaired hemi-channel activity in single oocytes, and failed to elicit gap-junction coupling in paired oocytes [47]. While p.N63S is located in the conserved tri-cysteine motif within the first extracellular domain of GJA3, p.V44M identified here and p.E42K identified in the rat are located near the boundary between the first extracellular domain and the first transmembrane domain (Figure 3). Both p.V44M and p.N63S are associated with autosomal dominant cataract, whereas, p.E42K is associated with autosomal recessive cataract. In general mutations underlying autosomal dominant phenotypes result in deleterious gain-of-function mechanisms, whereas, those underlying autosomal recessive phenotypes elicit loss-of-function mechanisms. Further detailed functional expression studies will be required to elucidate the precise pathogenic mechanisms that link GJA3 mutations with cataract.

Acknowledgments

We thank the family for participating in this study and Dr. O. Boskovska for help with their ascertainment. This work was supported by NIH/NEI grants EY012284 (A.S.) and EY02687 (Vision research core grant), and by an unrestricted grant to the Department of Ophthalmology and Visual Sciences from Research to Prevent Blindness (RPB).

References

  • 1.Rahi JS, Dezateux C. Measuring and interpreting the incidence of congenital ocular anomalies: lessons from a national study of congenital cataract in the UK. Invest Ophthalmol Vis Sci. 2001;42:1444–8. [PubMed] [Google Scholar]
  • 2.Zetterström C, Lundvall A, Kugelberg M. Cataracts in children. J Cataract Refract Surg. 2005;31:824–40. doi: 10.1016/j.jcrs.2005.01.012. [DOI] [PubMed] [Google Scholar]
  • 3.Tatham A, Odedra N, Tayebjee S, Anwar S, Woodruff G. The incidence of glaucoma following paediatric cataract surgery: a 20-year retrospective study. Eye (Lond) 2010;24:1366–75. doi: 10.1038/eye.2010.46. [DOI] [PubMed] [Google Scholar]
  • 4.Shiels A, Hejtmancik JF. Genetic origins of cataract. Arch Ophthalmol. 2007;125:165–73. doi: 10.1001/archopht.125.2.165. [DOI] [PubMed] [Google Scholar]
  • 5.Hejtmancik JF. Congenital cataracts and their molecular genetics. Semin Cell Dev Biol. 2008;19:134–49. doi: 10.1016/j.semcdb.2007.10.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Shiels A, Bennett TM, Hejtmancik JF. Cat-Map: putting cataract on the map. Mol Vis. 2010;16:2007–15. [PMC free article] [PubMed] [Google Scholar]
  • 7.Litt M, Kramer P, LaMorticella DM, Murphey W, Lovrien EW, Weleber RG. Autosomal dominant congenital cataract associated with a missense mutation in the human alpha crystallin gene CRYAA. Hum Mol Genet. 1998;7:471–4. doi: 10.1093/hmg/7.3.471. [DOI] [PubMed] [Google Scholar]
  • 8.Berry V, Francis P, Reddy MA, Collyer D, Vithana E, MacKay I, Dawson G, Carey AH, Moore A, Bhattacharya SS, Quinlan RA. Alpha-B crystallin gene (CRYAB) mutation causes dominant congenital posterior polar cataract in humans. Am J Hum Genet. 2001;69:1141–5. doi: 10.1086/324158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Mackay DS, Boskovska OB, Knopf HL, Lampi KJ, Shiels A. A nonsense mutation in CRYBB1 associated with autosomal dominant cataract linked to human chromosome 22q. Am J Hum Genet. 2002;71:1216–21. doi: 10.1086/344212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Litt M, Carrero-Valenzuela R, LaMorticella DM, Schultz DW, Mitchell TN, Kramer P, Maumenee IH. Autosomal dominant cerulean cataract is associated with a chain termination mutation in the human beta-crystallin gene CRYBB2. Hum Mol Genet. 1997;6:665–8. doi: 10.1093/hmg/6.5.665. [DOI] [PubMed] [Google Scholar]
  • 11.Riazuddin SA, Yasmeen A, Yao W, Sergeev YV, Zhang Q, Zulfiqar F, Riaz A, Riazuddin S, Hejtmancik JF. Mutations in betaB3-crystallin associated with autosomal recessive cataract in two Pakistani families. Invest Ophthalmol Vis Sci. 2005;46:2100–6. doi: 10.1167/iovs.04-1481. [DOI] [PubMed] [Google Scholar]
  • 12.Kannabiran C, Rogan PK, Olmos L, Basti S, Rao GN, Kaiser-Kupfer M, Hejtmancik JF. Autosomal dominant zonular cataract with sutural opacities is associated with a splice mutation in the betaA3/A1-crystallin gene. Mol Vis. 1998;4:21. [PubMed] [Google Scholar]
  • 13.Billingsley G, Santhiya ST, Paterson AD, Ogata K, Wodak S, Hosseini SM, Manisastry SM, Vijayalakshmi P, Gopinath PM, Graw J, Heon E. CRYBA4, a novel human cataract gene, is also involved in microphthalmia. Am J Hum Genet. 2006;79:702–9. doi: 10.1086/507712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Héon E, Priston M, Schorderet DF, Billingsley GD, Girard PO, Lubsen N, Munier FL. The gamma-crystallins and human cataracts: a puzzle made clearer. Am J Hum Genet. 1999;65:1261–7. doi: 10.1086/302619. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Sun H, Ma Z, Li Y, Liu B, Li Z, Ding X, Gao Y, Ma W, Tang X, Li X, Shen Y. Gamma-S crystallin gene (CRYGS) mutation causes dominant progressive cortical cataract in humans. J Med Genet. 2005;42:706–10. doi: 10.1136/jmg.2004.028274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Shiels A, Mackay D, Ionides A, Berry V, Moore A, Bhattacharya S. A missense mutation in the human connexin50 gene (GJA8) underlies autosomal dominant “zonular pulverulent” cataract, on chromosome 1q. Am J Hum Genet. 1998;62:526–32. doi: 10.1086/301762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Mackay D, Ionides A, Kibar Z, Rouleau G, Berry V, Moore A, Shiels A, Bhattacharya S. Connexin46 mutations in autosomal dominant congenital cataract. Am J Hum Genet. 1999;64:1357–64. doi: 10.1086/302383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Bu L, Jin Y, Shi Y, Chu R, Ban A, Eiberg H, Andres L, Jiang H, Zheng G, Qian M, Cui B, Xia Y, Liu J, Hu L, Zhao G, Hayden MR, Kong X. Mutant DNA-binding domain of HSF4 is associated with autosomal dominant lamellar and Marner cataract. Nat Genet. 2002;31:276–8. doi: 10.1038/ng921. [DOI] [PubMed] [Google Scholar]
  • 19.Berry V, Francis P, Kaushal S, Moore A, Bhattacharya S. Missense mutations in MIP underlie autosomal dominant 'polymorphic' and lamellar cataracts linked to 12q. Nat Genet. 2000;25:15–7. doi: 10.1038/75538. [DOI] [PubMed] [Google Scholar]
  • 20.Pras E, Levy-Nissenbaum E, Bakhan T, Lahat H, Assia E, Geffen-Carmi N, Frydman M, Goldman B, Pras E. A missense mutation in the LIM2 gene is associated with autosomal recessive presenile cataract in an inbred Iraqi Jewish family. Am J Hum Genet. 2002;70:1363–7. doi: 10.1086/340318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Jamieson RV, Farrar N, Stewart K, Perveen R, Mihelec M, Carette M, Grigg JR, McAvoy JW, Lovicu FJ, Tam PP, Scambler P, Lloyd IC, Donnai D, Black GC. Characterization of a familial t(16;22) balanced translocation associated with congenital cataract leads to identification of a novel gene, TMEM114, expressed in the lens and disrupted by the translocation. Hum Mutat. 2007;28:968–77. doi: 10.1002/humu.20545. [DOI] [PubMed] [Google Scholar]
  • 22.Conley YP, Erturk D, Keverline A, Mah TS, Keravala A, Barnes LR, Bruchis A, Hess JF, FitzGerald PG, Weeks DE, Ferrell RE, Gorin MB. A juvenile-onset, progressive cataract locus on chromosome 3q21-q22 is associated with a missense mutation in the beaded filament structural protein-2. Am J Hum Genet. 2000;66:1426–31. doi: 10.1086/302871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Ramachandran RD, Perumalsamy V, Hejtmancik JF. Autosomal recessive juvenile onset cataract associated with mutation in BFSP1. Hum Genet. 2007;121:475–82. doi: 10.1007/s00439-006-0319-6. [DOI] [PubMed] [Google Scholar]
  • 24.Shiels A, Bennett TM, Knopf HL, Yamada K, Yoshiura K, Niikawa N, Shim S, Hanson PI. CHMP4B, a novel gene for autosomal dominant cataracts linked to chromosome 20q. Am J Hum Genet. 2007;81:596–606. doi: 10.1086/519980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Shiels A, Bennett TM, Knopf HL, Maraini G, Li A, Jiao X, Hejtmancik JF. The EPHA2 gene is associated with cataracts linked to chromosome 1p. Mol Vis. 2008;14:2042–55. [PMC free article] [PubMed] [Google Scholar]
  • 26.Lachke SA, Alkuraya FS, Kneeland SC, Ohn T, Aboukhalil A, Howell GR, Saadi I, Cavallesco R, Yue Y, Tsai AC, Nair KS, Cosma MI, Smith RS, Hodges E, Alfadhli SM, Al-Hajeri A, Shamseldin HE, Behbehani A, Hannon GJ, Bulyk ML, Drack AV, Anderson PJ, John SW, Maas RL. Mutations in the RNA granule component TDRD7 cause cataract and glaucoma. Science. 2011;331:1571–6. doi: 10.1126/science.1195970. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Chen J, Ma Z, Jiao X, Fariss R, Kantorow WL, Kantorow M, Pras E, Frydman M, Pras E, Riazuddin S, Riazuddin SA, Hejtmancik JF. Mutations in FYCO1 Cause Autosomal-Recessive Congenital Cataracts. Am J Hum Genet. 2011;88:827–38. doi: 10.1016/j.ajhg.2011.05.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Mackay DS, Andley UP, Shiels A. Cell death triggered by a novel mutation in the alphaA-crystallin gene underlies autosomal dominant cataract linked to chromosome 21q. Eur J Hum Genet. 2003;11:784–93. doi: 10.1038/sj.ejhg.5201046. [DOI] [PubMed] [Google Scholar]
  • 29.Lathrop GM, Lalouel JM, Julier C, Ott J. Strategies for multilocus linkage analysis in humans. Proc Natl Acad Sci USA. 1984;81:3443–6. doi: 10.1073/pnas.81.11.3443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Collins JS, Schwartz CE. Detecting polymorphisms and mutations in candidate genes. Am J Hum Genet. 2002;71:1251–2. doi: 10.1086/344344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kumar P, Henikoff S, Ng PC. Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc. 2009;4:1073–81. doi: 10.1038/nprot.2009.86. [DOI] [PubMed] [Google Scholar]
  • 32.Adzhubei IA, Schmidt S, Peshkin L, Ramensky VE, Gerasimova A, Bork P, Kondrashov AS, Sunyaev SR. A method and server for predicting damaging missense mutations. Nat Methods. 2010;7:248–9. doi: 10.1038/nmeth0410-248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 2003;31:3497–500. doi: 10.1093/nar/gkg500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Tusnády GE, Simon I. The HMMTOP transmembrane topology prediction server. Bioinformatics. 2001;17:849–50. doi: 10.1093/bioinformatics/17.9.849. [DOI] [PubMed] [Google Scholar]
  • 35.Marchler-Bauer A, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR, Gwadz M, He S, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Liebert CA, Liu C, Lu F, Lu S, Marchler GH, Mullokandov M, Song JS, Tasneem A, Thanki N, Yamashita RA, Zhang D, Zhang N, Bryant SH. CDD: specific functional annotation with the Conserved Domain Database. Nucleic Acids Res. 2009;37(Database issue):D205–10. doi: 10.1093/nar/gkn845. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Zhou Z, Hu S, Wang B, Zhou N, Zhou S, Ma X, Qi Y. Mutation analysis of congenital cataract in a Chinese family identified a novel missense mutation in the connexin 46 gene (GJA3). Mol Vis. 2010;16:713–9. [PMC free article] [PubMed] [Google Scholar]
  • 37.Bennett TM, Mackay DS, Knopf HL, Shiels A. A novel missense mutation in the gene for gap-junction protein alpha3 (GJA3) associated with autosomal dominant “nuclear punctate” cataracts linked to chromosome 13q. Mol Vis. 2004;10:376–82. [PubMed] [Google Scholar]
  • 38.Hansen L, Mikkelsen A, Nurnberg P, Nurnberg G, Anjum I, Eiberg H, Rosenberg T. Comprehensive mutational screening in a cohort of Danish families with hereditary congenital cataract. Invest Ophthalmol Vis Sci. 2009;50:3291–303. doi: 10.1167/iovs.08-3149. [DOI] [PubMed] [Google Scholar]
  • 39.Burdon KP, Wirth MG, Mackey DA, Russell-Eggitt IM, Craig JE, Elder JE, Dickinson JL, Sale MM. A novel mutation in the Connexin 46 gene causes autosomal dominant congenital cataract with incomplete penetrance. J Med Genet. 2004;41:e106. doi: 10.1136/jmg.2004.018333. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Devi RR, Reena C, Vijayalakshmi P. Novel mutations in GJA3 associated with autosomal dominant congenital cataract in the Indian population. Mol Vis. 2005;11:846–52. [PubMed] [Google Scholar]
  • 41.Zhou Z, Wang B, Hu S, Zhang C, Ma X, Qi Y. Genetic variations in GJA3, GJA8, LIM2, and age-related cataract in the Chinese population: a mutation screening study. Mol Vis. 2011;17:621–6. [PMC free article] [PubMed] [Google Scholar]
  • 42.Yoshida M, Harada Y, Kaidzu S, Ohira A, Masuda J, Nabika T. New genetic model rat for congenital cataracts due to a connexin 46 (Gja3) mutation. Pathol Int. 2005;55:732–7. doi: 10.1111/j.1440-1827.2005.01896.x. [DOI] [PubMed] [Google Scholar]
  • 43.Gong X, Li E, Klier G, Huang Q, Wu Y, Lei H, Kumar NM, Horwitz J, Gilula NB. Disruption of alpha3 connexin gene leads to proteolysis and cataractogenesis in mice. Cell. 1997;91:833–43. doi: 10.1016/s0092-8674(00)80471-7. [DOI] [PubMed] [Google Scholar]
  • 44.Gong X, Agopian K, Kumar NM, Gilula NB. Genetic factors influence cataract formation in alpha 3 connexin knockout mice. Dev Genet. 1999;24:27–32. doi: 10.1002/(SICI)1520-6408(1999)24:1/2<27::AID-DVG4>3.0.CO;2-7. [DOI] [PubMed] [Google Scholar]
  • 45.Gong X, Baldo GJ, Kumar NM, Gilula NB, Mathias RT. Gap junctional coupling in lenses lacking alpha3 connexin. Proc Natl Acad Sci USA. 1998;95:15303–8. doi: 10.1073/pnas.95.26.15303. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Ebihara L, Tong JJ, Vertel B, White TW, Chen TL. Properties of connexin 46 hemichannels in dissociated lens fiber cells. Invest Ophthalmol Vis Sci. 2011;52:882–9. doi: 10.1167/iovs.10-6200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Pal JD, Liu X, Mackay D, Shiels A, Berthoud VM, Beyer EC, Ebihara L. Connexin46 mutations linked to congenital cataract show loss of gap junction channel function. Am J Physiol Cell Physiol. 2000;279:C596–602. doi: 10.1152/ajpcell.2000.279.3.C596. [DOI] [PubMed] [Google Scholar]
  • 48.Yao K, Wang W, Zhu Y, Jin C, Shentu X, Jiang J, Zhang Y, Ni S. A novel GJA3 mutation associated with congenital nuclear pulverulent and posterior polar cataract in a Chinese family. Hum Mutat. 2011 doi: 10.1002/humu.21552. [DOI] [PubMed] [Google Scholar]
  • 49.Addison PK, Berry V, Holden KR, Espinal D, Rivera B, Su H, Srivastava AK, Bhattacharya SS. A novel mutation in the connexin 46 gene (GJA3) causes autosomal dominant zonular pulverulent cataract in a Hispanic family. Mol Vis. 2006;12:791–5. [PubMed] [Google Scholar]
  • 50.Hansen L, Yao W, Eiberg H, Funding M, Riise R, Kjaer KW, Hejtmancik JF, Rosenberg T. The congenital “ant-egg” cataract phenotype is caused by a missense mutation in connexin46. Mol Vis. 2006;12:1033–9. [PubMed] [Google Scholar]
  • 51.Santhiya ST, Kumar GS, Sudhakar P, Gupta N, Klopp N, Illig T, Soker T, Groth M, Platzer M, Gopinath PM, Graw J. Molecular analysis of cataract families in India: new mutations in the CRYBB2 and GJA3 genes and rare polymorphisms. Mol Vis. 2010;16:1837–47. [PMC free article] [PubMed] [Google Scholar]
  • 52.Jiang H, Jin Y, Bu L, Zhang W, Liu J, Cui B, Kong X, Hu L. A novel mutation in GJA3 (connexin46) for autosomal dominant congenital nuclear pulverulent cataract. Mol Vis. 2003;9:579–83. [PubMed] [Google Scholar]
  • 53.Guleria K, Sperling K, Singh D, Varon R, Singh JR, Vanita V. A novel mutation in the connexin 46 (GJA3) gene associated with autosomal dominant congenital cataract in an Indian family. Mol Vis. 2007;13:1657–65. [PubMed] [Google Scholar]
  • 54.Ma ZW, Zheng JQ, Li J, Li XR, Tang X, Yuan XY, Zhang XM, Sun HM. Two novel mutations of connexin genes in Chinese families with autosomal dominant congenital nuclear cataract. Br J Ophthalmol. 2005;89:1535–7. doi: 10.1136/bjo.2005.075184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Yang G, Xing B, Liu G, Lu X, Jia X, Lu X, Wang X, Yu H, Fu Y, Zhao J. A novel mutation in the GJA3 (connexin46) gene is associated with autosomal dominant congenital nuclear cataract in a Chinese family. Mol Vis. 2011;17:1070–3. [PMC free article] [PubMed] [Google Scholar]
  • 56.Guleria K, Vanita V, Singh D, Singh JR. A novel “pearl box” cataract associated with a mutation in the connexin 46 (GJA3) gene. Mol Vis. 2007;13:797–803. [PMC free article] [PubMed] [Google Scholar]
  • 57.Rees MI, Watts P, Fenton I, Clarke A, Snell RG, Owen MJ, Gray J. Further evidence of autosomal dominant congenital zonular pulverulent cataracts linked to 13q11 (CZP3) and a novel mutation in connexin 46 (GJA3). Hum Genet. 2000;106:206–9. doi: 10.1007/s004390051029. [DOI] [PubMed] [Google Scholar]
  • 58.Ding X, Wang B, Luo Y, Hu S, Zhou G, Zhou Z, Wang J, Ma X, Qi Y. A novel mutation in the connexin 46 (GJA3) gene associated with congenital cataract in a Chinese pedigree. Mol Vis. 2011;17:1343–9. [PMC free article] [PubMed] [Google Scholar]
  • 59.Li Y, Wang J, Dong B, Man H. A novel connexin46 (GJA3) mutation in autosomal dominant congenital nuclear pulverulent cataract. Mol Vis. 2004;10:668–71. [PubMed] [Google Scholar]

Articles from Molecular Vision are provided here courtesy of Emory University and the Zhongshan Ophthalmic Center, Sun Yat-sen University, P.R. China

RESOURCES