Abstract
A theoretical inverse relationship has long been postulated for osteogenic and adipogenic differentiation (bone versus adipose tissue differentiation). This inverse relationship in theory at least partially underlies the clinical entity of osteoporosis, in which marrow mesenchymal stem cells (MSCs) have a predilection for adipose differentiation that increases with age. In the present study, we assayed the potential anti-adipogenic effects of Nell-1 protein (an osteoinductive molecule). Using 3T3-L1 (a human preadipocyte cell line) cells and human adipose-derived stromal cells (ASCs), we observed that adenoviral delivered (Ad)-Nell-1 or recombinant NELL-1 protein significantly reduced adipose differentiation across all markers examined (Oil red O staining, adipogenic gene expression [Pparg, Lpl, Ap2]). In a prospective fashion, Hedgehog signaling was assayed as potentially downstream of Nell-1 signaling in regulating osteogenic over adipogenic differentiation. In comparison to Ad-LacZ control, Ad-Nell-1 increased expression of hedgehog signaling markers (Ihh, Gli1, Ptc1). These studies suggest that Nell-1 is a potent anti-adipogenic agent. Moreover, Nell-1 signaling may inhibit adipogenic differentiation via a Hedgehog dependent mechanism.
Keywords: Nell-1, osteogenic differentiation, adipogenic differentiation, Sonic Hedgehog, Indian Hedgehog
Introduction
Numerous studies have proposed an inverse relationship between the differentiation of multipotent mesenchymal stem cells (MSCs) toward osteoblastic and adipocytic cell fates [1,2,3,4]. A number of signaling cascades have been implicated in this cell fate decision, including bone morphogenetic protein (BMP), Hedgehog, and Wnt (Wingless Protein) signaling, to name only a few [5,6,7,8,9,10]. In cases such as Hedgehog and Canonical (or β-catenin dependent) Wnt Signaling, a general enhancement of osteogenic over adipocytic differentiation has been repeatedly observed – or a ‘shift’ in lineage differentiation [8,9,10,11,12,13,14]. Thus, such concepts as ‘loss of bone is a gain in fat’ is a commonly held conception [1].
The growth factor Nell-1 has long been recognized to have osteoinductive properties. Nell-1 was first discovered as overexpressed in prematurely fusing (ossifying) calvarial sutures of human patients [15]. Nell-1 overexpressing mice demonstrate calvarial bone overgrowth and inappropriate cranial suture fusion [16]. Conversely, animals deficient in functional Nell-1 demonstrate major skeletal defects, including defects in the cranial, axial and appendicular skeleton [17,18]. Moreover, Nell-1 has been observed to induce bone formation both in small and large mammalian models [19,20,21,22,23], and in vitro across numerous cell types [16,24,25]. The effects of Nell-1 on adipogenic differentiation have yet to be systematically evaluated. However, recent evidence has found that Nell-1 can reverse the pro-adipogenic effects of high-dose BMP2 (bone morphogenetic protein2) both in vitro and in vivo (data in submission).
In this present study, we expose an immortalized pre-adipocyte cell line 3T3-L1 and human primary adipose-derived stromal cells (hASCs) to enhanced Nell-1 signaling via an adenoviral vector. As Nell-1 signaling is a potent pro-osteogenic inducer, we hypothesized that Nell-1 would negatively effect adipogenesis. We then in a candidate fashion examined Nell-1 mediated changes to the Hedgehog signaling pathway, to potentially explain the molecular mechanisms whereby Nell-1 may deleteriously impact the process of fat formation.
Materials and Methods
Isolation of Cells
3T3-L1 cells were a kind gift of the Tontonoz Laboratory, University of California, Los Angeles. ASCs were isolated from human adult lipoaspirate. No individually identifiable information about the donor was received, therefore IRB approval was not requested. Fat tissues was obtained from N=3 healthy patients. After standard liposuction procedures, the lipoaspirate (100 ml) was washed with an equal volume of PBS and centrifuged at 1800 RPM for 10 min. The tissue fraction on the top layer was collected and transferred into a new tube. An equal volume of digestion solution (RPMI, 3.5% BSA, 10ug/ml DNAse, 1mg/ml Collagenase II) was added and transferred into a shaking incubator for 30-45 min at 37°C 250 RPM. Following the digestion, the solution was filtered using a 70 μm cell strainer, and centrifuged at 1800 RPM for 10 min. The fatty top layer containing the adipocytes was discarded and the pellet resuspended in PBS 5mM EDTA. After two washes in PBS 5mM EDTA, the pellet was resuspended in red blood cell lysis solution for 10 min at RT. After adding 3 volumes of PBS 5mM EDTA and centrifuging at 1500 RPM for 5 min, the pellet was resuspended in PBS 5mM EDTA prior to counting the number of viable stromal vascular fraction (SVF) cells via Trypan blue staining. Cells were expanded in 100 mm dishes thereafter.
In vitro adipogenic differentiation
For adipogenic differentiation, 3T3-L1 or hASCs were seeded in 12-well plates at a density of 50,000 cells per well. All assays were performed in triplicate wells. After attachment, cells were treated with adipogenic differentiation media (ADM). For 3T3-L1 cells, ADM consisted of Dulbecco's Modified Eagle Medium (DMEM), 10% FBS, 1 uM dexamethasone, 0.5 mM IBMX, 5 ug/mL insulin, 1% penicillin / streptomycin. For hASCs, propriety ADM was purchased (Stem Cell Technologies, Inc.). Cells were maintained for 3 days in ADM, and thereafter refreshed with DMEM, 10% FBS, and insulin only for 3T3-L1 cells, or propriety ADM for hASCs. All experiments were performed in biological triplicate (cells derived from 3 separate patients), and each assay was performed in triplicate wells (N=3 wells per cell type per experiment, N=3*3=9 samples per condition). Cell medium was supplemented in all cases with recombinant human Nell-1 protein at various dosages, or adenoviral delivered Nell-1 (Ad-Nell-1). Control virus was used at equal concentrations (Ad-LacZ). Ad-Nell-1 and Ad-LacZ were used as previously published, at a concentration of 20 and 40pfu/cell [16].
Adipogenic Assessments
Assessments of adipogenic differentiation were performed as previously described [10,26,27]. Oil red O staining was performed using a 0.2% solution in 60% isopropanol / 40% deionized water. Real time PCR was performed as previously described, performed in triplicate wells per RNA isolate [28]. Specific mouse and human genes and primer sequences are listed in Table 1.
Table 1. Primer Sequences.
| Gene Name | Forward primer sequence (5′ to 3′) | Reverse primer sequence (5′ to 3′) |
|---|---|---|
| Ap2, mouse | CCAACTCTTTTGTGCCAGAGA | GGCTACATTGGTGTTGAGCTTTT |
| Gapdh, mouse | CTTTTGCGAAGTGCAGGAAAAT | TGTTGACTGAGTCTTCTGGACAA |
| Gli1, mouse | GAGCCCTTCTTTAGGATTCCCA | ACCCCGAGTAGAGTCATGTGG |
| Gli3, mouse | CACAGCTCTACGGCGACTG | CGGCCTTCTCGCTGACATC |
| Ihh, mouse | CTCAGACCGTGACCGAAATAAG | CCTTGGACTCGTAATACACCCAG |
| Lpl, mouse | ATGGGGAAGGTGAAGGTCG | GGGGTCATTGATGGCAACAATA |
| Pparg, mouse | CACTCCTCGCCCTATTGGC | CCCTCCTGCTTGGACACAAAG |
| Ptc1, mouse | GCCACAGCCCCTAACAAAAAT | ACCCACAATCAACTCCTCCTG |
Bromodeoxyuridine Incorporation
Proliferation was assessed by bromodeoxyuridine (BrdU) incorporation assays as previously described [29]. Cells were grown in 96 well plates seeded at a density of 1,000 cells / well. After 2, 4 and 6 days growth, BrdU labeling was performed for a period of 8 hours. Next, BrdU incorporation was quantified using a photometric ELISA (Roche Applied Science, Indianapolis, Ind.). N=6 per treatment group, experiments were performed on three separate occasions.
Osteogenic Differentiation and Assessments
Osteogenic differentiation and assessments were performed using hASCs as previously described. To assess early to intermediate osteogenesis, alkaline phosphatase staining and quantification was performed as previously described; quantification was in each case normalized to total protein content in sister wells [30]. To assess bone nodule formation Alizarin red staining and quantification was performed as previously described; quantification was performed by CPC leaching and photometric quantification, normalized to total protein content [31].
Statistical analysis
Means and standard deviations were calculated from numerical data, as presented in the text, figures and figure legends. In figures, bar graphs represent means, whereas error bars represent one standard deviation. Statistical analysis was performed using the appropriate ANOVA when more than two groups were compared, followed by a post-hoc Student's t-test to directly compare two groups. The exact statistical analysis for each dataset is described in the figure legends. Inequality of standard deviations was excluded by employing the Levene's test. *P ≤ 0.01 was considered to be significant.
Results
Nell-1 Effects on 3T3-L1 Adipogenic Differentiation
3T3-L1 preadipocytes are one of the most commonly studied adipoprogenitor cell lines, and represent a unipotent cell type. 3T3-L1 cells were exposed to standard adipogenic differentiation media with adenoviral (Ad)-Nell-1 or Ad-LacZ as a control. After seven days, while Ad-LacZ treated cells showed robust lipid accumulation (Fig. 1A), Ad-Nell-1 showed only sparse lipid droplets (Fig. 1B). Two viral titers were assessed, with both showing the same trend. Real time quantitative PCR demonstrated an over 500% increase in Nell-1 expression with Ad-Nell-1 treatments with both viral titers (Supp. Fig. 1). Oil red O staining results were quantified by leaching with isopropanol and photometric quantification, normalized to total protein content of sister wells (Fig. 1C). Quantification demonstrated an approximate 80% reduction in Oil red O staining intensity. Importantly Trypan blue staining showed no increase in cytotoxicity with Ad-Nell-1 treatment (data not shown).
Figure 1. Adipogenic Differentiation of 3T3-L1 Cells.
(A,B) Oil red O staining after seven days adipogenic differentiation under control conditions (Ad-LacZ) or Nell-1 overexpressing conditions (Ad-Nell-1). (C) Quantification of Oil red O by isopropanol leaching and photometric quantification, normalized to average protein content in sister wells. Ad-Nell-1 and Ad-LacZ were used as previously published, at a concentration of 20 and 40pfu/cell [16]. All experiments will perfomed in triplicate wells on three separate occasions. *P<0.01.
Nell-1 Effects on 3T3-L1 Adipogenic Gene Expression
To confirm the anti-adipogenic effects of Nell-1 signaling on 3T3-L1 pre-adipocytes, cells were cultured in the presence of Nell-1 overexpressing adenovirus (Ad-Nell-1) or control virus (Ad-LacZ); RNA was harvested at stratified timepoints post induction (two, four and six days). As expected, all markers gradually increased overtime in adipogenic medium under control conditions (including Peroxisome proliferating factor gamma [Ppar], Lipoprotein lipase [Lpl] and Adipocyte protein 2 [Ap2]) (Fig. 2, blue bars). Significantly Ad-Nell-1 addition to adipogenic medium resulted in a significant reduction in all markers (Fig. 2, red bars). These data confirmed the significant anti-adipogenic effects of Nell-1 signaling in 3T3-L1 cells.
Figure 2. Adipogenic Gene Expression in 3T3-L1 Cells.
Specific gene expression was assessed at 2, 4 and 6 days after induction of adipogenesis in 3T3-L1 cells with or without control virus (Ad-LacZ, blue bars) or Nell-1 overexpressing virus (Ad-Nell-1, red bars) via quantitative real-time PCR. (A) Peroxisome proliferating factor gamma (Pparg) expression. (B) Lipoprotein lipase (Lpl) expression. (C) Adipocyte protein 2 (Ap2) expression. Ad-Nell-1 and Ad-LacZ were used as previously published, at a concentration of 20 pfu/cell [16]. *P<0.01.
Nell-1 Effects on 3T3-L1 Proliferation
Theoretically a reduction in the proliferation of pre-adipocytes by Nell-1 signaling could result in a reduction in Oil red O staining (see again Fig. 1). To confirm or reject this hypothesis, bromodeoxyuridine (BrdU) incorporation assays were performed in the presence of control (Ad-LacZ) or Nell-1 overexpressing adenovirus (Ad-Nell-1) (Supp. Fig. 2). Interestingly, no significant change in BrdU incorporation was observed (Supp. Fig. 2, compare red and blue bars). Thus, we reasoned that Nell-1 signaling likely inhibits adipoprogenitor cell differentiation rather than pre-adipocyte expansion in vitro.
Nell-1 Effects on Human ASC Differentiation
Mesenchymal Stem Cells (MSCs) clearly retain important biological differences from 3T3-L1 pre-adipocytes. We next inquired as to whether Nell-1 signaling would have the same negative effects on adipogenic differentiation a human MSC population: adipose-derived stromal cells or human (h)ASCs. We opted to utilize recombinant protein instead as a more defined and quantitative delivery of Nell-1 alternative source. Recombinant human (rh)NELL-1 from CHO cells was supplemented to standard adipogenic or osteogenic ASC differentiation medium (Fig. 3). As expected, rhNELL-1 had a negative effect on adipogenic differentiation, as demonstrated by Oil red O staining of lipid accumulation (ORO, appearing red) (Fig. 3A). In stark contrast, rhNELL-1 increased markers of osteogenic differentiation by biochemical staining, including alkaline phosphatase (ALP, an intermediate marker of osteodifferentiation appearing purple) and Alizarin red (AR, a stain for bone nodule formation appearing red) (Fig. 3B,C). Quantification of each stain confirmed a significant upregulation of osteogenic differentiation and converse and negative effect on adipocytic differentiation (Fig. 3D). Thus, Nell-1 signaling inhibited adipogenic differentiation in both a unipotent pre-adipocyte cell line, and a primary MSC.
Figure 3. Osteogenic and Adipogenic Differentiation of Primary Human ASCs.
Recombinant human (rh)NELL-1 was supplemented to standard osteogenic or adipogenic differentiation mediums (300 ng/ml). (A) Oil red O (ORO) staining was performed after 9 days differentiation. (B) Alkaline phosphatase (ALP) staining was performed after 5 days differentiation. (C) Alizarin red (AR) staining was performed after 10 days differentiation. (D) Quantification of ALP, AR and ORO staining. In the case of ALP, enzymatic activity was assessed, normalized to total protein content. In the case of AR, CPC leaching was performed, normalized to total protein content. In the case of ORO, isopropanol leaching was performed, normalized to total protein content. *P<0.01.
Nell-1 Effects on Hedgehog Signaling
Hedgehog signaling has been known to positively regulate osteogenic differentiation at the expense of adipogenic differentiation in multiple cell types, including ASCs [10,32,33,34]. We therefore next inquired as to the effects of Nell-1 on hedgehog signaling. 3T3-L1 cells were culture in the presence of control virus (Ad-LacZ) or Nell-1 overexpression virus (Ad-Nell-1) (Fig. 4). Indian Hedgehog (Ihh) ligand showed upregulation after both 4 and 6 days differentiation (Fig. 4A). Likewise two markers of hedgehog signaling activation showed similar upregulations, Patched1 (Ptc1) and Gli1 (Fig. 4B,C). Conversely, Gli3, generally considered a negative regulator of Hedgehog pathway activity, showed a reduction in transcript abundance (Fig. 4D). Thus and in summary Nell-1 appears to reduce adipogenic differentiation of 3T3-L1 cells with concomitant induction of Hedgehog ligand expression and Hedgehog signaling activity.
Figure 4. Hedgehog Signaling Gene Expression in 3T3-L1 Cells.
After 2, 4 and 6 days in adipogenic differentiation medium, RNA expression of common Hedgehog signaling genes was assessed by quantitative real-time PCR. (A) Indian Hedgehog (Ihh) gene expression. (B) Patched1, a marker of Hedgehog signaling activity (Ptc1). (C) Gli1, a transcription factor and marker of Hedgehog signaling activity. (D) Gli3, a transcription factor and negative regulator of Hedgehog signaling. Ad-Nell-1 and Ad-LacZ were used as previously published, at a concentration of 20 pfu/cell [16]. *P<0.01.
Discussion
Adipocytes and osteoblasts arise from a common mesenchymal progenitor cells, and a theoretical inverse relationship exists between these two cell types (Supp. Fig. 3). Numerous bipotent or multipotent cell types exist for future tissue engineering applications, including traditional bone marrow MSCs (BMSCs), adipose-derived stromal cells (ASCs) and umbilical cord-derived (UC-) MSCs. Accumulating data suggests that this bipartite destiny of MSCs (bone versus fat) can be shifted given appropriate cytokine stimulation [1]. Here, we sought to examine whether Nell-1 would be an appropriate signal to shift the balance from adipocytic to osteogenic differentiation.
In fact we found this to be the case: namely that Nell-1 definitively represses adipogenic differentiation in vitro. First, Nell-1 represses adipogenesis in a unipotent cell (a pre-adipocyte – or 3T3-L1 cell). Secondarily, Nell-1 likewise serves to repress adipogenic differentiation in a multipotent ASC. This suggests the effect of Nell-1 on adipogenesis are direct repression of lipogenesis, rather than an indirect repression via enhancement of the converse lineage (osteogenic) differentiation.
No doubt, Nell-1 is one of many cytokines known to ‘shift’ this MSC differentiation away from fat and towards bone. One particular cytokine pathway of interest is Hedgehog signaling, which in multiple cell types including ASCs has been shown to cause a similar ‘shift’ in differentiation [10,32,33,34]. Three mammalian Hedgehog ligands exist, including Sonic Hedghog (Shh), Indian Hedgehog (Ihh) and Desert Hedgehog (Dhh) – and as Dhh appears limited to the mammalian testes, both Shh and Ihh have been studied in greater detail. Both ligands appear to have a similar and equivalent pro-osteogenic effect (for example the Ihh null has severe skeletal defects) – however Shh has been studied in greater detail in vitro, where the N-terminal domain is responsible for signal propagation [34,35,36]. In our previous manuscript, we detailed the extent to which Shh-N positively regulated osteogenesis and inhibited adipogenesis, both in vitro and in vivo in mouse ASCs [10].
Given the striking similarities in effect between Shh and Nell-1, we sought here to define the extent to which Nell-1 may positively regulate hedgehog signaling. In fact, a positive relationship was observed. These studies suggest highly that at least some portion of the differentiation effects of Nell-1 are via activation and/or potentiation of Hedegehog signaling. Whether Nell-1 directly increases Hedgehog ligand (Shh or Ihh) expression, directly increases Gli transcription or Gli activation, or inactivates a Hedgehog repressor (Ptc1, Gli3, Rab23 among numerous others) remains as yet unknown. Certainly there exist other potentially signaling networks that may work to transduce a Nell-1 signal into a ‘shift’ in lineage differentiation. For example, MAPK signaling in known to modulate both osteogenic and adipogenic differentiation and has been previously shown to be up-regulated in certain contexts by Nell-1 [37]. In addition, Canonical Wnt signaling is well known to overall produce a similar ‘shift’ in differentiation and again has been shown to be up-regulated both in vitro and in vivo by Nell-1 protein (in submission). These studies suggest the multifactorial and interwoven nature of cell fate decisions, and suggest Nell-1 to be integral to the balance of osteo- and adipogenic MSC differentiation.
In summary, in addition to the well-recognized role of Nell-1 is promotion of osteogenic differentiation and bone formation, Nell-1 significantly represses adipogenic differentiation. This anti-adipogenic effect of Nell-1 may be through potentiation of Hedgehog signaling among other signaling cascades. These studies suggest the future therapeutic utility of Nell-1 for either skeletal or soft-tissue regenerative medicine.
Supplementary Material
Supplemental Figure 1: Nell-1 gene expression was evaluated by quantitative RT-PCR after 2 days treatment with Ad-Nell-1 or Ad-LacZ, showing upregulation of Nell-1 expression among Ad-Nell-1 treated samples at both low and high viral titers as depicted in Figure 1. Ad-Nell-1 and Ad-LacZ were used as previously published, at a concentration of 20 and 40 pfu/cell [16].
BrdU Incorporation assays were performed after 2, 4 and 6 days growth with control virus (Ad-LacZ, blue bars) or Nell-1 overexpressing adenovirus (Ad-Nell-1). Data are normalized to Ad-LacZ 2 day BrdU uptake levels. Ad-Nell-1 and Ad-LacZ were used as previously published, at a concentration of 20 pfu/cell [16]. No difference was observed across all timepoints.
Shown in blue, Nell-1 positively regulates MSC differentiation into pre-osteoblasts as well as further bone tissue ossification. Shown in pink, Nell-1 conversely negatively regulates MSC differentiation into pre-adipocytes as well as further adipocyte maturation.
Highlights.
> Nell-1 is a potent pro-osteogenic molecule, but has not yet been studied systematically in adipogenic differentiation. > Using 3T3-L1 cells and primary human ASCs, we found that Nell-1 signaling negatively regulates adipogenic differentiation. > Nell-1 mediated reductions in adipogenesis are associated with increased Hedgehog signaling, which may be a causative factor.
Acknowledgments
This work was supported by the CIRM Early Translational II Research Award TR2-01821, NIH/NIDCR (grants R21 DE0177711 and RO1 DE01607), UC Discovery Grant 07-10677 and the Thomas R. Bales Endowed Chair.
Footnotes
Conflict of interest: Drs. X.Z, K.T and C.S. are inventors of Nell-1 related patents filed from UCLA, and are founders of Bone Biologics Inc. which sublicenses Nell-1 patents from UC Regent.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Contributor Information
Aaron W. James, Email: aaronwjames1@gmail.com.
Angel Pan, Email: ismart@ucla.edu.
Michael Chiang, Email: mchiang9@gmail.com.
Janette Zara, Email: jzara@ucla.edu.
Xinli Zhang, Email: xzhang@dentistry.ucla.edu.
Kang Ting, Email: kting@dentistry.ucla.edu.
References
- 1.Pei L, Tontonoz P. Fat's loss is bone's gain. J Clin Invest. 2004;113:805–806. doi: 10.1172/JCI21311. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Gimble JM, Zvonic S, Floyd ZE, Kassem M, Nuttall ME. Playing with bone and fat. J Cell Biochem. 2006;98:251–266. doi: 10.1002/jcb.20777. [DOI] [PubMed] [Google Scholar]
- 3.Kirkland JL, Tchkonia T, Pirtskhalava T, Han J, Karagiannides I. Adipogenesis and aging: does aging make fat go MAD? Exp Gerontol. 2002;37:757–767. doi: 10.1016/s0531-5565(02)00014-1. [DOI] [PubMed] [Google Scholar]
- 4.Gimble JM, Nuttall ME. Bone and fat: old questions, new insights. Endocrine. 2004;23:183–188. doi: 10.1385/ENDO:23:2-3:183. [DOI] [PubMed] [Google Scholar]
- 5.Tseng YH, Kokkotou E, Schulz TJ, Huang TL, Winnay JN, Taniguchi CM, Tran TT, Suzuki R, Espinoza DO, Yamamoto Y, Ahrens MJ, Dudley AT, Norris AW, Kulkarni RN, Kahn CR. New role of bone morphogenetic protein 7 in brown adipogenesis and energy expenditure. Nature. 2008;454:1000–1004. doi: 10.1038/nature07221. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Neumann K, Endres M, Ringe J, Flath B, Manz R, Haupl T, Sittinger M, Kaps C. BMP7 promotes adipogenic but not osteo-/chondrogenic differentiation of adult human bone marrow-derived stem cells in high-density micro-mass culture. J Cell Biochem. 2007;102:626–637. doi: 10.1002/jcb.21319. [DOI] [PubMed] [Google Scholar]
- 7.Ross SE, Hemati N, Longo KA, Bennett CN, Lucas PC, Erickson RL, MacDougald OA. Inhibition of adipogenesis by Wnt signaling. Science. 2000;289:950–953. doi: 10.1126/science.289.5481.950. [DOI] [PubMed] [Google Scholar]
- 8.Li HX, Luo X, Liu RX, Yang YJ, Yang GS. Roles of Wnt/beta-catenin signaling in adipogenic differentiation potential of adipose-derived mesenchymal stem cells. Mol Cell Endocrinol. 2008 doi: 10.1016/j.mce.2008.05.005. [DOI] [PubMed] [Google Scholar]
- 9.Kennell JA, MacDougald OA. Wnt signaling inhibits adipogenesis through beta-catenin-dependent and -independent mechanisms. J Biol Chem. 2005;280:24004–24010. doi: 10.1074/jbc.M501080200. [DOI] [PubMed] [Google Scholar]
- 10.James AW, Leucht P, Levi B, Carre AL, Xu Y, Helms JA, Longaker MT. Sonic Hedgehog influences the balance of osteogenesis and adipogenesis in mouse adipose-derived stromal cells. Tissue Eng Part A. 2010;16:2605–2616. doi: 10.1089/ten.tea.2010.0048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kawai M, Mushiake S, Bessho K, Murakami M, Namba N, Kokubu C, Michigami T, Ozono K. Wnt/Lrp/beta-catenin signaling suppresses adipogenesis by inhibiting mutual activation of PPARgamma and C/EBPalpha. Biochem Biophys Res Commun. 2007;363:276–282. doi: 10.1016/j.bbrc.2007.08.088. [DOI] [PubMed] [Google Scholar]
- 12.Prestwich TC, Macdougald OA. Wnt/beta-catenin signaling in adipogenesis and metabolism. Curr Opin Cell Biol. 2007;19:612–617. doi: 10.1016/j.ceb.2007.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Suh JM, Gao X, McKay J, McKay R, Salo Z, Graff JM. Hedgehog signaling plays a conserved role in inhibiting fat formation. Cell Metab. 2006;3:25–34. doi: 10.1016/j.cmet.2005.11.012. [DOI] [PubMed] [Google Scholar]
- 14.van der Horst G, Farih-Sips H, Lowik CW, Karperien M. Hedgehog stimulates only osteoblastic differentiation of undifferentiated KS483 cells. Bone. 2003;33:899–910. doi: 10.1016/j.bone.2003.07.004. [DOI] [PubMed] [Google Scholar]
- 15.Ting K, Vastardis H, Mulliken JB, Soo C, Tieu A, Do H, Kwong E, Bertolami CN, Kawamoto H, Kuroda S, Longaker MT. Human NELL-1 expressed in unilateral coronal synostosis. J Bone Miner Res. 1999;14:80–89. doi: 10.1359/jbmr.1999.14.1.80. [DOI] [PubMed] [Google Scholar]
- 16.Zhang X, Kuroda S, Carpenter D, Nishimura I, Soo C, Moats R, Iida K, Wisner E, Hu FY, Miao S, Beanes S, Dang C, Vastardis H, Longaker M, Tanizawa K, Kanayama N, Saito N, Ting K. Craniosynostosis in transgenic mice overexpressing Nell-1. J Clin Invest. 2002;110:861–870. doi: 10.1172/JCI15375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Siu RK, Zhang X, Ko T, Wu BM, Ting K, Culiat CT, Soo C. Nell-1 deficient mice exhibit abnormal structure in spinal and long bones. ASBMR. 2009:S50–51. [Google Scholar]
- 18.Desai J, Shannon ME, Johnson MD, Ruff DW, Hughes LA, Kerley MK, Carpenter DA, Johnson DK, Rinchik EM, Culiat CT. Nell1-deficient mice have reduced expression of extracellular matrix proteins causing cranial and vertebral defects. Hum Mol Genet. 2006;15:1329–1341. doi: 10.1093/hmg/ddl053. [DOI] [PubMed] [Google Scholar]
- 19.Lu SS, Zhang X, Soo C, Hsu T, Napoli A, Aghaloo T, Wu BM, Tsou P, Ting K, Wang JC. The osteoinductive properties of Nell-1 in a rat spinal fusion model. Spine J. 2007;7:50–60. doi: 10.1016/j.spinee.2006.04.020. [DOI] [PubMed] [Google Scholar]
- 20.Siu RK, Lu SS, Li W, Whang J, McNeill GR, Zhang X, Wu B, Turner AS, Seim HB, Hoang P, Wang J, Gertzman A, Ting K, Soo C. Nell-1 protein promotes bone formation in a sheep spinal fusion model. Tissue Eng Part A. 2010 doi: 10.1089/ten.tea.2010.0486. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Aghaloo T, Cowan CM, Chou YF, Zhang X, Lee H, Miao S, Hong N, Kuroda S, Wu B, Ting K, Soo C. Nell-1-induced bone regeneration in calvarial defects. Am J Pathol. 2006;169:903–915. doi: 10.2353/ajpath.2006.051210. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Cowan CM, Cheng S, Ting K, Soo C, Walder B, Wu B, Kuroda S, Zhang X. Nell-1 induced bone formation within the distracted intermaxillary suture. Bone. 2006;38:48–58. doi: 10.1016/j.bone.2005.06.023. [DOI] [PubMed] [Google Scholar]
- 23.Li W, Zara JN, Siu RK, Lee M, Aghaloo T, Zhang X, Wu BM, Gertzman AA, Ting K, Soo C. Nell-1 enhances bone regeneration in a rat critical-sized femoral segmental defect model. Plast Reconstr Surg. 2011;127:580–587. doi: 10.1097/PRS.0b013e3181fed5ae. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Aghaloo T, Jiang X, Soo C, Zhang Z, Zhang X, Hu J, Pan H, Hsu T, Wu B, Ting K. A study of the role of nell-1 gene modified goat bone marrow stromal cells in promoting new bone formation. Mol Ther. 2007;15:1872–1880. doi: 10.1038/sj.mt.6300270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Cowan CM, Jiang X, Hsu T, Soo C, Zhang B, Wang JZ, Kuroda S, Wu B, Zhang Z, Zhang X, Ting K. Synergistic effects of Nell-1 and BMP-2 on the osteogenic differentiation of myoblasts. J Bone Miner Res. 2007;22:918–930. doi: 10.1359/jbmr.070312. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Levi B, James AW, Glotzbach JP, Wan DC, Commons GW, Longaker MT. Depot-specific variation in the osteogenic and adipogenic potential of human adipose-derived stromal cells. Plast Reconstr Surg. 2010;126:822–834. doi: 10.1097/PRS.0b013e3181e5f892. [DOI] [PubMed] [Google Scholar]
- 27.Levi B, James AW, Xu Y, Commons GW, Longaker MT. Divergent modulation of adipose-derived stromal cell differentiation by TGF-beta1 based on species of derivation. Plast Reconstr Surg. 2010;126:412–425. doi: 10.1097/PRS.0b013e3181df64dc. [DOI] [PubMed] [Google Scholar]
- 28.James AW, Levi B, Xu Y, Carre AL, Longaker MT. Retinoic acid enhances osteogenesis in cranial suture-derived mesenchymal cells: potential mechanisms of retinoid-induced craniosynostosis. Plast Reconstr Surg. 2010;125:1352–1361. doi: 10.1097/PRS.0b013e3181d62980. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.James AW, Levi B, Nelson ER, Peng M, Commons GW, Lee M, Wu B, Longaker MT. Deleterious Effects of Freezing on Osteogenic Differentiation of Human Adipose-Derived Stromal Cells In Vitro and In Vivo. Stem Cells Dev. 2010 doi: 10.1089/scd.2010.0082. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.James AW, Theologis AA, Brugmann SA, Xu Y, Carre AL, Leucht P, Hamilton K, Korach KS, Longaker MT. Estrogen/estrogen receptor alpha signaling in mouse posterofrontal cranial suture fusion. PLoS One. 2009;4:e7120. doi: 10.1371/journal.pone.0007120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Levi B, James AW, Xu Y, Commons GW, Longaker MT. Divergent modulation of adipose-derived stromal cell differentiation by TGF-beta1 based on species of derivation. Plast Reconstr Surg In Revision. 2009 doi: 10.1097/PRS.0b013e3181df64dc. [DOI] [PubMed] [Google Scholar]
- 32.Yuasa T, Kataoka H, Kinto N, Iwamoto M, Enomoto-Iwamoto M, Iemura S, Ueno N, Shibata Y, Kurosawa H, Yamaguchi A. Sonic hedgehog is involved in osteoblast differentiation by cooperating with BMP-2. J Cell Physiol. 2002;193:225–232. doi: 10.1002/jcp.10166. [DOI] [PubMed] [Google Scholar]
- 33.Spinella-Jaegle S, Rawadi G, Kawai S, Gallea S, Faucheu C, Mollat P, Courtois B, Bergaud B, Ramez V, Blanchet AM, Adelmant G, Baron R, Roman-Roman S. Sonic hedgehog increases the commitment of pluripotent mesenchymal cells into the osteoblastic lineage and abolishes adipocytic differentiation. J Cell Sci. 2001;114:2085–2094. doi: 10.1242/jcs.114.11.2085. [DOI] [PubMed] [Google Scholar]
- 34.Lenton K, James AW, Manu A, Brugmann SA, Birker D, Nelson ER, Leucht P, Helms JA, Longaker MT. Indian hedgehog positively regulates calvarial ossification and modulates bone morphogenetic protein signaling. Genesis. 2011 doi: 10.1002/dvg.20768. [DOI] [PubMed] [Google Scholar]
- 35.Levi B, James AW, Nelson ER, Brugmann SA, Sorkin M, Manu A, Longaker MT. Role of Indian hedgehog signaling in palatal osteogenesis. Plast Reconstr Surg. 2011;127:1182–1190. doi: 10.1097/PRS.0b013e3182043a07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM, Tabin CJ. Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science. 1996;273:613–622. doi: 10.1126/science.273.5275.613. [DOI] [PubMed] [Google Scholar]
- 37.Zhang X, Ting K, Bessette CM, Culiat CT, Sung SJ, Lee H, Chen F, Shen J, Wang JJ, Kuroda S, Soo C. Nell-1, a key functional mediator of Runx2, partially rescues calvarial defects in Runx2(+/-) mice. J Bone Miner Res. 2010 doi: 10.1002/jbmr.267. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplemental Figure 1: Nell-1 gene expression was evaluated by quantitative RT-PCR after 2 days treatment with Ad-Nell-1 or Ad-LacZ, showing upregulation of Nell-1 expression among Ad-Nell-1 treated samples at both low and high viral titers as depicted in Figure 1. Ad-Nell-1 and Ad-LacZ were used as previously published, at a concentration of 20 and 40 pfu/cell [16].
BrdU Incorporation assays were performed after 2, 4 and 6 days growth with control virus (Ad-LacZ, blue bars) or Nell-1 overexpressing adenovirus (Ad-Nell-1). Data are normalized to Ad-LacZ 2 day BrdU uptake levels. Ad-Nell-1 and Ad-LacZ were used as previously published, at a concentration of 20 pfu/cell [16]. No difference was observed across all timepoints.
Shown in blue, Nell-1 positively regulates MSC differentiation into pre-osteoblasts as well as further bone tissue ossification. Shown in pink, Nell-1 conversely negatively regulates MSC differentiation into pre-adipocytes as well as further adipocyte maturation.