Abstract
MRSA CC130 containing the mecA homologue mecALGA251 were reported from the UK and from Denmark so far from cattle and humans. Here we report on 11 MRSA CC130 among a sample of 12691 isolates of human origin collected from January 2006 until June 2011. MRSA CC130 grew insufficiently on chromogernic agar plates for detection of MRSA; the agglutination test for presence of PBP2a was negative. We designed primers for specific detection of mecALGA251 as well as for concomitant detection of both, mec LGA251 and mecA. As already described, the isolates exhibited spa-types t843, t1736, and t1773. The ccrA homologue indicated the presence SCCmec XI. When subjected to further characterization by means of a commercially available microarray the isolates were negative for sak chp, and scn, and as expected positive for hla, untruncated hlb, and hld. They furthermore contained edinB, aur, slpA, slpB, slpE. From genes coding for surface and cell wall associated products the ica-operon, cap8, clfA, clfF, ebpS, fnbA, fnbB, sdrC were detected but not cna. The isolates were negative for enterotoxin genes and tst, as well as for eta, and etb; agr-type was III.
Introduction
Nosocomial infections with methicillin resistant Staphylococcus aureus (MRSA) became an infection control problem worldwide during the past 20 years. They are mainly associated with hospital associated, clonal lineages (HA-MRSA) which have a pronounced capacity for spread in and among hospitals [1]. By the end of the 1990s MRSA emerged in parallel in the community independent upon hospitals. Community associated MRSA (CA-MRSA) obviously evolved separately from HA-MRSA, the majority of them represent clonal lineages different from HA-MRSA [2]. Since 2005 the emergence of MRSA in animals, in particular in livestock, focussed attention (LA-MRSA). The predominant clonal lineage ST398 was at first found as a colonizer in conventionally raised pigs, later on in other livestock such as veal calves and poultry, and finally in humans where it is not only a colonizer but infrequently the cause of infections, too [3]. The first demonstration of MRSA from mastitis in cattle dates back to 1972 [4], altogether MRSA remained infrequent in ruminants [5], [6]. Earlier studies based on phenotypic characterization suggested that S. aureus from cattle and from humans are unrelated [7]. This was confirmed by molecular typing for clonal lineages ST97 and ST705 of bovine origin, which seem to be pandemic [8], [9]. Mastitis associated lineages ST151 and ST133 seem to be frequent in the United Kingdom (UK) and in Denmark [10], [11]. However the majority of isolates from these lineages remained methicillin susceptible. There are several reports on mastitis in cattle associated with LA-MRSA ST398 [12]. Also clonal lineages of MRSA known before from humans have been reported in association with bovine mastitis such as HA-MRSA ST5 from Japan [13], ST239 from Turkey [14] and CA-MRSA ST1 from Hungary [15] and from Korea [16]. Another example for a clonal lineage with no restricted host specificity is S. aureus ST130 which represents a smaller fraction among S. aureus from mastitis in cattle in UK and more recently also MRSA ST130 from humans have been described [17], [18]. Interestingly these MRSA contain the mecA homologue mec LGA251 which is not detected by PCR established for detection of mecA. When human isolates exhibiting MRSA phenotype but negative PCR for mecA were tested, mecALGA251 was also detected among MRSA from humans in England and in Denmark. Here we report about the emergence of MRSA ST130 in infections in humans in Germany at low frequencies, PCR detection, and the uncertainty of detection by use of chromogenic media based on cefoxitin as selective agar.
Materials and Methods
Strain collection
MRSA isolates from a network of diagnostic laboratories all over Germany were sent to the German National Reference Centre for Staphylococci at the Robert Koch Institute, Wernigerode Branch, for typing and strain characterization.
The isolates were cultured on sheep blood agar and the species identification was confirmed by conventional methods. Additionally, all isolates were subjected to antibiotic susceptibility testing, spa-typing and PCR detection for the presence of mecA. A subset of selected isolates was further characterized.
No patient data were used or stored for the present study. Therefore, consent from the ethics committee was not required.
Phenotypic characterisation
Antimicrobial susceptibility testing was performed using the broth microdilution assay as described by Deutsches Institut für Normung, DIN 58940. [19] Interpretation of the results was done according to the EUCAST standard [20]. The MIC test panel included penicillin G, oxacillin, gentamicin, erythromycin, clindamycin, ciprofloxacin, moxifloxacin, oxytetracycline, cotrimoxazol, rifampicin, fusidic acid, fosfomycin, linezolid, mupirocin, daptomycin, tigecyclin, vancomycin, and teicoplanin. Furthermore all isolates were checked for susceptibility against oxacillin/sulbactam by a tube test as described previously [21].
Test for growth on chromogenic selective agar plates: Colonies grown on blood agar plates after overnight incubation were suspended in 0.9% NaCl solution with a turbidity corresponding to the 0.5 McFarland turbidity standard. This suspension and appropriate dilutions were inoculated in parallel onto sheep blood agar plates (Mueller Hinton agar containing sheep blood, OXOID) and onto chromogenic agar plates from three different manufacturers (chromID™ MRSA, bioMerieux; Brilliance™ MRSA, Oxoid; chromagar™ MRSA, Becton Dickinson). Growth was recorded after overnight incubation at 37±1°C. Efficiency of plating was calculated as the proportion of colony forming units on selective agar plates in comparison to blood agar plates.
Phenotypic test for the expression of PBP2a: The Slidex Staph MRSA test kit from bioMerieux was used as recommended by the manufacturer.
Genotypic characterisation
Primers used for PCR-based mecA-detection correspond to [22]. Primers were designed for the detection of mec LGA251 by choosing regions of low homology in the genome of MRSA LGA251 (accession-no. FR821779, EMBL database). Primers for the concomitant detection of mecA and mec LGA251 ( = mec u) were also deduced from the sequence of the genome of MRSA LGA251 by choosing regions nearly identical to mecA. A PCR for the ccrA homologue described for SCCmec XI in MRSA ST130 was developed by using primers deduced from the genome sequence of MRSA M10/0061 (accession-no. FR823292, EMBL database) (Table 1). The sequence of the respective PCR product shared >99% identity with the corresponding sequence in FR823292 and homologies <91% with ccrA of other SCCmec elements reported so far. The cycling scheme for the PCR reactions were 95°C for 2 min followed by 30 cycles with 94°C for 30 sec; 30 sec with the respective annealing temperature, 72°C for 30 sec; and finally 72°C for 4 min.
Table 1. Primers used for amplification and sequencing of mecA, mec LGA251, mec u and ccrAXI.
| Primer | Sequence (5′-3′) | PCR product (bp) | Tann | Target localisation | Reference |
| mecA f | TGGCTCAGGTACTGCTATCCAC | 776 | 60°C | 1038–1059 in Y00688 | [22] |
| mecA r | AGTTCTGCAGTACCGGATTTGC | 1814–1793 in Y00688 | |||
| mec LGA251 f | GCTCCTAATGCTAATGCA | 304 | 50°C | 36321–36338 in FR821779 | This study |
| mec LGA251 r | TAAGCAATAATGACTACC | 36625–36608 in FR821779 | |||
| mec u f2 | ATTTGTCTKCCAGTTTC | 728 | 48°C | 35907–35823 in FR821779 | This study |
| mec u r2.1 | TCACCAGGTTCAACRCA | 36551–36534 in FR821779 | |||
| ccrAXI f | TTTGGATTGTATGGTTRGA | 261 | 50°C | 12271–12288 in FR823292 | This study |
| ccrAXI r | CTCAAACGGACATCATCA, | 12532–15215 in FR823292 |
For spa-typing the polymorphic X-region of the protein A gene (spa) was amplified and sequenced according to the Ridom StaphType standard protocol (www.ridom.com). The resulting spa-types were assigned by using the Ridom StaphType software package (Ridom GmbH, Würzburg, Germany). The BURP algorithm, implemented in the most recent Ridom StaphType software version, was used for cluster analysis of spa-types [23]. Primers used for MLST correspond to the protocol as described previously [24], with the exception of the forward primer for tpi, where the following primer was used: tpif 5′-GCATTAGCAGATTTAGGCGT-3′.
SCCmec elements of types I to IV were characterized by using a PCR approach, including a combination of different PCRs as described (www.staphylococcus.net).
Selected isolates (08-02742, 09-01300, 09-02494, 10-00991, 10-01051, 10-01981, 10-02462-1) were further genotyped with the Identibac S. aureus Genotyping Test System (Alere Technologies GmbH) and the procedures recommended by the producer. This DNA microarray was initially developed and described by Monecke et al. [25]. It covers 334 target sequences (221 distinct genes represented by non polymorphic probes and a number of allelic variants) including taxonomic markers, SCCmec, capsule and agr group typing markers, resistance genes, exotoxins, and MSCRAMM genes. The hybridisation pattern was analyzed with the respective instrument and software (ArrayMate, Alere Technologies GmbH).
Results
Detection of MRSA ST130
The isolates reported here attracted attention by exhibiting resistance to oxacillin (MIC 8 mg/l) and to oxacillin/sulbactam (tube test) but negative PCR for mecA. MIC's for cefoxitin were 4 mg/l for 9 of the isolates and 8 mg/l for 2 of them. The 11 isolates MRSA ST130 investigated were only weakly able to grow on commercially available selective agar plates for MRSA. At least ChromID™ MRSA agar permitted growth of 8 of these isolates (Table 2).
Table 2. Efficiency of plating of MRSA ST130 on chromogenic agar plates in comparison to blood agar plates (% as proportion of colony forming units on blood agar plates).
| Proportion of colony forming units growing on chromogenic agar plates selective for MRSA in comparison to blood agar plates | |||||
| Number ofStrains | ChromID™(bioMerieux) | Number of strains | Brilliance™ MRSA(Oxoid) | Number ofstrains | Chromagar™ MRSA(Becton-Dickinson) |
| 8 | 50–100% | 4 | 50–100% | 1 | 80% |
| 3 | 0,1–0,2% | 1 | 10% | 4 | 5–10% |
| 6 | 0,01% | 6 | 0,01–0,05% | ||
All of the 11 isolates gave a negative result when subjected to phenotypical detection of PBP2a by means of the Slidex MRSA detection kit (bioMerieux). PCR amplification of the mecA homologue mec LGA251 by use of primers deduced from the sequence of MRSA ST130 strain LGA251 resulted in an amplimer of the corresponding size (304 bp) and nucleotide sequence. PCR for the ccrA homologue typical for SCCmec XI confirmed the presence of this SCCmec element.
PCR for covering both, mecA and mec LGA251: For establishing this PCR a sequence of high homology has been chosen for primer design. This PCR gave positive results for the major lineages of HA-MRSA, CA-MRSA, LA-MRSA ST398, and MRSA isolates ST130 (Table 3).
Table 3. Results for PCR detection of mecA in major MRSA clonal lineages and mecLGA251 in MRSA ST130 by different sets of primers.
| clonal lineage, SCCmec, spa-type | number of isolates | PCR results | ||
| mecA | mec LGA251 | mec u | ||
| ST5, II, IV | 4 | + | - | + |
| ST8, IV, t008 | 5 | + | - | + |
| ST22, IV, t022, t032 | 4 | + | - | + |
| ST36, t018 | 1 | + | - | + |
| ST45, t004, t015 | 5 | + | - | + |
| ST225, II, t003 | 3 | + | - | + |
| ST228, II, t001 | 4 | + | - | + |
| ST239, III, t037 | 3 | + | - | + |
| ST247, I, t051 | 3 | + | - | + |
| ST1, IV, t127, PVL+ | 1 | + | - | + |
| ST5, V, t002, PVL+ | 1 | + | - | + |
| ST8, IV, t008, PVL+ | 2 | + | - | + |
| ST22, IV, t310, PVL+ | 2 | + | - | + |
| ST59, IV, t216, PVL+ | 1 | + | - | + |
| ST80, IV, t044, PVL+ | 3 | + | - | + |
| ST152, V, t355 | 1 | + | - | + |
| ST398, V, t011, t034 | 4 | + | - | + |
| ST130, XI, t843, t1736, t1773 | 11 | - | + | + |
Results from typing
The isolates exhibited spa-types t843, t1736 and t1773 and multilocus sequence type ST130. Besides resistance to oxacillin and to oxacillin/sulbactam only two of the 11 isolates exhibited resistance to ciprofloxacin.
Origin of MRSA ST130
The first isolate of this MRSA lineages from infections in humans we became aware of originated from a patient suffering from a wound infection which needed surgical treatment in a hospital in Saxony Anhalt in 2006. Until 2011 9 other cases followed. Altogether MRSA ST130 were rare so far; 11 isolates among 12691 MRSA isolates from infections in humans (2006: 1 among 1514; 2007: 1 among 1972; 2008: 1 among 2287; 2009: 2 among 3168; 2010: 4 among 2853; 2011: 2 among 897).
The origin of these isolates and their characteristics are shown in Table 4.
Table 4. MRSA ST130: origin and characteristics.
| No. | Isolate area | origin | spa-type | resistance phenotype |
| 06-01833 | H. Saxony Anhalt | wound infection | t1736 | PEN,OXA,OXA/SUL,CIP |
| 07-03307 | H. Bavaria | wound infection | t843 | PEN,OXA,OXA/SUL |
| 08-02742 | B.W. | nasal swab veterinarian | t1736 | PEN,OXA,OXA/SUL |
| 09-01300 | NDH,Thuringia | dermatitis | t1773 | PEN,OXA,OXA/SUL |
| 09-02494 | WP,NRW | wound infection | t843 | PEN,OXA,OXA/SUL |
| 10-00991 | Rd, Schl.-H. | wound infection | t1736 | PEN,OXA,OXA/SUL |
| 10-01051 | Lp. Saxony | wound infection | t1736 | PEN,OXA,OXA/SUL |
| 10-01981 | Bd-L., Thuringia | wound infection after hip replacement | t843 | PEN,OXA,OXA/SUL |
| 10-02462-1 | H. Saxony Anhalt | wound infection | t1736 | PEN,OXA,OXA/SUL |
| 11-00529 | RZ, W.-W. | wound infection | t843 | PEN,OXA,OXA/SUL,CIP,MFL |
| 11-01497 | Saxonia | nosocomial pneumonia | t1736 | PEN,OXA,OXA/SUL |
CIP = ciprofloxacin, PEN = benzylpenicillin, OXA = oxacillin, OXA/SUL = oxacillin/sulbactam,
MFL = moxifloxacin.
Further characterization by means of microarray analysis for virulence and antibiotic resistance genes
Detailed results of the DNA microarray hybridisation are provided in Figure S1.
For genes of particular interest we obtained the following patterns:
hemolysins: hla+, hlb+, hld+
immune evasion: sak-, chp-, scn-, aur+, splA+, splB+, splE+,
matrix protein binding: bbp-, can-, clfA+, clfB+, ebh+, fnbA+, fnbB+,
sdrC+ (non polymorphic probes), coa+, vwb+ (non polymorphic probe)
superantigens: tst-, sea to seq -
exfoliative toxins: eta-, etb-, etd-, edinA-, edinB+
capsule, biofilm: cap8+, ica-operon+
agr type: III
Abbreviations: aur: “aureolysin”, proteinase; bbp: bone sialoprotein binding protein; cap: capsule formation; chp: chemotaxo inhibitory protein; clfA, clfB: clumping factor (fibrinogen binding); can: collagen binding protein; coa: coagulase; ebh: fibronectin binding protein; edin: epidermal cell differentiation inhibitors; eta, etb, etd: exfoliative toxins; fnb: fibronectin binding proteins, ica-operon: protein involved in biofilm formation; sak: staphylokinase; sea to seq: staphylococcal enterotoxins; scn: staphylococcal complement inhibitor; spl: serin protease like proteins; vwb: non Willebrandt factor binding protein.
Discussion
As typical for S. aureus from ruminants and other animal species MRSA ST130 lack immune evasion genes sak, chp, and scn [26]. They are contained by a phage of the phi3 family which integrates into hlb [27]. Corresponding to the lack of these genes MRSA ST130 isolates contain an untruncated hlb gene. Redundancy in S. aureus virulence associated proteins is common, and the function other proteins such as the aureolysin protease (aur) and serin protease like enzyme(s) may be sufficient. MRSA ST130 contain a number of genes coding for matrix protein binding proteins also known from S. aureus clonal lineages typical for humans such as fnbA, fnbB, clfA, clfB, sdrC, and ebh. A surprising similarity of immune evasion and surface protein genes of S. aureus from different animal hosts was reported just recently [28]. Different alleles of these genes are lineage specific and not associated with the major animal host. None of the known superantigen determinants was found in MRSA ST130, but a number of genes for staphylococcal superantigen like proteins was detected (set6, set8, set3, set5, set1) for which the function is not exactly known so far.
Genes coding for exfoliated toxins were absent besides edinB, this corresponds to the clinical picture infections with MRSA ST130 in humans recorded.
MRSA ST130 has the potential for biofilm formation (ica-gene cluster) and of formation of a type 8 capsule. Capsular serotype 8 is known from S. aureus of both, human and bovine origin [29] and capsules of this type protect against both, human and bovine neutrophils [30].
Although MRSA ST130 have not been reported from cattle in Germany so far an animal origin seems likely, this is also supported by its isolation from a nasal swab of a veterinarian in Bavaria. As reported from Denmark and from the UK MRSA ST130 is obviously able to colonize and to cause infections in both, cattle and humans (17, 18). Different from HA-MRSA and LA-MRSA the isolates were only resistant to beta lactam antibiotics, two of them in addition to fluoroquinolones. As fluoroquinolone resistance is uncommon in S. aureus from bovine mastitis it has probably been acquired by fluoroquinolone treatment of humans.
So far MSSA and MRSA ST130 are very rare among isolates from infections in humans. Also we did not find MSSA of this clonal lineage in healthy carriers investigated [31], [32]. Because of the low MICs for cefoxitin MRSA ST130 can be overlooked when using selective agar plates for screening at admission to hospitals. They should be considered also and verified by an appropriate PCR for the mec LGA251, when oxacillin/cefoxitin resistant but mecA negative isolates appear in routine clinical bacteriology.
Future studies have to show whether S. aureus/MRSA ST130 will to be able to disseminate among humans.
Supporting Information
Array hybridisation results for selected isolates.
(PDF)
Footnotes
Competing Interests: The authors have declared that no competing interests exist.
Funding: This study was supported by grant 01KI1014G from the German Federal Ministry of Education and Research. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Grundmann H, Aanensen DM, van den Wijnjaard CC, Spratt BG, Harmsen D, et al. Geographic distribution of Staphylococcus aureus causing invasive infections in Europe: a molecular-epidemiological analysis. PLoS Med; 2010;7(1):e1000215. doi: 10.1371/journal.pmed.1000215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.David MZ, Daum R. Community-associated methicillin-resistant Staphylococcus aureus: epidemiology and clinical consequences of an emerging epidemic. Clin Microbiol Rev. 2010;10:616–87. doi: 10.1128/CMR.00081-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Catry B, Van Duijkeren E, Pomba MC, Greko C, Moreno MA, et al. Reflection paper on MRSA in food-producing and companion animals: epidemiology and control options for human and animal health. Epidemiol Infect. 2010;138:6265–44. doi: 10.1017/S0950268810000014. [DOI] [PubMed] [Google Scholar]
- 4.Huber H, Koller S, Giezendanner N, Stephan R, Zweifel C. Prevalence and characteristics of methicillin-resistant Staphylococcus aureus in humans in contact with farm animals, in livestock, and in food of animal origin, Switzerland, 2009. Euro Surveill. 2010;15(6):pii: 19542. [PubMed] [Google Scholar]
- 5.Devriese LA, Van Damme LR, Fameree L. Methicillin (cloxacillin)-resitant Staphylococcus aureus strains isolated from bovine mastitis cases. Zentralbl Veterinarmed B. 1972;19:598–605. doi: 10.1111/j.1439-0450.1972.tb00439.x. [DOI] [PubMed] [Google Scholar]
- 6.Vanderhaeghen W, Cerpentier T, Adriaensen C, Vicca J, Hermans K, et al. Methicillin-resistant Staphylococcus aureus (MRSA) ST398 associated with clinical and subclinical mastitis in Belgian cows. Vet Microbiol. 2010;144:166–71. doi: 10.1016/j.vetmic.2009.12.044. [DOI] [PubMed] [Google Scholar]
- 7.Devriese LA. A simplified system for biotyping Staphylococcus aureus strains isolated from animal species. J Appl Bacteriol. 1984;56:215–20. doi: 10.1111/j.1365-2672.1984.tb01341.x. [DOI] [PubMed] [Google Scholar]
- 8.Alves PD, McCulloch JA, Even S, Le Maréchal C, Thierry A, et al. Molecular characterisation of Staphylococcus aureus strains isolated from small and large ruminants reveals a host rather than tissue specificity. Vet Microbiol. 2009;137:190–5. doi: 10.1016/j.vetmic.2008.12.014. [DOI] [PubMed] [Google Scholar]
- 9.Smith EM, Green LE, Medley FG, Bird HE, Fox LK, et al. Multilocus sequence typing of intercontinental bovine Staphylococcus aureus isolates. J Clin Microbiol. 2005;43:4737–43. doi: 10.1128/JCM.43.9.4737-4743.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sung JM, Lloyd DH, Lindsay JA. Staphylococcus aureus host specificity: comparative genomics of human versus animal isolates by multi-strain microarray. Microbiology. 2008;154:1949–59. doi: 10.1099/mic.0.2007/015289-0. [DOI] [PubMed] [Google Scholar]
- 11.Hasman H, Moodley A, Guardabassi L, Stegger M, Skov RL, et al. Spa type distribution in Staphylococcus aureus originating from pigs, cattle and poultry. Vet Microbiol. 2010;141:326–31. doi: 10.1016/j.vetmic.2009.09.025. [DOI] [PubMed] [Google Scholar]
- 12.Spohr M, Rau J, Friedrich A, Klittich G, Fetsch A, et al. Methicillin-resistant Staphylococcus aureus (MRSA) in three dairy herds in Southwest Germany. Zoonoses Public Health Jul. 2010;11 doi: 10.1111/j.1863-2378.2010.01344.x. [DOI] [PubMed] [Google Scholar]
- 13.Hata E, Katsuda K, Kobayashi H, Uchida I, Tanaka K, et al. Genetic variation among Staphylococcus aureus strains from bovine milk and their relevance to methicillin-resistant isolates from humans. J Clin Microbiol. 2010;48:2130–9. doi: 10.1128/JCM.01940-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Türkyilmaz S, Tekbiyik S, Oryasin E, Bozdogan B. Molecular epidemiology and antimicrobial resistance mechanisms of methicillin-resistant Staphylococcus aureus isolated from bovine milk. Zoonoses Public Health. 2010;57:197–203. doi: 10.1111/j.1863-2378.2009.01257.x. [DOI] [PubMed] [Google Scholar]
- 15.Juhasz-Kaszanyitzky E, Janosi S, Somogyi P, Dan A, van der Graff-van Bloois L, et al. MRSA transmission between cow and humans. Emerg Infect Dis. 2007;13:630–632. doi: 10.3201/eid1304.060833. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Nam HM, Lee AL, Jung SC, Kim MN, Jang GC, et al. Antimicrobial susceptibility of Staphylococcus aureus and characterization of methicillin-resistant Staphylococcus aureus isolated from bovine mastitis in Korea. Foodborne Pathog Dis. 2011;8:231–8. doi: 10.1089/fpd.2010.0661. [DOI] [PubMed] [Google Scholar]
- 17.Shore AC, Deasy EC, Slickers P, Brennan G, O'Connell B, et al. Detection of staphylococcal cassette chromosome mec type XI encoding highly divergent mecA, mecI, mecR1, blaZ and ccr genes in human clinical clonal complex 130 methicillin-resistant Staphylococcus aureus. Antimicrob Agents Chemother. 2011;55:3765–73. doi: 10.1128/AAC.00187-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Garcia-Alvarez L, Holden MT, Lindsay H, Webb CR, Brown DF, et al. Methicillin-resistant Staphylococcus aureus with a novel mecA homologue in human and bovine populations in the UK and Denmark: a descriptive study. Lancet Infect Dis. 2011;11:595–603. doi: 10.1016/S1473-3099(11)70126-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.German Institute for Standardization. Methods for susceptibility testing of bacterial pathogens (besides mycobacteria) against chemotherapeutics. DIN 58940, Part 8. Microdilution. In: Medical microbiology and immunology: diagnostic procedures. Vienna.
- 20.European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MIC's and zone diameters. Available: http://www.eucast.org.
- 21.Cuny C, Pasemann B, Witte W. Detection of oxacillin resistance in Staphylococcus aureus by screening tests. Eur J Clin Microbiol Infect Dis. 1999;18:834–6. doi: 10.1007/s100960050413. [DOI] [PubMed] [Google Scholar]
- 22.Murakami K, Minamide W, Wada K, Nakamura E, Teraoka H, et al. Identification of methicillin-resistant strains of staphylococci by polymerase chain reaction. J Clin Microbiol. 1991;29:2240–4. doi: 10.1128/jcm.29.10.2240-2244.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Strommenger B, Kettlitz C, Weniger T, Harmsen D, Friedrich AW, et al. Assignment of Staphylococcus aureus isolates to groups by spa-typing, SmaI-macrorestriction analysis, and multilocus sequence typing. J Clin Microbiol. 2006;44:2533–40. doi: 10.1128/JCM.00420-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Enright MC, Day NP, Davies CE, Peacock SJ, Spratt BG. Multilocus sequence typing for characterization of methicillin-resistant and methicillin-susceptible clones of Staphylococcus aureus. J Clin Microbiol. 2000;38:1008–15. doi: 10.1128/jcm.38.3.1008-1015.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Monecke S, Jatzwauk L, Weber S, Slickers P, Ehricht R. DNA microarray based genotyping of MRSA strains from Eastern Saxony. Clin Microbiol Infect. 2008;14:534–45. doi: 10.1111/j.1469-0691.2008.01986.x. [DOI] [PubMed] [Google Scholar]
- 26.Sibbald MJ, Ziebandt AK, Engelmann S, Hecker M, de Jong A, et al. Mapping the pathways to staphylococcal pathogenesis by comparative secretomics. Microbiol Mol Biol Rev. 2006;70:755–88. doi: 10.1128/MMBR.00008-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.van Wamel WJ, Rooijakkers SH, Ruyken M, van Kessel KP, van Strijp JA. The innate immune modulators staphylococcal complement inhibitor and chemotaxis inhibitory protein of Staphylococcus aureus are located on beta-hemolysin-converting bacteriophages. J Bacteriol. 2006;188:1310–5. doi: 10.1128/JB.188.4.1310-1315.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.McCarthy AJ, Lindsay JA. Genetic variation in Staphylococcus aureus surface and immune evasion genes is lineage associated: implications for vaccine design and host-pathogen interactions. BMC Microbiol. 2010;10:173. doi: 10.1186/1471-2180-10-173. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Watts A, Ke D, Wang Q, Pillay A, Nicholson-Weller A, et al. Staphylococcus aureus strains that express serotype 5 or serotype 8 capsular polysaccharides differ in virulence. Infect Immun. 2005;73:3502–11. doi: 10.1128/IAI.73.6.3502-3511.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Kampen AH, Tollersrud T, Lund A. Staphylococcus aureus capsular polysaccharide types 5 and 8 reduce killing by bovine neutrophils in vitro. Infect Immun. 2005;73:1578–83. doi: 10.1128/IAI.73.3.1578-1583.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Cuny C, Nathaus R, Layer F, Strommenger B, Altmann D, et al. Nasal colonization of humans with methicillin-resistant Staphylococcus aureus (MRSA) CC398 with and without exposure to pigs. PLoS One. 2009;4(8):46800. doi: 10.1371/journal.pone.0006800. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Holtfreter S, Grumann D, Schmudde M, Nguyen HT, Eichler P, et al. Clonal distribution of superantigen genes in clinical Staphylococcus aureus isolates. J Clin Microbiol. 2007;45:2669–80. doi: 10.1128/JCM.00204-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Array hybridisation results for selected isolates.
(PDF)
