Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2011 Sep;55(9):4188–4195. doi: 10.1128/AAC.00398-11

Mutation of RNA Polymerase β Subunit (rpoB) Promotes hVISA-to-VISA Phenotypic Conversion of Strain Mu3▿,†

Miki Matsuo 1, Tomomi Hishinuma 1, Yuki Katayama 1, Longzhu Cui 1, Maria Kapi 2, Keiichi Hiramatsu 1,*
PMCID: PMC3165293  PMID: 21746940

Abstract

The clinical vancomycin-intermediate Staphylococcus aureus (VISA) strain Mu50 carries two mutations in the vraSR and graRS two-component regulatory systems (TCRSs), namely, vraS(I5N) and graR(N197S) (hereinafter designated graR*). The clinical heterogeneously vancomycin-intermediate S. aureus (hVISA) strain Mu3 shares with Mu50 the mutation in vraS that encodes the VraS two-component histidine kinase. Previously, we showed that introduction of the plasmid pgraR*, carrying the mutated two-component response regulator graR*, converted the hVISA strain Mu3 into VISA (vancomycin MIC = 4 mg/liter). Subsequently, however, we found that the introduction of a single copy of graR* into the Mu3 chromosome by a gene replacement method did not confer on Mu3 the VISA phenotype. The gene-replaced strain Mu3graR* thus obtained remained hVISA (MIC ≤ 2 mg/liter), although a small increase in vancomycin MIC was observed compared to that of the parent strain Mu3. Reevaluation of the Mu3 and Mu50 genomes revealed the presence of another mutation responsible for the expression of the VISA phenotype in Mu50. Here, we demonstrate that in addition to the two regulator mutations, a third mutation found in the Mu50 rpoB gene, encoding the RNA polymerase β subunit, was required for Mu3 to achieve the level of vancomycin resistance of Mu50. The selection of strain Mu3graR* with rifampin gave rise to rpoB mutants with various levels of increased vancomycin resistance. Furthermore, 3 (33%) of 10 independently isolated VISA strains established from the heterogeneous subpopulations of Mu3graR* were found to possess rpoB mutations with or without an accompanying rifampin-resistance phenotype. The data indicate that a sizable proportion of the resistant hVISA cell subpopulations is composed of spontaneous rpoB mutants with various degrees of increased vancomycin resistance.

INTRODUCTION

The first vancomycin-intermediate Staphylococcus aureus (VISA) clinical strain, Mu50, was isolated in May 1996 in Juntendo University Hospital (JUH) (20). VISA can be generated in vitro from vancomycin-susceptible S. aureus (VSSA) by exposing the cells to selective concentrations of vancomycin. At least two steps of selection are required to get VISA when starting from VSSA strains (18). Before the VISA phenotype is attained, mutants in the transitional stage of vancomycin resistance appear. Such mutants are called heterogeneously VISA (hVISA or hetero-VISA). hVISA spontaneously generates VISA cells within its cell population at a high frequency, greater than 1 × 10−6. The first hVISA clinical strain, Mu3, was isolated in January 1996, 4 months prior to the isolation of Mu50 in JUH (22). hVISA has a characteristic heterogeneous resistance phenotype as observed by analysis of the vancomycin-resistant cell subpopulations (population analysis) (22). While more than 99.99% of the cell populations of hVISA retain susceptible levels of vancomycin MIC (≤2 mg/liter), they also contain VISA cells with various resistance levels, capable of growth on the agar plates containing 2 to 10 mg/liter of vancomycin (22). Therefore, the scheme of stepwise acquisition of vancomycin-intermediate resistance is VSSA → hVISA →VISA (18).

Two mutations were identified in VISA strain Mu50 which were considered to correspond to the two sequential steps in vancomycin-intermediate resistance acquisition; namely, VSSA-to-hVISA and hVISA-to-VISA phenotypic conversion (7). Both mutations are incorporated in the regulator genes of a two-component regulatory system (TCRS), one in vraSR (28, 29) and the other in graRS (8).

In the case of vraSR, the mutation was identified in vraS, encoding a sensor kinase or signal transducer. The mutation vraS(I5N), which replaces the fifth isoleucine (I) with asparagine (N), was found to be responsible for VSSA-to-hVISA phenotypic conversion (25). vraSR is an upregulator of S. aureus cell wall synthesis (14, 28). The hVISA strain Mu3 shares this mutation with Mu50 (25). Activation of the regulator induces the transcription of such genes as murZ, pbp2, and sgtB, encoding UDP-N-acetylglucosamine enolpyruvyl transferase, penicillin-binding protein 2, and peptidoglycan transglycosylase, respectively (28). Since the accelerated peptidoglycan synthesis and thickening of the cell wall peptidoglycan layers are directly associated with increased vancomycin resistance in VISA strain Mu50 (5, 10, 15), it is reasonable that the first mutation occurred in the vraSR TCRS.

In contrast to vraSR, the second mutation in Mu50 responsible for hVISA-to-VISA conversion was found in the response regulator gene graR of the graRS TCRS. graRS is known to control more than 200 genes (16) and is involved in the susceptibility of S. aureus to lysozyme and cationic antimicrobial peptides (16, 27, 30). The mutation graR(N197S), hereinafter designated graR*, replaced the 197th amino acid, asparagine (N), with serine (S) (34). Introduction of the plasmid carrying graR* but not introduction of wild-type graR increased the vancomycin MIC from 2 to 4 mg/liter (34). The plasmid pgraR* also conferred on Mu3 such phenotypic changes as significant cell wall thickening and greatly reduced growth rate, which are common characteristics of the VISA clinical strains studied so far (34). The introduction of pgraR* did not confer the VISA phenotype on a VSSA strain whose vraS was intact (34). Therefore, the VISA phenotype of Mu50 was attained by the combined effects of the two regulator mutations sequentially incorporated in the global regulators vraSR and graRS (7).

To further confirm the combined effect of the two mutations in an equal gene dose, strain Mu3graR* was constructed by replacing the graR gene of Mu3 with graR*. Contrary to our expectation, however, the vancomycin MIC of the constructed strain Mu3graR* did not exceed 4 mg/liter. This study was planned to resolve this question, and we found that, in addition to the two regulator mutations, a third mutation in the RNA polymerase (RNAP) β subunit (rpoB) was required for Mu3 to achieve hVISA-to-VISA phenotypic conversion.

MATERIALS AND METHODS

Bacterial strains and growth condition.

The bacterial strains and plasmids used in this study are listed in Table 1. LB medium (1% [wt/vol] Bacto tryptone [Becton, Dickinson and Co. {BD}, Franklin Lakes, NJ], 0.5% [wt/vol] yeast extract [BD], and 1% [wt/vol] NaCl [Wako Pure Chemical Industries, Osaka, Japan]) was used to culture Escherichia coli, while S. aureus was grown in brain heart infusion (BHI) broth (BD) with aeration at 37°C, unless indicated otherwise. In some experiments, antibiotics were added to the media at the following concentrations: ampicillin (Sigma Chemical Co., St. Louis, MO) at 100 mg/liter for E. coli and chloramphenicol (Sigma) at 10 mg/liter and tetracycline (Wako) at 150 mg/liter for S. aureus.

Table 1.

Plasmids and bacterial strains used in this study

Plasmid or bacterial strain(s) Descriptiona Reference(s) or source
Plasmids
    pYT3 E. coli-S. aureus shuttle-cloning vector 15
    pgraR* pYT3 carrying mutated graR gene with the N197S amino acid substitution (graR*) 34
    pKOR1 E. coli-S. aureus shuttle vector for the construction of allelic-exchange mutants 1
    pKORgraR* pKOR1 carrying the 0.9-kb DNA fragment containing the graR* gene This study
    pKORrpoB(H481Y) pKOR1 carrying the 3.1-kb DNA fragment containing the rpoB(H481Y) sequence This study
Strains
    Mu50 VISA clinical isolate from JUH in 1996; carrying vraS(I5N), graR*, and rpoB(H481Y) mutations 20
    Mu3 hVISA clinical isolate from JUH in 1996; carrying vraS(I5N) mutation 22
    N315 MRSA clinical isolate from NUH in 1982; a representative health care-associated MRSA in Japan 25, 26
    Mu3(pYT3) Mu3 transformed with pYT3 34
    Mu3(pgraR*) Mu3 transformed with pgraR* 34
    Mu3graR* Mu3 with its graR gene replaced by graR* This study
    Mu3rpoB(H481Y) Mu3 introduced with rpoB(H481Y) by gene replacement procedure This study
    Mu3graR*rpoB(H481Y) Mu3graR* with rpoB(H481Y) introduced by gene replacement procedure This study
    Mu3RP1-1 to -3 Mutant strains obtained by selecting Mu3 with 1 mg/liter of rifampin This study
    Mu3graR*RP1-1, -2, -3, -10, -15, -25, -31, -33, -35 Mutant strains obtained by selecting Mu3graR* with 1 mg/liter of rifampin This study
    Mu3graR*V4-1 to -10 Mutant strains obtained by selecting Mu3graR* with 4 mg/liter of vancomycin This study
    Mu3graR*V6-25, -36 Mutant strains obtained by selecting Mu3graR* with 6 mg/liter of vancomycin This study
a

JUH, Juntendo University Hospital; NUH, Nagasaki University Hospital.

Genetic manipulation of bacteria.

Plasmid DNA was isolated by standard techniques (Promega Co., Madison, WI) and used to transform chemically competent E. coli JM109 (Takara Bio, Inc., Shiga, Japan) or electrocompetent S. aureus strains as described previously (26). KOD DNA polymerase was purchased from Toyobo Co., Ltd., Osaka, Japan, and was used according to the manufacturer's recommendations.

Isolation of rifampin-resistant mutants from Mu3 and Mu3graR*.

Amounts of 107 to 108 CFU of overnight cultures of Mu3 or Mu3graR* were plated onto a BHI agar plate containing 1 mg/liter of rifampin (Sigma). After 24 h of incubation at 37°C, colonies were picked and purified by streaking them on another BHI agar plate containing 1 mg/liter of rifampin before establishing them as rifampin-resistant mutant strains.

Isolation of VISA strains from vancomycin-resistant subpopulations of Mu3graR*.

VISA strains were isolated from Mu3graR* by vancomycin selection in two separate experiments. In the first experiment, a total of 6.5 × 107 CFU (5 × 106 CFU/plate) of an overnight culture of Mu3graR* was spread on BHI agar plates containing 6 mg/liter vancomycin. A total of 36 colonies were formed after 48 h of incubation at 37°C. They were tested for rifampin resistance by replica plating onto the BHI agar plates containing 0.5 mg/liter of rifampin. Two colonies were found to grow on the rifampin plates. They were colony purified on drug-free BHI agar plates and established as strains Mu3graR*V6-25 and Mu3graR*V6-36 and then were subjected to further analysis (Table 1). In the second experiment, 10 independent cultures were prepared by inoculating 104 CFU of Mu3graR* into each of the 10 test tubes containing 5 ml of tryptic soy broth (TSB; BD). After overnight cultivation, 106 CFU of the cell suspension of each tube was spread on a Mueller-Hinton (MH) agar plate containing 4 mg/liter of vancomycin. The numbers of colonies formed on each agar plate were 32, 9, 15, 22, 15, 10, 18, 11, 18, and 20. One colony was arbitrarily picked from each of the 10 MH agar plates and colony purified on another MH agar plate containing 4 mg/liter vancomycin. Ten mutually independent mutant strains (Mu3graR*V4-1 to -10) of Mu3graR* were thus established and were subjected to further analysis (Table 1).

Construction of the gene-replaced derivative strains of Mu3: Mu3graR*, Mu3rpoB(H481Y), and Mu3graR*rpoB(H481Y).

To replace the graR of Mu3 with graR* and the rpoB of Mu3 with rpoB(H481Y), the pKOR1 allele replacement system was used as described previously (1). Briefly, to replace the wild-type graR with graR*, a DNA fragment of approximately 0.9 kb containing the mutation was amplified by PCR using primers attB1-graR*-FW and attB2-graR*-RV and Mu50 genomic DNA as the template. The sequences of the primers used in this study are listed in Table 2. To replace rpoB with rpoB(H481Y), an approximately 3.1-kb DNA fragment containing the mutation site was amplified by PCR using primers attB1-rpoB-P1 and attB2-rpoB-P2 and Mu50 genomic DNA as the template. The PCR products with the attB site at both ends thus prepared were used for recombination with pKOR1, obtaining the plasmids pKOR-graR* and pKOR-rpoB(H481Y), which were then used for the allelic replacement procedure (1, 7).

Table 2.

Primers used in this study

Primer Nucleotide sequencea (5′–3′)
attB1-graR*-FW GGGGACAAGTTTGTACAAAAAAGCAGGCTGTATTGAAGATTTCGGCAAAGTAATGGATACATTTGAAAG
attB2-graR*-RV GGGGACCACTTTGTACAAGAAAGCTGGGTATAATCAACTGTATGACGTT
attB1-rpoB-P1 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGACAAAAATGGTCGTGAA
attB2-rpoB-P2 GGGGACCACTTTGTACAAGAAAGCTGGGTTGCCTGTTTTGTAAATTGCGTA
rpoB#6746 CTGTAATTGGTAATGCTTTCCCTGACTC
rpoB#6747 CCAGAATCACGTGCTGCAACGTGTTCCA
rpoB-CP1 GAACTTTTTGGAAATGTAGAAGTGG
rpoB-CP2 TTTTGCCTGTTTTGTAAATTGC
rpoB-SP1 TTATGCTGCACCTCTTCGTG
rpoB-SP2 CGTCGATTTTACGACGATCA
rpoB-SP3 TGGAACACGTTGCAGCACGTGATTCTGG
rpoB-SP4 GGCGGTATCGTTCTTGATGT
rpoB-SP5 CAAGTGCCCATACCTCCATC
rpoB-SP6 ATCGGACGTCCATCTGGTAA
rpoB-SP7 GATGGAGGTATGGGCACTTG
rpoB-SP8 TGATCGTCGTAAAATCGACG
rpoB-SP9 GTCCAGGTGAACCACCAACT
rpoB-SP10 TGGTCGTTTCATGGATGATG
a

attB sites are underlined.

DNA sequencing.

The location of the rpoB mutation and the amino acid substitution it causes in the rifampin-resistant (MIC ≥ 1 mg/liter) mutant strains were determined by DNA sequencing as described previously (29). Briefly, the rifampin resistance-determining region (RRDR) of the rpoB gene (3, 47), with an approximate size of 1 kb, was amplified using primers rpoB#6746 and rpoB#6747 (Table 2), and the resulting DNA fragments were sequenced in reciprocal directions from rpoB#6746 and rpoB#6747 using an Applied Biosystems 377 DNA sequencer. For rifampin-susceptible (MIC < 1 mg/liter) mutants, the entire rpoB gene was amplified by using primers rpoB-CP1 and rpoB-CP2 (Table 2). With the amplified DNA as a template, the entire rpoB gene sequence was determined by using all the primers listed in Table 2.

Antibiotic susceptibility tests.

MIC determination by the agar dilution method was performed according to the recommendation of CLSI (4), with some modifications as follows. BHI agar was used instead of MH agar, because BHI agar is more supportive of the expression of the VISA phenotype than any other tested agar (17). In addition to the orthodox 2-fold antibiotic dilution, linear sets of vancomycin concentrations with 1-mg/liter increments were used for the range of 1 to 10 mg/liter. Therefore, the drug concentrations for vancomycin were 0.5 mg/liter, 1 to 10 at 1-mg/liter increments and 16, 32, 64, and 128 mg/liter. For the evaluation of small changes in susceptibility to daptomycin and linezolid, the Etest method (AB Biodisk, Solna, Sweden) using BHI agar plates was adopted. MICs were determined in at least three independent experiments to confirm reproducibility. Representative data are presented.

Analysis of resistant cell subpopulations (population analysis).

Analysis of the cell subpopulations resistant to vancomycin was performed as described previously (22). An appropriately diluted overnight culture was spread onto BHI agar plates containing vancomycin at various concentrations. After 48 h of incubation at 37°C, the colonies were counted and plotted on a graph.

Doubling time.

Determination of doubling time was performed as described previously (34). Overnight cultures of the test strains were diluted 1,000 times into 10 ml fresh BHI and were grown at 37°C with shaking at 25 rpm in an automatic photorecording incubator (TN-2612, Advantec, Tokyo, Japan). The optical density at 600 nm (OD600) was automatically monitored and recorded every 2 min. For doubling-time determinations, the OD versus time was plotted for each strain in the exponential growth phase. The doubling times were then calculated as follows: [(t2 − t1) × log 2]/(log OD600 at t2 − log OD600 at t1). Doubling time was measured in at least three independent experiments.

Transmission electron microscopy.

S. aureus sample preparation for transmission electron microscopy was performed as described previously (10). Morphometric evaluation of cell wall thickness was performed by using photographic images taken by an electron microscope (model H-7100, Hitachi, Tokyo, Japan) at a final magnification of ×30,000, and the cell wall thickness was measured as previously described (10). At least 30 cells of each strain with nearly equatorial cut surfaces were measured for the evaluation of cell wall thickness; the results are expressed as the mean values ± standard deviations, and the significance of the differences in the mean values were evaluated by using Student's t test.

RESULTS

A single dose of the mutated graR gene (graR*) did not confer on Mu3 the VISA phenotype of Mu50.

As shown in Fig. 1, the population analysis of the graR gene-replaced strain Mu3graR* showed increased vancomycin resistance compared to that of its parent Mu3. However, it did not satisfy the criterion of VISA, which is defined as having a vancomycin MIC of 4 or 8 mg/liter. We have previously reported that Mu3(pgraR*), a transformant of Mu3 with the plasmid pgraR*, expressed a vancomycin MIC of 4 mg/liter (34). Figure 1 shows that Mu3(pgraR*) does exceed Mu3graR* in the level of vancomycin resistance. However, Mu3(pgraR*) also was still short of Mu50 in the level of vancomycin resistance. Mu50 has a MIC of 8 mg/liter, and its population curve is evidently shifted more to the right than that of Mu3(pgraR*). Since both Mu50 and Mu3graR* have a single copy of graR* in the chromosome, we considered that some thus-far-unnoticed additional genetic alteration that promotes vancomycin resistance was present in Mu50.

Fig. 1.

Fig. 1.

Effect of graR(N197S) mutation (graR*) on the vancomycin-resistant subpopulations of Mu3. The numbers of colonies on BHI agar plates containing various concentrations of vancomycin were counted after 48 h of incubation at 37°C. Mu3graR* is a Mu3-derived mutant strain with the graR* mutation introduced by a gene replacement method. Mu3(pgraR*) is a transformant of Mu3 with the plasmid pgraR*. L, liter.

We again reviewed the whole-genome sequence data of Mu50 and Mu3 and noticed that Mu50 harbored a mutation in the rpoB gene which was absent in Mu3 (34). The gene encodes RpoB, the β subunit of RNA polymerase (RNAP). In Mu50, the 481st amino acid, histidine (H), of RpoB was replaced by tyrosine (Y). Consistent with the presence of the rpoB mutation was the fact that Mu50 was resistant to rifampin and Mu3 was susceptible to it (Table 3). To test whether the mutated rpoB, rpoB(H481Y), contributed to the expression of the VISA phenotype in Mu50, we obtained rpoB mutant strains from Mu3 and Mu3graR* by selecting them with 1 mg/liter of rifampin. The rpoB genes of the established mutant strains were sequenced, and their vancomycin MICs determined (Table 3).

Table 3.

The antibiograms, doubling times, and predicted RpoB amino acid substitutions of the Mu3-derived strains

Strainsa Amino acid substitution in RpoB MIC (mg/liter)c
Doubling timec (min)
Rifampin Teicoplanin Vancomycin Daptomycin Linezolid
Mu50 H481Y >128 16 6 4 0.5 35.7
N315 0.031 2 1 0.5 1 25.7
Mu3 0.031 16 2 2 1 28.9
Mu3graR* 0.031 16 3 3 0.75 29.8
Rifampin-selected or rpoB-replaced strains
    Mu3RP1-1 Q468L >128 32 3 2 0.5 42.8
    Mu3RP1-2 D471Y 16 16 3 2 0.75 32.0
    Mu3RP1-3 H481Y >128 16 4 1.5 0.5 31.3
    Mu3rpoB(H481Y)b H481Y >128 16 4 1.5 0.5 31.0
    Mu3graR*RP1-35 Q468K >128 16 3 4 0.38 31.0
    Mu3graR*RP1-10 S464P 8 16 3 3 0.5 32.6
    Mu3graR*RP1-25 Q468R >128 16 3 4 0.25 38.5
    Mu3graR*RP1-2 I527F 8 16 4 3 0.5 32.4
    Mu3graR*RP1-3 A477D >128 16 4 3 0.5 34.2
    Mu3graR*RP1-31 S486L >128 16 4 4 0.38 39.1
    Mu3graR*RP1-15 Q468L >128 32 5 3 0.38 33.1
    Mu3graR*RP1-1 H481L 128 16 5 3 0.5 31.9
    Mu3graR*RP1-33 H481Y >128 16 6 3 0.38 32.1
    Mu3graR*rpoB(H481Y)b H481Y >128 16 6 3 0.38 32.5
Vancomycin-selected strains
    Experiment 1
        Mu3graR*V6-25 A477V 1 32 8 4 0.5 36.0
        Mu3graR*V6-36 H481Y >128 16 6 3 0.5 31.3
    Experiment 2
        Mu3graR*V4-1 T480M 0.016 32 7 6 0.5 42.2
        Mu3graR*V4-3 R503H 0.031 32 9 6 0.38 42.9
        Mu3graR*V4-7 S746Y 0.25 32 9 4 0.25 57.5
        Mu3graR*V4-2 0.063 32 5 3 0.75 33.8
        Mu3graR*V4-4 0.031 32 6 3 0.75 30.5
        Mu3graR*V4-5 0.031 32 6 3 0.75 30.2
        Mu3graR*V4-6 0.063 16 7 4 0.75 42.5
        Mu3graR*V4-8 0.031 16 5 8 0.75 34.0
        Mu3graR*V4-9 0.063 16 6 4 0.5 31.6
        Mu3graR*V4-10 0.031 16 6 3 0.75 35.2
a

Strains carrying the rpoB(H481Y) mutation are denoted in boldface.

b

rpoB gene-replaced strains.

c

The MIC determination and doubling-time measurement were repeated at least three times to confirm reproducibility.

The rpoB(H481Y) mutants of Mu3graR* but not those of Mu3 expressed VISA phenotypes comparable to that of Mu50.

Totals of 8 and 34 rifampin-resistant mutant strains were obtained from Mu3 and Mu3graR*, respectively, by selection with 1 mg/liter of rifampin. All the rifampin-resistant mutants harbored rpoB mutations. The kinds of RpoB amino acid substitutions and the numbers of Mu3 mutants harboring them were H481Y, 5 strains; D471Y, 2 strains; and Q486L, one strain. The amino acid substitutions and numbers of the Mu3graR*-derived rifampin-selected mutants were H481L, 9 strains; A477D, 9 strains; H481Y, 5 strains; Q468L, 3 strains; S486L, 3 strains; S464P, 2 strains; Q468K, 1 strain; Q468R, 1 strain; and I527F, 1 strain. Rifampin-resistant strains carrying the same rpoB mutation as Mu50, rpoB(H481Y), were frequently obtained from both strain Mu3 and Mu3graR*.

Table 3 shows the vancomycin and teicoplanin MICs for the rifampin-resistant mutant strains representing each of the RpoB amino acid substitutions. Mu3graR*RP1-33, representing the five rpoB(H481Y) mutants obtained from Mu3graR*, had the highest vancomycin MIC, which was comparable to that of VISA strain Mu50 (Table 3). The rpoB gene-replaced strain Mu3graR*rpoB(H481Y) had a vancomycin MIC of 6 mg/liter, identical with that of Mu3graR*RP1-33, supporting the idea that the increase in the vancomycin MIC was due to the rpoB mutation (Table 3). The rifampin-selected mutant strain Mu3RP1-3 harboring the rpoB(H481Y) mutation and the gene-replaced strain Mu3rpoB(H481Y) had higher vancomycin MICs than Mu3. However, the level of resistance of these strains did not reach that of VISA strain Mu50 (Table 3). Therefore, both the graR* and the rpoB(H481Y) mutation were needed for Mu3 to achieve the VISA phenotype of Mu50.

Three mutations, causing RpoB amino acid substitutions H481Y, H481L, and Q468L, were associated with clear increases in vancomycin resistance (the MIC increased by at least 2 digits, from 3 to 5 or 6 mg/liter). RpoB amino acid substitutions I527F, A477D, and S486L were associated with marginal increases in vancomycin MICs, from 3 to 4 mg/liter. The vancomycin MIC was not influenced appreciably by the S464P, Q468K, or Q468R amino acid substitution (Table 3). No rpoB mutation, however, was negatively associated with the vancomycin MIC change before or after its introduction (Table 3).

The MIC for the other glycopeptide antibiotic, teicoplanin, was not much influenced by rpoB mutations (Table 3). hVISA strain Mu3 was already fully resistant to teicoplanin (MIC of 16 mg/liter versus 2 mg/liter for a control VSSA strain, N315) (Table 3). Teicoplanin resistance has been associated with the vraS(I5N) mutation in the vraSR TCRS of Mu3 (28). No more significant increases or decreases in teicoplanin MICs were observed with the addition of rpoB mutations, except for rpoB(Q468L), which slightly increased the teicoplanin MIC of both Mu3 and Mu3graR*.

More detailed evaluation of changes in vancomycin susceptibility due to the rpoB(H481Y) mutation was done by using population analysis (Fig. 2). Figure 2A illustrates the analysis of vancomycin-resistant subpopulations of Mu3 and its derivative strains. Mu3RP1-3, the rifampin-selected rpoB(H481Y) mutant strain of Mu3, had moderately increased vancomycin resistance compared to that of Mu3. However, Mu3RP1-3 and Mu3graR* contained only small subpopulations of cells that could grow on the plates containing more than 4 mg/liter of vancomycin (Fig. 2A). This was in contrast to Mu3graR*RP1-33, having both the graR* and rpoB(H481Y) mutations, which showed a population curve almost identical to that of Mu50. All five Mu3graR*RP1 mutants having the rpoB(H481Y) mutation exhibited population curves practically identical to that of Mu50 (data not shown).

Fig. 2.

Fig. 2.

Effect of rpoB(H481Y) mutation on the vancomycin-resistant subpopulations of Mu3 and Mu3graR*. (A) Mu3RP1-3 is a rifampin-resistant mutant of Mu3 having the rpoB(H481Y) mutation. Mu3graR*RP1-33 is a rifampin-resistant mutant of Mu3graR* having the rpoB(H481Y) mutation. (B) Mu3rpoB(H481Y) and Mu3graR*rpoB(H481Y) are derivative strains of Mu3 and Mu3graR*, respectively, with the rpoB(H481Y) mutation introduced by a gene replacement method.

Figure 2B shows the population curves of the strains Mu3graR*rpoB(H481Y) and Mu3rpoB(H481Y). They were the derivative strains of Mu3graR* and Mu3, respectively, constructed by replacing their rpoB genes with rpoB(H481Y) using the single-gene replacement procedure (1). Both strains exhibited practically the same population curves as Mu3graR*RP1-33 and Mu3RP1-3, respectively. The data strongly suggested that the rpoB mutation itself and not any other incidental genetic alteration(s) caused by rifampin selection was responsible for the increased vancomycin resistance. Although not so significantly as in Mu3graR*, rpoB(H481Y) did increase vancomycin resistance when introduced in Mu3 as well (Fig. 2).

The resistant subpopulations of hVISA strain Mu3graR* contain rpoB mutants at high frequency.

To further ascertain the importance of rpoB mutations in the hVISA-to-VISA phenotypic conversion, we established VISA strains from the vancomycin-resistant cell subpopulations of hVISA strain Mu3graR* by vancomycin selection. They were selected by their capability to grow in 4 or 6 mg/liter of vancomycin. In the first experiment (experiment 1), a total of 6.5 × 107 CFU of a single overnight culture of Mu3graR* was spread on BHI agar plates containing 6 mg/liter of vancomycin. After 48 h of incubation, 36 discrete colonies were observed. The rifampin susceptibilities of the colonies were tested by replicating them on BHI agar plates containing 0.5 mg/liter of rifampin. Two colonies, Mu3graR*V6-25 and Mu3graR*V6-36, were found to grow on the rifampin plates (Table 3).

The next experiment (experiment 2) was performed to roughly evaluate the frequency of rpoB mutations among the VISA subpopulations of Mu3graR*. We obtained 10 independent Mu3graR* mutant strains capable of growth on MH agar plates containing 4 mg/liter of vancomycin (Materials and Methods and Table 3). All of the strains had vancomycin MIC values of 4 to 6 mg/liter on MH agar, satisfying the VISA definition. Their rpoB sequencing results and their susceptibilities to anti-methicillin-resistant S. aureus (MRSA) antibiotics are shown in Table 3. It was remarkable that three rpoB mutant strains were identified among 10 independently obtained VISA strains from Mu3graR*. This strongly indicated that rpoB mutations are one of the major contributors to the hVISA-to-VISA phenotypic conversion of Mu3graR*. Also remarkable was that all three of the VISA strains with rpoB mutations were either susceptible to rifampin (Table 3) or only marginally resistant to it.

The rpoB mutants selected with vancomycin had higher vancomycin MIC values than the ones selected with rifampin. The most notable were rpoB(A477V), rpoB(R503H), and rpoB(S746Y), which increased vancomycin resistance beyond that of Mu50 (MICs of 8 to 9 versus 6 for Mu50) (Table 3). However, the rpoB(H481Y) mutants found in both groups (denoted by boldface in Table 3) had equal vancomycin MICs whether they were selected with vancomycin or rifampin (Table 3). This indicated that the type of rpoB mutation, namely, the position and the kind of amino acid change, but not the selection method determined the level of vancomycin resistance.

There were seven vancomycin-selected VISA mutants without rpoB mutations. Therefore, it is evident that there are other genetic mechanisms than rpoB mutation that can increase vancomycin resistance. It was curious, however, that within the vancomycin-selected mutants, the level of resistance associated with rpoB mutation was higher than that caused by non-rpoB mutations (MICs of 6 to 9 versus 5 to 7) (Table 3). Together with rifampin-selected mutants, a total of 13 different types of rpoB mutants were obtained from Mu3graR* and 3 from Mu3. Although certain rpoB mutations, such as rpoB(Q468K), rpoB(S464P), and rpoB(Q468R), were not associated with increased vancomycin resistance, all the other rpoB mutants analyzed here demonstrated higher MIC values than their parents (Table 3). Therefore, we concluded that, in addition to rpoB(H481Y), some other types of rpoB mutations also promote hVISA-to-VISA conversion.

Influence of rpoB mutation on daptomycin and linezolid susceptibilities.

The VISA phenotype has been associated with decreased daptomycin susceptibility (6, 33) and increased linezolid susceptibility (45). We tested whether rpoB mutation was responsible for the curious correlations or not. The introduction of graR* into Mu3 was accompanied by a small increase in the daptomycin MIC, from 2 to 3 mg/liter (Table 3). The subsequent introduction of rpoB mutations causing Q468K, Q468R, S486L, A477V, and S746Y amino acid substitutions further increased the daptomycin MICs of the Mu3graR* mutants to the level of Mu50 (up to 4 mg/liter) (Table 3). Two rpoB mutations resulting in T480M and R503H amino acid substitutions increased the daptomycin MICs even beyond the level of Mu50 (up to 6 mg/liter). Therefore, increases in the daptomycin resistance of Mu3graR* were dependent on the type of rpoB mutation. Curiously, rpoB(H481Y), which significantly promoted vancomycin resistance, did not add much to the daptomycin resistance of Mu3graR* (MIC = 3 mg/liter) (Table 3).

With regard to linezolid susceptibility, all the rpoB mutants of Mu3graR* selected with rifampin or constructed by gene replacement were associated with significant decreases in linezolid MICs (Table 3). Moreover, all five rpoB mutants selected with vancomycin also had decreased linezolid MICs, whereas six of the seven vancomycin-selected non-rpoB mutants retained the same linezolid MIC as Mu3graR* (Table 3). Therefore, all 19 rpoB mutant strains obtained from Mu3graR* and Mu3 demonstrated decreased linezolid MICs, whereas only 1 of the 7 non-rpoB mutant strains had a decreased linezolid MIC (Table 3). The data clearly showed that rpoB mutation itself and not vancomycin resistance was directly associated with the decreases in linezolid susceptibility in at least the Mu3 and Mu3graR* genetic backgrounds.

rpoB mutation prolongs the doubling times of Mu3 and Mu3graR*.

The introduction of the graR* mutation into Mu3 did not affect the doubling time appreciably (Table 3). This posed a great contrast to the previously observed extremely prolonged doubling time of Mu3(pgraR*) (41.5 min) (34). On the other hand, the subsequent introduction of rpoB(H481Y) into Mu3graR* either by selection with rifampin (Mu3graR*RP1-3) or vancomycin (Mu3graR*V6-36) or by gene replacement [Mu3graR*rpoB(H481Y)] prolonged the doubling time of Mu3graR* to almost the same degree (Table 3). The doubling-time-prolonging effect of the rpoB(H481Y) mutation was also observed with Mu3-derived mutant strains Mu3RP1-3 and Mu3rpoB(H481Y) (Table 3).

Table 3 shows that, actually, all the rpoB mutant strains used in this study had prolonged doubling times compared with those of their parent strains. However, the degree of prolongation was not associated with the degree of vancomycin resistance. For example, although rpoB(Q468R) caused an extremely prolonged doubling time (38.5 min versus 29.8 min for Mu3graR*), it did not increase vancomycin resistance appreciably (Table 3). This indicates that the rpoB mutation itself has a growth-delaying effect on the cell that is independent from its effect on vancomycin susceptibility. On the other hand, among the seven VISA strains without rpoB mutations, two strains had only marginal increases in doubling time (Mu3graR*V4-4 and V4-5) (Table 3), whereas they expressed high vancomycin resistance comparable to that of Mu50 (vancomycin MIC = 6 mg/liter). Therefore, rpoB mutation seemed to be directly associated with delayed cell growth. However, the prolonged doubling time itself was not sufficient for the expression of the VISA phenotype. It may not be a prerequisite condition for VISA phenotype expression, either.

The rpoB(H481Y) mutation thickens the cell wall of Mu3 and Mu3graR*.

Besides the prolonged doubling time, cell wall thickening has been considered a cardinal feature of the VISA phenotype (10, 11, 18, 31, 37). The cell wall thicknesses of Mu3 and its derivative strains were evaluated by using transmission electron microscopy. The mean cell wall thicknesses and standard deviations were as follows: Mu3, 27.40 ± 2.41 nm; Mu3graR*, 27.37 ± 3.09 nm; and Mu3graR*RP1-33, 30.67 ± 3.27 nm. As reported previously, introduction of the plasmid carrying the graR* gene into Mu3 brought about significant thickening of the cell wall (37.88 ± 11.31 nm) (34). In contrast, there was no increase in cell wall thickness caused by the introduction of a single copy of graR* in this study. Subsequent introduction of the rpoB(H481Y) mutation, however, significantly thickened the cell wall (from 27.37 to 30.67 nm). Although statistically nonsignificant, a slight increase in the cell wall thickness was also observed with Mu3RP1-3 (28.67 ± 2.53 nm) in comparison to that of Mu3. A small increase in vancomycin resistance observed with Mu3RP1-3 and Mu3rpoB(H481Y) may be correlated with the cell wall thickening effect of the rpoB(H481Y) mutation (Table 3).

DISCUSSION

VISA emerges from cell populations of hVISA, which, represented by Mu3 or Mu3graR*, has a characteristic vancomycin-resistant subpopulation profile, as illustrated in Fig. 1 (18, 19). hVISA is composed of the cell subpopulations with various degrees of vancomycin resistance (22). The high frequency (>10−6) of emergence of VISA from within hVISA cell populations has long been an enigma. The genetic basis for the VISA phenotype has been sought, and many candidate genes have been proposed, such as agr (40, 41), ccpA (43), graRS (23, 32), mgrA/sarA (44), mprF (35, 39), pbp4 (13), the σB gene (2, 42), trfAB (38), and walRK (24). It is noted that the genes, except for mprF (36) and pbp4, are reported to have regulatory functions. Thus, regulator mutation seems to be a feature of genetic alteration underlying the VISA phenotype (21). In addition to the list of regulator genes, we recently reported that the rpoB(A621E) mutation, which replaces the 621st amino acid, alanine (A), with glutamic acid (E) in the RNAP β subunit, conferred dual heteroresistance to daptomycin and vancomycin on a VSSA strain (9). In this study, we further demonstrated that 3 (30%) of 10 VISA strains independently established from the heterogeneous cell population of hVISA strain Mu3graR* possess rpoB mutations that do not accompany rifampin resistance. We also observed that the selection of hVISA with rifampin established rifampin-resistant rpoB mutant strains whose levels of vancomycin resistance were increased in various degrees, depending on the location of the mutations and the kinds of amino acid substitutions (Table 3). Based on these data, it is likely that the spontaneous occurrence of rpoB mutations with different abilities to increase vancomycin resistance constitutes the characteristic heterogeneous population curve of hVISA.

In our previous study, we observed that Mu3(pgraR*), the transformant of Mu3 with the plasmid pgraR*, expressed the VISA phenotype with a thickened cell wall and extremely prolonged growth rate (34). The reason why introduction of the graR* plasmid alone conferred the VISA phenotype on Mu3 in our previous study is not evident at the moment. However, our preliminary microarray analysis of Mu3(pgraR*) showed downregulated expression of ribosomal protein genes and increased expression of biosynthesis pathways for some amino acids (T. Hishinuma, unpublished observations). These data indicated that the strain was in a stringent-response-like status (12). The extremely slow growth rate observed for Mu3(pgraR*) is compatible with this hypothesis, since slow growth is one of the cardinal features of the stringent response. In fact, in Escherichia coli, rpoB mutations are reported to mimic the stringent response (48). Therefore, it is possible that the rpoB(H481Y) mutation helped the effect of the graR* mutation by triggering the stringent response.

This study demonstrated the promotional effect of rpoB mutation in the development of the VISA phenotype in the hVISA strain Mu3. This leads to the prediction that VISA clinical isolates, irrespective of their rifampin susceptibilities, would frequently carry rpoB mutations. We tested our collection of clinical VISA strains from various countries and found that this was the case: more than 70% of the VISA strains carried rpoB mutations (46). This study also showed that rifampin selection of hVISA strains frequently converts them to VISA. This implies that the combined use of rifampin and vancomycin in the treatment of MRSA may have to be reevaluated in view of the risk of facilitating MRSA to acquire vancomycin resistance.

VISA clinical strains tend to have reduced susceptibility to daptomycin (6, 33) and increased linezolid susceptibility (45). The results of this study indicate that rpoB mutation is directly involved in the linezolid susceptibility change in the VISA phenotype. With regard to daptomycin, different rpoB mutations had different degrees of effect. While rpoB(H481Y) did not increase the daptomycin MIC of Mu3graR* appreciably, rpoB(T480M) increased the daptomycin MIC significantly.

The rpoB mutation was also found to be involved in other features of the VISA phenotype, such as delayed growth and cell wall thickening. Although we do not know the exact mechanism of the effect of the rpoB mutation, it would be reasonable to assume that an rpoB mutation would change the transcriptional profile of the cell by producing an RNAP β subunit with altered preference for the genes to be transcribed. A different transcriptional profile would produce a different status of cell physiology with altered susceptibilities to various antibiotics. Extensive research would be needed to understand the effect of the rpoB mutation, an ultimate “regulatory mutation.”

ACKNOWLEDGMENTS

We thank Mitutaka Yoshida (Division of Ultrastructural Research, Juntendo University) for invaluable help in sample preparation and technical support of transmission electron microscopy.

This work was supported by a Grant-in-Aid (S0991013) from the Ministry of Education, Culture, Sports, Science &Technology Japan (MEXT) for the Foundation of Strategic Research Projects in Private Universities.

Footnotes

▿

Published ahead of print on 11 July 2011.

†

The authors have paid a fee to allow immediate free access to this article.

REFERENCES

  • 1. Bae T., Schneewind O. 2006. Allelic replacement in Staphylococcus aureus with inducible counter-selection. Plasmid 55:58–63 [DOI] [PubMed] [Google Scholar]
  • 2. Bischoff M., Berger-Bachi B. 2001. Teicoplanin stress-selected mutations increasing sigma(B) activity in Staphylococcus aureus. Antimicrob. Agents Chemother. 45:1714–1720 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Campbell E. A., et al. 2001. Structural mechanism for rifampicin inhibition of bacterial RNA polymerase. Cell 104:901–912 [DOI] [PubMed] [Google Scholar]
  • 4. Clinical and Laboratory Standards Institute 2009. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 8th ed., vol. 29, no. 2 Approved standard M07-A8. Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
  • 5. Cui L., et al. 2006. Novel mechanism of antibiotic resistance originating in vancomycin-intermediate Staphylococcus aureus. Antimicrob. Agents Chemother. 50:428–438 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Cui L., Tominaga E., Neoh H. M., Hiramatsu K. 2006. Correlation between reduced daptomycin susceptibility and vancomycin resistance in vancomycin-intermediate Staphylococcus aureus. Antimicrob. Agents Chemother. 50:1079–1082 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Cui L., Neoh H. M., Shoji M., Hiramatsu K. 2009. Contribution of vraSR and graSR point mutations to vancomycin resistance in vancomycin-intermediate Staphylococcus aureus. Antimicrob. Agents Chemother. 53:1231–1234 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Cui L., Lian J. Q., Neoh H. M., Reyes E., Hiramatsu K. 2005. DNA microarray-based identification of genes associated with glycopeptide resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 49:3404–3413 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Cui L., et al. 2010. An RpoB mutation confers dual heteroresistance to daptomycin and vancomycin in Staphylococcus aureus. Antimicrob. Agents Chemother. 54:5222–5233 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Cui L., et al. 2003. Cell wall thickening is a common feature of vancomycin resistance in Staphylococcus aureus. J. Clin. Microbiol. 41:5–14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Daum R. S., Gupta S., Sabbagh R., Milewski W. M. 1992. Characterization of Staphylococcus aureus isolates with decreased susceptibility to vancomycin and teicoplanin: isolation and purification of a constitutively produced protein associated with decreased susceptibility. J. Infect. Dis. 166:1066–1072 [DOI] [PubMed] [Google Scholar]
  • 12. Eymann C., Homuth G., Scharf C., Hecker M. 2002. Bacillus subtilis functional genomics: global characterization of the stringent response by proteome and transcriptome analysis. J. Bacteriol. 184:2500–2520 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Finan J. E., Archer G. L., Pucci M. J., Climo M. W. 2001. Role of penicillin-binding protein 4 in expression of vancomycin resistance among clinical isolates of oxacillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 45:3070–3075 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Gardete S., Wu S. W., Gill S., Tomasz A. 2006. Role of VraSR in antibiotic resistance and antibiotic-induced stress response in Staphylococcus aureus. Antimicrob. Agents Chemother. 50:3424–3434 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Hanaki H., et al. 1998. Activated cell-wall synthesis is associated with vancomycin resistance in methicillin-resistant Staphylococcus aureus clinical strains Mu3 and Mu50. J. Antimicrob. Chemother. 42:199–209 [DOI] [PubMed] [Google Scholar]
  • 16. Herbert S., et al. 2007. Molecular basis of resistance to muramidase and cationic antimicrobial peptide activity of lysozyme in staphylococci. PLoS Pathog. 3:e102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Hiramatsu K. 1998. Vancomycin resistance in staphylococci. Drug Resist. Updat. 1:135–150 [DOI] [PubMed] [Google Scholar]
  • 18. Hiramatsu K. 2001. Vancomycin-resistant Staphylococcus aureus: a new model of antibiotic resistance. Lancet Infect. Dis. 1:147–155 [DOI] [PubMed] [Google Scholar]
  • 19. Hiramatsu K., Hanaki H. 1998. Glycopeptide resistance in staphylococci. Curr. Opin. Infect. Dis. 11:653–658 [DOI] [PubMed] [Google Scholar]
  • 20. Hiramatsu K., et al. 1997. Methicillin-resistant Staphylococcus aureus clinical strain with reduced vancomycin susceptibility. J. Antimicrob. Chemother. 40:135–136 [DOI] [PubMed] [Google Scholar]
  • 21. Hiramatsu K., et al. 2002. New trends in Staphylococcus aureus infections: glycopeptide resistance in hospital and methicillin resistance in the community. Curr. Opin. Infect. Dis. 15:407–413 [DOI] [PubMed] [Google Scholar]
  • 22. Hiramatsu K., et al. 1997. Dissemination in Japanese hospitals of strains of Staphylococcus aureus heterogeneously resistant to vancomycin. Lancet 350:1670–1673 [DOI] [PubMed] [Google Scholar]
  • 23. Howden B. P., et al. 2008. Genomic analysis reveals a point mutation in the two-component sensor gene graS that leads to intermediate vancomycin resistance in clinical Staphylococcus aureus. Antimicrob. Agents Chemother. 52:3755–3762 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Jansen A., et al. 2007. Role of insertion elements and yycFG in the development of decreased susceptibility to vancomycin in Staphylococcus aureus. Int. J. Med. Microbiol. 297:205–215 [DOI] [PubMed] [Google Scholar]
  • 25. Katayama Y., Murakami-Kuroda H., Cui L., Hiramatsu K. 2009. Selection of heterogeneous vancomycin-intermediate Staphylococcus aureus by imipenem. Antimicrob. Agents Chemother. 53:3190–3196 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Kondo N., Kuwahara-Arai K., Kuroda-Murakami H., Tateda-Suzuki E., Hiramatsu K. 2001. Eagle-type methicillin resistance: new phenotype of high methicillin resistance under mec regulator gene control. Antimicrob. Agents Chemother. 45:815–824 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Kraus D., et al. 2008. The GraRS regulatory system controls Staphylococcus aureus susceptibility to antimicrobial host defenses. BMC Microbiol. 8:85. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Kuroda M., et al. 2003. Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus. Mol. Microbiol. 49:807–821 [DOI] [PubMed] [Google Scholar]
  • 29. Kuroda M., Kuwahara-Arai K., Hiramatsu K. 2000. Identification of the up- and down-regulated genes in vancomycin-resistant Staphylococcus aureus strains Mu3 and Mu50 by cDNA differential hybridization method. Biochem. Biophys. Res. Commun. 269:485–490 [DOI] [PubMed] [Google Scholar]
  • 30. Li M., et al. 2007. The antimicrobial peptide-sensing system aps of Staphylococcus aureus. Mol. Microbiol. 66:1136–1147 [DOI] [PubMed] [Google Scholar]
  • 31. McCallum N., et al. 2006. In vivo survival of teicoplanin-resistant Staphylococcus aureus and fitness cost of teicoplanin resistance. Antimicrob. Agents Chemother. 50:2352–2360 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Meehl M., Herbert S., Gotz F., Cheung A. 2007. Interaction of the GraRS two-component system with the VraFG ABC transporter to support vancomycin-intermediate resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 51:2679–2689 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Mwangi M. M., et al. 2007. Tracking the in vivo evolution of multidrug resistance in Staphylococcus aureus by whole-genome sequencing. Proc. Natl. Acad. Sci. U. S. A. 104:9451–9456 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Neoh H. M., et al. 2008. Mutated response regulator graR is responsible for phenotypic conversion of Staphylococcus aureus from heterogeneous vancomycin-intermediate resistance to vancomycin-intermediate resistance. Antimicrob. Agents Chemother. 52:45–53 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Nishi H., Komatsuzawa H., Fujiwara T., McCallum N., Sugai M. 2004. Reduced content of lysyl-phosphatidylglycerol in the cytoplasmic membrane affects susceptibility to moenomycin, as well as vancomycin, gentamicin, and antimicrobial peptides, in Staphylococcus aureus. Antimicrob. Agents Chemother. 48:4800–4807 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Peschel A., et al. 2001. Staphylococcus aureus resistance to human defensins and evasion of neutrophil killing via the novel virulence factor MprF is based on modification of membrane lipids with l-lysine. J. Exp. Med. 193:1067–1076 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Pfeltz R. F., et al. 2000. Characterization of passage-selected vancomycin-resistant Staphylococcus aureus strains of diverse parental backgrounds. Antimicrob. Agents Chemother. 44:294–303 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Renzoni A., et al. 2009. Identification by genomic and genetic analysis of two new genes playing a key role in intermediate glycopeptide resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 53:903–911 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Ruzin A., et al. 2003. Inactivation of mprF affects vancomycin susceptibility in Staphylococcus aureus. Biochim. Biophys. Acta 1621:117–121 [DOI] [PubMed] [Google Scholar]
  • 40. Sakoulas G., et al. 2002. Accessory gene regulator (agr) locus in geographically diverse Staphylococcus aureus isolates with reduced susceptibility to vancomycin. Antimicrob. Agents Chemother. 46:1492–1502 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Sakoulas G., et al. 2005. Reduced susceptibility of Staphylococcus aureus to vancomycin and platelet microbicidal protein correlates with defective autolysis and loss of accessory gene regulator (agr) function. Antimicrob. Agents Chemother. 49:2687–2692 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Schulthess B., et al. 2009. Functional characterization of the sigmaB-dependent yabJ-spoVG operon in Staphylococcus aureus: role in methicillin and glycopeptide resistance. Antimicrob. Agents Chemother. 53:1832–1839 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Seidl K., et al. 2006. Staphylococcus aureus CcpA affects virulence determinant production and antibiotic resistance. Antimicrob. Agents Chemother. 50:1183–1194 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Trotonda M. P., Xiong Y. Q., Memmi G., Bayer A. S., Cheung A. L. 2009. Role of mgrA and sarA in methicillin-resistant Staphylococcus aureus autolysis and resistance to cell wall-active antibiotics. J. Infect. Dis. 199:209–218 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Watanabe Y., Neoh H. M., Cui L., Hiramatsu K. 2008. Improved antimicrobial activity of linezolid against vancomycin-intermediate Staphylococcus aureus. Antimicrob. Agents Chemother. 52:4207–4208 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Watanabe Y., Cui L., Katayama Y., Kozue K., Hiramatsu K. 2011. Impact of rpoB mutations on reduced vancomycin susceptibility in Staphylococcus aureus. J. Clin. Microbiol. 49:2680–2684 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Wichelhaus T. A., Schafer V., Brade V., Boddinghaus B. 1999. Molecular characterization of rpoB mutations conferring cross-resistance to rifamycins on methicillin-resistant Staphylococcus aureus. Antimicrob. Agents Chemother. 43:2813–2816 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Zhou Y. N., Jin D. J. 1998. The rpoB mutants destabilizing initiation complexes at stringently controlled promoters behave like “stringent” RNA polymerases in Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 95:2908–2913 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES