Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2011 Sep;79(9):3659–3664. doi: 10.1128/IAI.01351-10

Role for the Burkholderia pseudomallei Type Three Secretion System Cluster 1 bpscN Gene in Virulence ▿

Tanya D'Cruze 1,3, Lan Gong 1,3, Puthayalai Treerat 2,3, Georg Ramm 1, John D Boyce 2,3, Mark Prescott 1, Ben Adler 2,3,*, Rodney J Devenish 1,3
Editor: J B Bliska
PMCID: PMC3165474  PMID: 21768285

Abstract

Burkholderia pseudomallei, the causal agent of melioidosis, employs a number of virulence factors during its infection of mammalian cells. One such factor is the type three secretion system (TTSS), which is proposed to mediate the transport and secretion of bacterial effector molecules directly into host cells. The B. pseudomallei genome contains three TTSS gene clusters (designated TTSS1, TTSS2, and TTSS3). Previous research has indicated that neither TTSS1 nor TTSS2 is involved in B. pseudomallei virulence in a hamster infection model. We have characterized a B. pseudomallei mutant lacking expression of the predicted TTSS1 ATPase encoded by bpscN. This mutant was significantly attenuated for virulence in a respiratory melioidosis mouse model of infection. In addition, analyses in vitro showed diminished survival and replication in RAW264.7 cells and an increased level of colocalization with the autophagy marker protein LC3 but an unhindered ability to escape from phagosomes. Taken together, these data provide evidence that the TTSS1 bpscN gene product plays an important role in the intracellular survival of B. pseudomallei and the pathogenesis of murine infection.

INTRODUCTION

Burkholderia pseudomallei, the causal agent of melioidosis, is endemic in southeastern Asia and northern Australia (3), with recently diagnosed sporadic cases in southeastern Africa (1), the Americas, New Caledonia, and Mauritius (4). B. pseudomallei infection can present with acute or chronic clinical manifestations, including septic shock, pulmonary infections, benign pulmonitis, pneumonia (21), prostatic abscesses, cerebral abscesses, meningoencephalitis, encephalomyelitis, suppurative parotitis, and conjunctival ulcers (10).

Several B. pseudomallei virulence factors have been identified, including the capsule, pili, flagella, lipopolysaccharide, quorum-sensing molecules, and type six and type three secretory systems (6). The type three secretion system (TTSS) is one of six types of secretion systems identified in bacteria and mediates the secretion of effector molecules directly into host cells (24). Structurally, TTSS consist of a membrane-spanning needle which employs hydrophilic and hydrophobic translocators to deliver bacterial effectors directly into the host cell cytoplasm (16). The current view is that the hydrophilic translocators assist the integration of the hydrophobic translocators into the host cell membrane, forming a pore complex (16). It is hypothesized that the initial contact of the needle tip with the host cell membrane triggers the TTSS to secrete effector molecules (16). B. pseudomallei has been shown to assemble a syringe-like TTSS structure, which is proposed to inject critical virulence effectors into the host cell cytoplasm (17).

B. pseudomallei has three TTSS gene clusters (designated TTSS1, TTSS2, and TTSS3), and each of these clusters is present on the small chromosome (20). The TTSS1 gene cluster, which was first reported in 1999 by Winstanley et al. (25), shows homology to a TTSS in the plant pathogen Ralstonia solanacearum but is absent from the related Burkholderia species B. mallei and B. thailandensis (24). In contrast, TTSS2, while showing homology to a TTSS present in R. solanacearum, is also present in B. mallei and B. thailandensis (24). TTSS3 shows homology to a TTSS found in Salmonella enterica serovar Typhimurium, Shigella flexneri (21), B. mallei, and B. thailandensis. The TTSS1 and TTSS2 loci encode 16 to 18 proteins, the functions of which remain mostly uncharacterized. Previous work has shown that TTSS1 and TTSS2 are not involved in B. pseudomallei virulence in a hamster infection model (23).

In this paper, we report the construction and characterization of a B. pseudomallei mutant lacking expression of the predicted TTSS1 ATPase (bpscN, BPSS1394). The hydrolysis of ATP by TTSS-associated ATPases is the key energizer of the TTSS (5, 12). It has been proposed that TTSS ATPases form ring structures associated with the secretion apparatus at the inner bacterial membrane. ATP hydrolysis functions to drive TTSS function by promoting the initial docking of TTSS substrates to the secretion apparatus, unfolding effector proteins prior to secretion, and releasing effectors from their cognate chaperones (12). Here we show that the bpscN mutant is attenuated for virulence in a mouse model of infection. Furthermore, additional studies using cultured RAW264.7 macrophage-like cells show that while mutant bacteria are able to escape from phagosomes, they show diminished survival and replication in RAW264.7 cells and show increased levels of colocalization with the autophagy marker protein LC3. Collectively, our data provide strong evidence that the TTSS1 bpscN gene plays an important role in B. pseudomallei pathogenesis.

MATERIALS AND METHODS

Bacterial strains and vectors.

The Escherichia coli K-12 DH5α strain (Bethesda Research Laboratories, Rockville, MD) was used primarily for propagation of the pBluescriptKS phagemid (Stratagene, La Jolla, CA) (Table 1) and its derivatives. The E. coli K-12 SM10λpir strain (15) was used as the donor strain to allow mobilization of the λpir-dependent plasmid pDM4 (14) (Table 1) into B. pseudomallei strain K96243 (9).

Table 1.

Strains and plasmids used in this study

Strain or plasmid Description Reference
B. pseudomallei strains
    K96243 Virulent Thai clinical isolate 9
    K96243ΔbpscN::tetA(C) bpscN deletion mutant, Tetr This study
    K96243ΔbpscN::tetA(C)/pBHR1 bpscN deletion mutant, Tetr, containing the original pBHR1 plasmid This study
    K96243ΔbpscN::tetA(C)/pBHR1comp bpscN deletion mutant, Tetr, containing the pBHR1 plasmid with the inserted bpscN complementation construct This study
E. coli strains
    K-12 DH5α For propagation of pBluescriptKS phagemid; F− φ80dlacZΔM15 Δ(lacZYA-argF)U169deoRrecA1endA1hsdR17(rK− mK+) phoAsupE44 λ−thi-1gyrA96relA1 13
    K-12 SM10λpir For propagation of λpir-dependent plasmid pDM4; thi-1thrleutonAlacYsupErecA::RP4-2-Tc::Mu Kmr λ′ 15
    S17-1λpir Tpr SmrrecAthiprohsdR-M+RP4-2-Tc:Mu:Km Tn7 λpir 19
Plasmids
    pBluescriptKS phagemid lacZrep pMB1 Ampr 18
    pBluescript::bpscN::tetA(C) pBluescriptKS phagemid vector containing the bpscN mutagenesis construct This study
    pDM4 λpir dependent, Cmr, sacBR negative selection 15
    pDM4::bpscN::tetA(C) pDM4 vector containing the bpscN mutagenesis construct This study
    pBHR1 mob, rep, Cmr, Kanr 22
    pBHR1comp pBHR1 plasmid containing the bpscN complementation construct This study

Construction of a B. pseudomallei bpscN mutant.

The bpscN deletion mutant was constructed by double-crossover allelic exchange. Primers bpscN-U5′ and bpscN-U3′ (Table 2) were used to amplify a 1,203-bp fragment spanning 972 bp upstream of the bpscN coding sequence plus 231 bp of the 5′ coding sequence flanked by XbaI and BglII restriction sites. Primers bpscN-D5′ (containing a BglII site) and bpscN-D3′ (containing an XbaI site) were used to amplify a 981-bp fragment spanning 105 bp of the 3′ end of the coding sequence and 876 bp of downstream sequence flanked by BglII and XbaI restriction sites. These two fragments, together with the BglII-digested tetracycline tetA(C) gene cassette, were introduced by three-way ligation into the pBluescriptKS phagemid. The resulting plasmid was digested with XbaI, and the bpscN mutagenesis cassette was recovered and ligated into XbaI-digested pDM4. This construct was then introduced by transformation into E. coli SM10 λpir. For mobilization into B. pseudomallei, overnight cultures of E. coli and B. pseudomallei were subcultured, grown to mid-log phase, spotted together onto Luria-Bertani (LB) agar plates, and grown overnight at 37°C. Transconjugants were subsequently selected on LB agar containing tetracycline (25 μg/ml) and gentamicin (64 μg/ml). Transconjugants were screened for chloramphenicol sensitivity (40 μg/ml), and mutants were confirmed by PCR using primers specific for the tetA(C) gene (Tet-5424, Table 2) and sequences upstream and flanking the mutagenesis site (bpscN-D3′O, Table 2). The identity of the PCR product was confirmed by DNA sequencing.

Table 2.

Primers used in this study

Primer Sequence 5′→3′ Description
bpscN-U5′ TGCGGCTCTAGACGCGGACCGCGAC Forward primer upstream of bpscN; specifying an XbaI site
bpscN-U3′ CGCCACAGATCTATCACGCGTGAAACCGAC Reverse primer upstream of bpscN; specifying a BglII site
bpscN-D5′ GACGAGAGATCTGCGAAGGCCGACGCGATTC Forward primer downstream of bpscN; specifying a BglII site
bpscN-D3′ ACGATCTCTAGAGTGCCGTGCAGCGTC Reverse primer downstream of bpscN; specifying an XbaI site
tet-5424 GCTGTCGGAATGGACGATAT Forward primer at 3′ end of tetA(C)
bpscN-D3′O TACCGAGGACGACGCCGATC Reverse primer downstream of bpscN and outside the region used to make the mutagenesis construct
cbpscN-5′ CGC GGG TTT AAA GGC ATG AGC GCG G Forward primer for complementation of bpscN; specifying a DraI site
cbpscN-3′ TCA CCA TGG GTT CGC CCC GCT CAA C Reverse primer for complementation of bpscN; specifying an NcoI site

Complementation of a B. pseudomallei bpscN mutant.

The bpscN complementation construct was generated using primers cbpscN-5′ and cbpscN-3′ (Table 2) to amplify a 1,374-bp fragment, spanning the entire bpscN coding region from B. pseudomallei K96243. The fragment was digested with DraI and NcoI and ligated into the pBHR1 plasmid (23), which was kindly provided by J Warawa (University of Louisville, Louisville, KY). The resulting pBHR1comp plasmid was introduced into E. coli S17-1 and subsequently conjugated into the bpscN mutant B. pseudomallei strain.

Mouse relative in vivo growth assays.

Relative in vivo growth assays were carried out with BALB/c mice. Overnight cultures of wild-type B. pseudomallei and the bpscN mutant, grown in LB supplemented with appropriate antibiotics, were subcultured for 90 min to an optical density at 600 nm (OD600) of 0.2. For in vitro growth analysis, the cultures were combined, a 10-μl aliquot of an appropriate dilution (containing 4 × 104 CFU and designated the input culture) was inoculated into LB broth and grown for 18 h at 37°C with shaking (200 rpm), and an appropriate volume of a serial dilution was spread onto LB agar plates. For in vivo growth analysis, groups of five 6- to 8-week-old female BALB/c mice were infected intranasally with 20 μl of the same input culture. After 24 h, mice were euthanized in accordance with animal ethics requirements, their spleens were removed and homogenized in phosphate-buffered saline (PBS), and the homogenate was spread onto LB agar plates. After incubation at 37°C for 24 h, 100 colonies from each experimental set of plates (bacteria recovered in vitro and in vivo) were patched onto LB agar and LB agar with tetracycline (25 μg/ml) to identify the proportions of wild-type and bpscN mutant bacteria. The relative competitive index (rCI) was determined by dividing the number of tetracycline-resistant bacteria derived from the in vivo growth assay by the number of tetracycline-resistant bacteria derived from the in vitro growth assay (8). The statistical significance of a reduced rCI was determined using a one-sided z test as described previously (8).

Mouse virulence assays.

Wild-type or mutant B. pseudomallei bacteria were subcultured in fresh medium with appropriate antibiotics and grown for 4 h to mid-log phase, to an OD600 of 0.8 (corresponding to 5 × 108 CFu/ml). Groups of seven 6- to 8-week-old, female BALB/c mice were infected intranasally with 20 μl of wild-type or mutant bacteria at a dose of 2 × 107 or 2 × 105 CFU. Mice were observed for 10 days and euthanized if moribund, in accordance with animal ethics requirements. Survival data were displayed as Kaplan-Meier curves, the difference in overall survival was assessed using Fisher's exact test, and the difference in time to death was analyzed using the log-rank Mantel-Cox test.

Survival and replication of B. pseudomallei in RAW 264.7 cells.

The ability of wild-type and bpscN mutant bacteria to survive and replicate intracellularly was investigated in the mouse macrophage-like cell line RAW 264.7 (2). Cells were maintained in RPMI 1640 medium supplemented with 10% (vol/vol) heat-inactivated fetal calf serum (Invitrogen, Carlsbad, CA) at 37°C with 5% CO2. At 15 h prior to B. pseudomallei infection, cells were seeded at 1.0 × 105/well into 24-well trays.

B. pseudomallei strains were grown overnight in LB medium containing appropriate antibiotics and subcultured for 3 h to reach mid-log phase. RAW 264.7 macrophage-like cells were infected for 1 h at a multiplicity of infection (MOI) of 6. At 1 h postinfection (p.i.), cells were washed with PBS, pH 7.2, and replenished with fresh RPMI containing 100 μg/ml ceftazidime and 800 μg/ml kanamycin to kill extracellular bacteria. At 2 h, 4 h, and 6 h p.i., wells were washed to remove extracellular bacteria and lysed with 0.1% (vol/vol) Triton X-100 for 10 min. An aliquot of the bacterial lysate was plated on LB agar and grown at 37°C for 2 days, and CFU were enumerated.

Transmission electron microscopy (TEM).

RAW264.7 cells were infected with wild-type or mutant B. pseudomallei strains at an MOI of 6. At 2, 4, and 6 h p.i., cells were fixed for 2 h with 2.5% glutaraldehyde in 0.1 M cacodylate buffer, pH 7.2. At this time, cells were harvested and postfixed for an additional 1 h in 1% (wt/vol) osmium tetroxide, followed by 1 h in 2% (wt/vol) uranyl acetate. Samples were then dehydrated, embedded in Epon resin, sliced into 70-nm sections, and stained with lead citrate and uranyl acetate. Images were obtained using a Hitachi H-7500 transmission electron microscope. A minimum of 150 cross sections was imaged in each experiment, and bacteria were scored according to the presence and number of visible membranes in which they were encapsulated.

Fluorescence microscopy.

Strains were grown overnight in LB broth supplemented with appropriate antibiotics and subcultured to mid-log phase. RAW264.7 cells stably transfected with LC3-GFP (green fluorescent protein) (2) were infected with B. pseudomallei for 1 h in 24-well trays containing coverslips, at an MOI of 6. Wells were then washed with PBS and replenished with fresh RPMI containing ceftazidime (100 μg/ml) and kanamycin (800 μg/ml) to kill extracellular bacteria. At 2 h, 4 h, and 6 h p.i., the cells were fixed with methanol for 10 min, washed with PBS, and incubated with rabbit antiserum against B. pseudomallei (2) at a dilution of 1:100 for 1 h. Following washes, the cells were further incubated with goat anti-rabbit IgG Texas Red antiserum (Molecular Probes, Eugene, OR) at a 1:250 dilution for a further 1 h. Internalized B. pseudomallei and cytoplasmic LC3 were visualized with an Olympus FV-500 confocal laser scanning microscope by using the fluorescein isothiocyanate and tetramethyl rhodamine isothiocyanate channels to monitor green and red fluorescence emissions, respectively. The images were scored for the numbers of bacteria within RAW 264.7 cells and colocalized with LC3-GFP.

RESULTS

The bpscN mutant is highly attenuated for virulence in BALB/c mice.

In order to investigate the role of TTSS1 in B. pseudomallei virulence, we constructed, in the K96243 background, a bpscN (the predicted TTSS1 ATPase) mutant strain. Reverse transcription-PCR performed on RNA isolated from bpscN mutant bacteria successfully led to the amplification of transcripts of the downstream gene BPSS1393 (data not shown), indicating that no polarity effects arose due to the tetA(C) insertion in bpscN. To determine the ability of the mutant to grow in vivo, relative growth assays were carried out with 6- to 8-week-old BALB/c mice coinfected with wild-type and mutant B. pseudomallei bacteria. In three independent experiments, the rCI of the bpscN mutant was determined to be 0.00, 0.00, and 0.06, respectively, indicating a highly reduced growth rate in vivo (P < 0.001).

The bpscN mutant was then tested for virulence in BALB/c mice, which were challenged intranasally with wild-type or mutant bacteria at a dose of 2 × 107 or 2 × 105 CFU and monitored for 10 days (Fig. 1). All mice infected with 2 × 105 CFU of the wild-type strain showed signs of acute illness within 24 h and were euthanized by 78 h. Similarly, mice infected with 2 × 107 CFU of the wild-type strain were moribund at 24 h and were euthanized by 54 h. However, all of the mice infected with either the large or the small dose of the mutant strain showed no signs of disease for the 10 days of the trial (Fig. 1). Therefore, the bpscN deletion mutant is highly attenuated for virulence in BALB/c mice.

Fig. 1.

Fig. 1.

Kaplan-Meier survival curves for mice infected with either 2 × 107 CFU (A) or 2 × 105 CFU (B) of wild-type or bpscN mutant B. pseudomallei.

To confirm the in vivo results, we constructed a second, independent bpscN deletion mutant; this mutant had rCI values of 0.09, 0.02, and 0.09 and was also attenuated for virulence in BALB/c mice (data not shown). Bacteria recovered from the spleens of mice infected with the second bpscN mutant were tested by PCR and confirmed as retaining the mutation.

The bpscN mutant has diminished survival and replicative capacity in RAW264.7 cells.

As the bpscN mutant was highly attenuated for virulence in BALB/c mice, we hypothesized that mutant bacteria have an increased susceptibility to killing by macrophages. In order to address this hypothesis, we infected murine macrophage-like RAW264.7 cells with wild-type bacteria, mutant bacteria, mutant bacteria harboring the empty pBHR1 vector, or mutant bacteria harboring the bpscN complementation construct. There was no difference in the growth rate in LB broth among any of the four strains (data not shown).

Wild-type bacteria were able to survive and multiply in macrophages over the 6 h of the experiment, as observed previously (2). However, compared with wild-type bacteria, bpscN mutant bacteria and bpscN mutant bacteria harboring the empty pBHR1 vector showed a statistically significant decrease in the number of intracellular bacteria at 4 h (P < 0.001) and at 6 h (P < 0.001) p.i (Fig. 2). The mutant complemented with an intact copy of bpscN showed a statistically significant increase in the number of intracellular bacteria at 4 h and 6 h p.i (P < 0.001) compared to the bpscN mutant (Fig. 2).

Fig. 2.

Fig. 2.

Bacterial survival and replication within RAW264.7 macrophage-like cells infected at an MOI of 6 with wild-type B. pseudomallei, the bpscN mutant, the bpscN mutant expressing the empty pBHR1 plasmid, or the bpscN mutant complemented (comp) with an intact bpscN gene. Error bars indicate the standard error of the mean of nine biological replicates. *, P < 0.05; **, P < 0.001.

The bpscN mutant is able to escape from phagosomes.

As the bpscN mutant showed a reduced ability to survive and replicate in RAW 264.7 cells, we investigated whether this outcome resulted from a reduced ability of the mutant to escape from phagosomes. We first used TEM to determine the location of intracellular bacteria at different times after infection. Thin sections of infected macrophage cells were scored for the presence of bacteria and whether they existed free in the cytoplasm or were confined within single membrane compartments (phagosomes). At 2 h p.i., 84% of the wild-type and 66% of the mutant bacteria were found in single membrane compartments, with the remainder free in the cytosol. At 4 h and 6 h p.i., the number of bacteria within single membrane compartments decreased, while the number of bacteria free in the cytosol increased. Thus, at 6 h p.i., 75% and 91% of the wild-type and mutant bacteria, respectively, were found free in the cytosol (Fig. 3). Therefore, bpscN mutant bacteria are able to escape from the phagosome at levels similar to those of the wild-type strain. Notably, only a single multiple-membrane structure (encapsulating the bpscN mutant) predicted to be an autophagosome was observed across all of the samples analyzed.

Fig. 3.

Fig. 3.

TEM analysis of the intracellular locations of wild-type and bpscN mutant B. pseudomallei bacteria in infected RAW264.7 macrophage-like cells. Bacteria were scored as free in the cytoplasm or encapsulated in a single membrane. At least 100 bacteria were scored for both strains in triplicate experiments. Error bars represent the standard error of the mean of biological triplicates.

The bpscN mutant shows increased colocalization with LC3-GFP.

To complement the findings of TEM analysis and in view of our recent observations that the TTSS3 genes bopA and bipD are critical for escape from LC3-associated phagocytosis (7), we analyzed the colocalization of wild-type and bpscN mutant bacteria with LC3-GFP. LC3 has been an accepted marker of autophagy; however, our recent data suggest that LC3 is recruited directly to phagosomal membranes, where it contributes to phagosomal maturation and increased bacterial killing (7). At all of the time points measured, the bpscN mutant showed an approximately 2-fold increase in colocalization with LC3 compared to that of the wild-type strain (Fig. 4B). This difference was statistically significant at both 4 h and 6 h p.i. (P < 0.01).

Fig. 4.

Fig. 4.

Colocalization of wild-type and bpscN mutant bacteria with LC3-GFP. RAW264.7 macrophage-like cells stably expressing LC3-GFP were infected with wild-type or bpscN mutant B. pseudomallei bacteria and viewed at 2, 4, and 6 h p.i. (A) Bacterial colocalization with LC3-GFP was defined by the presence of labeled bacteria (red) (yellow fluorescence) which were fully overlaid by intense green or fully contained within a green ring. Scale bars, 5 μm. (B) Quantitative analysis of bacterial colocalization with LC3-GFP. The experiment was performed in biological triplicates, and data are presented as the mean ± the standard error of the mean. *, P < 0.01.

DISCUSSION

The TTSS1 gene bpscN (23) encodes a protein with 63.5% amino acid identity to R. solanacearum HrcN, which is a predicted TTSS-associated ATPase (17). TTSS ATPases are predicted to facilitate the initial docking of the TTSS substrates to the secretion apparatus and through ATP hydrolysis provide the proton motive force for subsequent expulsion of these proteins through the TTSS (12). In the plant pathogen Xanthomonas campestris pv. vesicatoria, HrcN has 31% amino acid identity to the bacterial F0F1 ATPase β subunit. HrcN is proposed to drive ATP binding and hydrolysis and therefore would be involved in the translocation and secretion of effector TTSS proteins (12). B. pseudomallei TTSS1 mutant strains are significantly less virulent in the infection of tomatoes, suggesting a potential role for B. pseudomallei TTSS1 in pathogenesis and virulence in plants (11). In contrast, Warawa and Woods (23) had earlier reported that TTSS1 and TTSS2 were not involved in the virulence of B. pseudomallei in hamsters. Hence, we aimed to clarify the importance of B. pseudomallei TTSS1 for pathogenesis in mammals using the well-characterized BALB/c mouse melioidosis model.

Given the requirement of the ATPase as an energizer of the TTSS secretion process, we generated a bpscN deletion mutant in the expectation that loss of ATPase function would result in specific loss of TTSS1 function. The bpscN mutant showed a growth rate in vitro in LB medium equivalent to that of wild type bacteria (data not shown) but significantly reduced growth relative to that of the wild type in vivo. Furthermore, the bpscN mutant showed significantly reduced virulence in the BALB/c melioidosis model. All of the mice infected with the mutant strain remained healthy for the duration of the experiment (P < 0.0001). Thus, we conclude that bpscN plays an important role in the virulence of B. pseudomallei and that the reduction in virulence is not due to diminished growth rate of the mutant per se. On this basis, we determined the importance of bpscN for the intracellular survival of B. pseudomallei.

The intracellular survival and replication of bpscN mutant bacteria in RAW 264.7 macrophage-like cells were decreased significantly at 2 h, 4 h, and 6 h p.i. Indeed, at 6 h p.i., the reduction in intracellular survival was 46-fold. This finding suggests that effectors of TTSS1 are critical for intracellular survival and replication. Following complementation with an intact copy of bpscN in multicopy plasmid pBHR1, intracellular survival and replication were restored to approximately 50% of wild-type levels, confirming that bpscN is important for intracellular survival. The exact reason for the lack of complete restoration of intracellular replication is unknown, but it may be due to gene dosage effects resulting in the overproduction of the ATPase relative to other components of the TTSS1 apparatus. Next, we analyzed at what stage of macrophage infection the bpscN mutant strain was susceptible to increased killing. To determine the intracellular location of wild-type and mutant bacteria, we performed TEM, which showed that both wild-type and mutant bacteria were either free in the macrophage cytosol or encapsulated in single-membrane phagosomes. A high proportion of both mutant and wild-type bacteria was found within phagosomes at 2 h p.i., but this number decreased at 4 h and 6 h; there was a concomitant increase in bacteria free in the cytosol at these times. There was no statistically significant difference in the extent of phagosomal escape of mutant compared with wild-type bacteria over time. Analysis of the ability of both strains to form actin tails revealed that both wild-type and bpscN mutant bacteria were able to polymerize actin at 6 h p.i. (data not shown). This observation provides supporting evidence that both strains are able to escape from the phagosomes into the cytosol and subsequently initiate actin polymerization. Therefore, TTSS1 does not appear to be involved in phagosome escape, consistent with previous data showing that this role is mediated by TTSS3 effectors (2).

Given the similar levels of phagosomal escape observed for mutant and wild-type bacteria, we analyzed whether mutant bacteria may be killed more efficiently in the phagosomes. We have recently shown that LC3 recruitment to phagosomes stimulates bacterial killing (7). The bpscN mutant bacteria showed an increased level of colocalization with LC3, consistent with the mutant bacteria being more susceptible to LC3-associated phagocytosis and therefore having increased susceptibility to intracellular killing. These data are consistent with a role for TTSS1 in subverting normal phagosomal maturation, possibly by slowing the recruitment of LC3. As TEM analysis identified only a single bacterium enclosed within a multimembrane structure, the bpscN mutant is not susceptible to canonical autophagy (the encapsulation of cytoplasmic bacteria by a double-membrane autophagosome), in agreement with recent finding that TTSS3 mutants are not susceptible to autophagy (6).

In conclusion, we have shown that the TTSS1 gene bpscN is involved in the infectivity and pathogenicity of B. pseudomallei in mice. Our results differ from those reported by Warawa and Woods (23), who showed that the TTSS1 and TTSS2 clusters are not critically required for B. pseudomallei virulence in the hamster model. Thus, it appears that there may be differences in the gene complements required for virulence in these two animal models. Moreover, we cannot exclude the possibility that survival and replication may differ in other cell types, such as epithelial cells or fibroblasts. Given the importance of the bpscN gene in mouse infection, it is likely that secreted TTSS1 effectors are required for infection and virulence. Further research on elucidating the role of the TTSS1 effectors and potentially TTSS2 in pathogenesis is therefore warranted.

ACKNOWLEDGMENTS

This research was supported by the Australian Research Council and the National Health and Medical Research Council, Australia.

Footnotes

▿

Published ahead of print on 18 July 2011.

REFERENCES

  • 1. Borgherini G., et al. 2006. Melioidosis: an imported case from Madagascar. J. Travel Med. 13:318–320 [DOI] [PubMed] [Google Scholar]
  • 2. Cullinane M., et al. 2008. Stimulation of autophagy suppresses the intracellular survival of Burkholderia pseudomallei in mammalian cell lines. Autophagy 4:744–753 [DOI] [PubMed] [Google Scholar]
  • 3. Currie B. J. 2008. Advances and remaining uncertainties in the epidemiology of Burkholderia pseudomallei and melioidosis. Trans. R. Soc. Trop. Med. Hyg. 102:225–227 [DOI] [PubMed] [Google Scholar]
  • 4. Currie B. J., Dance D. A. B., Cheng A. C. 2008. The global distribution of Burkholderia pseudomallei and melioidosis: an update. Trans. R. Soc. Trop. Med. Hyg. 102(Suppl. 1):S1–S4 [DOI] [PubMed] [Google Scholar]
  • 5. Galán J. E., Collmer A. 1999. Type III secretion machines: bacterial devices for protein delivery into host cells. Science 284:1322–1328 [DOI] [PubMed] [Google Scholar]
  • 6. Galyov E. E., Brett P. J., DeShazer D. 2010. Molecular insights into Burkholderia pseudomallei and Burkholderia mallei Pathogenesis. Annu. Rev. Microbiol. 64:495–517 [DOI] [PubMed] [Google Scholar]
  • 7. Gong L., et al. 2011. The Burkholderia pseudomallei type III secretion system and BopA are required for evasion of LC3-associated phagocytosis. PLoS One 6:e17852. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Harper M., Cox A. D., St. Michael F., Wilkie I. W., Boyce J. D., Adler B. 2004. A heptosyltransferase mutant of Pasteurella multocida produces a truncated lipopolysaccharide structure and is attenuated in virulence. Infect. Immun. 72:3436–3443 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Holden M. T. G., et al. 2004. Genomic plasticity of the causative agent of melioidosis, Burkholderia pseudomallei. Proc. Natl. Acad. Sci. U. S. A. 101:14240–14245 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Inglis T. J., Rolim D. B., Rodriguez J. L. 2006. Clinical guideline for diagnosis and management of melioidosis. Rev. Inst. Med. Trop. Sao Paulo 48:1–4 [DOI] [PubMed] [Google Scholar]
  • 11. Lee Y., Chen Y., Ouyang X., Gan Y.-H. 2010. Identification of tomato plant as a novel host model for Burkholderia pseudomallei. BMC Microbiol. 10:28. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Lorenz C., Buttner D. 2009. Functional characterization of the type III secretion ATPase HrcN from the plant pathogen Xanthomonas campestris pv. vesicatoria. J. Bacteriol. 191:1414–1428 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Mason C. A., Bailey J. E. 1989. Effects of plasmid presence on growth and enzyme activity of Escherichia coli DH5α. Appl. Microbiol. Biotechnol. 32:54–60 [Google Scholar]
  • 14. Milton D., O'Toole R., Horstedt P., Wolf-Watz H. 1996. Flagellin A is essential for the virulence of Vibrio anguillarum. J. Bacteriol. 178:1310–1319 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Milton D. L., Norqvist A., Wolf-Watz H. 1992. Cloning of a metalloprotease gene involved in the virulence mechanism of Vibrio anguillarum. J. Bacteriol. 174:7235–7244 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Mueller C. A., Broz P., Cornelis G. R. 2008. The type III secretion system tip complex and translocon. Mol. Microbiol. 68:1085–1095 [DOI] [PubMed] [Google Scholar]
  • 17. Rainbow L., Hart A., Winstanley C. 2002. Distribution of type III secretion gene clusters in Burkholderia pseudomallei, B. thailandensis and B. mallei. J. Med. Microbiol. 51:374–384 [DOI] [PubMed] [Google Scholar]
  • 18. Short J. M., Fernandez J. M., Sorge J. A., Huse W. D. 1988. Lambda ZAP: a bacteriophage lambda expression vector with in vivo excision properties. Nucleic Acids Res. 16:7583–7600 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Simon R., Priefer U., Pühler A. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Nat. Biotech. 1:784–791 [Google Scholar]
  • 20. Sun G. W., Gan Y.-H. 2010. Unraveling type III secretion systems in the highly versatile Burkholderia pseudomallei. Trends Microbiol. 18:561–568 [DOI] [PubMed] [Google Scholar]
  • 21. Sun G. W., Lu J., Pervaiz S., Cao W. P., Gan Y.-H. 2005. Caspase-1 dependent macrophage death induced by Burkholderia pseudomallei. Cell. Microbiol. 7:1447–1458 [DOI] [PubMed] [Google Scholar]
  • 22. Szpirer C. Y., Faelen M., Couturier M. 2001. Mobilization function of the pBHR1 plasmid, a derivative of the broad-host-range plasmid pBHR1. J. Bacteriol. 183:2101–2110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Warawa J., Woods D. E. 2005. Type III secretion system cluster 3 is required for maximal virulence of Burkholderia pseudomallei in a hamster infection model. FEMS Microbiol. Lett. 242:101–108 [DOI] [PubMed] [Google Scholar]
  • 24. Wiersinga W. J., van der Poll T., White N., Day N., Peacock S. 2006. Melioidosis: insights into the pathogenicity of Burkholderia pseudomallei. Nat. Rev. Microbiol. 4:272–280 [DOI] [PubMed] [Google Scholar]
  • 25. Winstanley C., Hales B. A., Hart C. A. 1999. Evidence for the presence in Burkholderia pseudomallei of a type III secretion system-associated gene cluster. J. Med. Microbiol. 48:649–656 [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES