Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Mar 2.
Published in final edited form as: Mov Disord. 2011 Mar 2;26(3):549–552. doi: 10.1002/mds.23551

The c.-237_236GA>TT THAP1 Sequence Variant Does Not Increase Risk for Primary Dystonia

Jianfeng Xiao 1, Yu Zhao 1, Robert W Bastian 2, Joel S Perlmutter 3, Brad A Racette 4, Samer D Tabbal 4, Morvarid Karimi 4, Randal C Paniello 5, Zbigniew K Wszolek 6, Ryan J Uitti 6, Jay A Van Gerpen 6, David K Simon 7, Daniel Tarsy 7, Peter Hedera 8, Daniel D Truong 9, Karen P Frei 9, Andrew Blitzer 10, Monika Rudzińska 11, Ronald F Pfeiffer 1, Carrie Le 1, Mark S LeDoux 1,*
PMCID: PMC3171986  NIHMSID: NIHMS250422  PMID: 21370264

Abstract

Sequence variants in coding and non-coding regions of THAP1 have been associated with primary dystonia. In this study, 1446 Caucasian subjects with mainly adult-onset primary dystonia and 1520 controls were genotyped for a variant located in the 5’-untranslated region of THAP1 (c.-237_236GA>TT). Minor allele frequencies were 62/2892 (2.14%) and 55/3040 (1.81%) in subjects with dystonia and controls, respectively (P = 0.202). Subgroup analyses by gender and anatomical distribution also failed to attain statistical significance. In addition, there was no effect of the TT variant on expression levels of THAP1 transcript or protein. Our findings indicate that the c.-237_236GA>TT THAP1 sequence variant does not increase risk for adult-onset primary dystonia in Caucasians.

Keywords: dystonia, DYT6, high-resolution melting, untranslated region, THAP1


DYT6 dystonia is an autosomal dominant primary dystonia causally-associated with sequence variants in THAP1 which encodes the DNA-binding transcription factor THAP1.1–3 DYT6 dystonia shows reduced penetrance and variable expressivity.2–8 In contrast to DYT1 dystonia, DYT6 more commonly remains focal in distribution and often affects the cervical and laryngeal musculature.1,4,5 Over 30 sequence variants have been localized to the coding regions of THAP1 and associated with focal, segmental, multi-focal or generalized dystonia with age of onset ranging from 2 to 62 years.1–8 In addition, several asymptomatic carriers have been identified in the relatives of probands. The genetic and phenotypic heterogeneity of DYT6 dystonia, and variable penetrance of known coding variants suggest that non-coding variants in THAP1 could contribute to the risk of developing adult-onset primary dystonia.4,5,7 Given that THAP1 is a transcriptional repressor, it is conceivable that non-coding variants which cause minor quantitative changes in the temporal or spatial patterns of THAP1 expression could have broad effects on the transcriptome.

Djarmati and colleagues4 identified a non-coding sequence variant (c.-237_236GA>TT) near the transcriptional start site of THAP1 that might increase the risk of developing primary dystonia. The relative frequency of this polymorphism in their subjects with dystonia (20/320) relative to controls (7/355) was noteworthy (P = 0.0054). Extrapolation of their findings to a broad population of late-onset primary dystonia is problematic given that the subjects with dystonia were relatively young (mean age of onset = 38.5 years) and predominantly Northern German whereas the control group was composed of Caucasian individuals of more diverse European ancestry. Another, relatively small case-control study with heterogeneous control and dystonia populations did not find an association between the TT allele and risk for dystonia.7

Herein, we present the results of a large case-control study of c.-237_236GA>TT in primary, mainly adult-onset, dystonia. All subjects were Caucasians. Moreover, the effects of the TT variant on overall gene expression (transcript) were interrogated in leukocytes, and replicated in lymphoblastoid cell lines (transcript and protein) derived from distinct cohorts of cases and controls. Although RNA derived from peripheral blood has been used to study DYT1 dystonia9 and other movement disorders, analysis of gene expression in lymphoblastoid cell lines limits potential exogenous confounds including the effects of medications, nutrient intake, and concomitant infectious and inflammatory medical conditions.

PATIENTS AND METHODS

Participants

All human studies were conducted in accordance with the Declaration of Helsinki with formal approval from the institutional review boards at each participating study site. All subjects gave written informed consent. Recruitment of patients with primary dystonia and neurologically-normal controls is described in Xiao et al.5 Additional Caucasian control samples were obtained from Sigma-Aldrich (Human Random Control DNA Panels 1, 3, and 4), Emory Center for Neurodegenerative Disease Tissue Bank Core, Washington University in St. Louis School of Medicine Neuroscience Blueprint Core and Coriell Institute for Medical Research (Control Panels NDPT020 and NDPT024). All normal controls except those from Sigma-Aldrich were examined to exclude dystonia and other neurological disorders. Demographics for dystonia and control subjects are presented in Table 1. Of note, Table 1 does not include family members of probands.

TABLE 1.

Clinical diagnoses, demographics, genotypes and allele frequencies in dystonia and controls

Clinical diagnosis Number
(age of onset)*
Family
history†
Minor Allele Frequency (TT) Genotypes P-value

M F All GA/GA GA/TT TT/TT M F All
Spasmodic
dysphonia
464
(45.8 ± 16.0, 7–85)
7.8% 4/214
(1.9%)
21/714
(2.9%)
25/928
(2.7%)
439/464
(94.6%)
25/464
(5.4%)
0/464
(0%)
0.501 0.082 0.064
Cervical
Dystonia
490
(44.5 ± 13.3, 4–76)
9.0% 4/230
(1.7%)
12/750
(1.6)
16/980
(1.6%)
474/490
(96.7%)
16/490
(3.3%)
0/490
(0%)
0.554 0.359 0.420
Blepharospasm 197
(58.1 ± 9.5, 20–73)
6.6% 3/122
(2.5%)
4/272
(1.5%)
7/394
(1.8%)
190/197
(96.4%)
7/197
(3.6%)
0/197
(0%)
0.356 0.416 0.581
Hand-forearm
dystonia
52
(35.2 ± 15.9, 7–60)
8.3% 0/46
(0%)
2/58
(3.4%)
2/104
(1.9%)
50/52
(96.2%)
2/52
(3.8%)
0/52
(0%)
0.468 0.317 0.569
Oromandibular
dystonia
17
(52.9 ± 11.6, 20–70)
10.5% 0/8
(0%)
0/26
(0%)
0/34
(0%)
17/17
(100%)
0/17
(0%)
0/17
(0%)
0.875 0.607 0.539
Other primary
dystonia
36
(42.5 ± 18.3, 10–74)
13.9% 1/28
(3.6%)
1/44
(2.3%)
2/72
(2.8%)
34/36
(94.4%)
2/36
(5.6%)
0/36
(0%)
0.385 0.580 0.382
Segmental
Dystonia
140
(47.5 ± 12.2, 12–74)
13.2% 1/92
(1.1%)
6/188
(3.2%)
7/280
(2.5%)
134/140
(95.7%)
5/140
(3.6%)
1/140
(0.7%)
0.551 0.179 0.265
Multifocal
Dystonia
24
(32.2 ± 15.8, 7–67)
22.2% 0/16
(0%)
2/32
(6.3%)
2/48
(4.2%)
22/24
(91.7%)
2/24
(8.3%)
0/24
(0%)
0.766 0.133 0.222
Generalized
dystonia
26
(23.9 ± 19.4, 1–57)
13.3% 1/24
(4.2%)
0/28
(0%)
1/52
(1.9%)
25/26
(96.2%)
1/26
(3.8%)
0/26
(0%)
0.342 0.584 0.617

Dystonia totals 1446
(46.2 ± 13.9, 1–85)
9.1% 14/780
(1.8%)
48/2112
(2.3%)
62/2892
(2.1%)
1385/1446
(95.8%)
60/1446
(4.1%)
1/1446
(0.1%)
0.476 0.260 0.202

Neurologically
normal controls
1520
(49.3 ± 13.2, 23–83)
NA 22/1320
(1.7%)
33/1720
(1.9%)
55/3040
(1.8%)
1465/1520
(96.4%)
55/1520
(3.6%)
0/1520
(0%)
*

Mean age at study enrollment +/− standard error of the mean (SEM), range (yrs).

†

First- or second-degree relative with dystonia. M, male. F, female

High Resolution Melting

High resolution melting (HRM) analyses were performed with the LightCycler® 480 Real-Time PCR system and High Resolution Master Mix (Roche) in accordance with manufacturer instructions and our laboratory protocol5 using forward (acctggcctcagccaatagt) and reverse (ctgcgctcggttggattc) primers designed to amplify the 5’-untranslated region (UTR) of THAP1. Melting curves and difference plots were analyzed by three investigators (J.X., Y.Z. and M.S.L.) blinded to phenotype. All samples were unambiguously assigned to genotypes by Gene Scanning software. For samples with shifted melting curves, PCR products were cleaned using ExoSAP-IT® (United States Biochemical) and sequenced in the forward and reverse directions. To evaluate the sensitivity and specificity of HRM, amplicons from 400 neurologically-normal controls and 400 subjects with dystonia were subjected to Sanger sequencing. Fisher's exact test was used to evaluate association of the c.-237_236GA>TT sequence variant with dystonia. The Genetic Power Calculator, case-control discrete traits module, was used for power analysis.10

THAP1 Expression

Ambion’s LeukoLOCK™ Total RNA Isolation System and TRI Reagent® were used to isolate RNA from peripheral blood leukocytes of dystonia subjects and controls. Leukocyte RNA was used to evaluate the effects of the TT allele on THAP1 expression in dystonia subjects with the TT allele (n = 20) and controls without the TT allele (n = 24). RNA and protein were also extracted from lymphoblastoid cells derived from another 5 patients with the TT allele and 10 normal controls without the TT allele. Sanger sequencing was used to exclude coding, splice-site, 5’UTR and previously reported intronic sequence variants (c.71+9C>A, c.71+126T>C) from the control and dystonia groups.5,7 Detailed protocols for maintenance of lymphoblastoid cell lines, quantitative real-time PCR and quantitative Western blotting are provided in Supporting Information Methods. Student’s t-tests were used to compare RNA and protein expression between dystonia and control samples. G*Power 3 was used for post-hoc power analysis.11

RESULTS

As depicted in Supporting Information Figure 1, melting curves robustly discriminated GA/GA homozygotes from heterozygotes (GA/TT) and homozygotes of the minor allele (TT/TT). Furthermore, difference plots clustered these genotypes into three discrete groups. Based on follow-up sequencing of samples exhibiting shifted melting curves and sequencing data from 400 neurologically-normal controls and 400 subjects with dystonia, HRM showed 100% diagnostic specificity and sensitivity.

As detailed in Table 1, only one subject with dystonia was homozygous for the TT allele whereas 60 were GA/TT heterozygotes. TT allelic frequencies were 62/2892 (2.14%) in subjects with dystonia and 55/3040 (1.81%) in controls. A one-tailed Fisher’s exact test failed to confirm nonrandom associations between the TT allele and dystonia (p = 0.202). Subgroup analyses for laryngeal dystonia, cervical dystonia, blepharospasm, hand-forearm dystonia, segmental dystonia, multifocal dystonia and generalized dystonia also failed to attain statistical significance in both male and female subjects (p > 0.06, for all). Of note, with a Bonferroni correction for multiple comparisons, a P value less than 0.05/12 (0.0042) would be required to maintain a Type I error rate (α) of 0.05 for the subgroup analyses. Using a conservative population prevalence for primary dystonia of 1/10,00012 and an α of 0.05, our case-control cohort had over 95% power to detect a 2-fold relative risk of the TT allele. As seen in Table 2, there was no effect of the TT allele on THAP1 mRNA expression levels in either leukocytes or lymphoblastoid cell lines. Moreover, there was no statistically significant effect of the TT allele on expression of THAP1 protein (Supporting Information Figure 2). Post-hoc power analysis with an effect size (d) of 0.20 showed that our comparison of leukocyte mRNA expression levels was weakly powered (1 - β = 0.10).

TABLE 2.

Effect of the c.-237_236GA>TT sequence variant on relative THAP1 expression levels in leukocytes and lymphoblastoid cells

Genotype/phenotype RNA
Leukocytes
RNA
Lymphoblastoid
cell lines
Protein
Lymphoblastoid
cell lines
Heterozygous
c.-237_236GA>TT
Primary dystonia
1.043 ± 0.036*
(n=20)
0.973 ± 0.065
(n=5)
0.811 ± 0.146
(n=5)
Homozygous GA allele
Neurologically-normal
controls
1.011 ± 0.032
(n=24)
1.020 ± 0.065
(n=10)
1.000 ± 0.074
(n=10)
P-value** 0.508 0.617 0.292
*

All values are means ± SEM.

**

Difference between dystonia and control samples.

DISCUSSION

THAP1 encodes a 213 residue transcription factor which contains a highly conserved DNA sequence-specific zinc-dependent THAP domain (1–81aa), a proline-rich region, a nuclear localization signal (146–162aa) and a coiled-coil domain.13,14 Overexpression of THAP1 in endothelial cells was used by Cayrol and co-workers15 as an indirect means of identifying THAP1 targets. Down-regulated genes were concentrated in classes related to cell-cycle/cell proliferation and the majority were also regulated by the pRB/E2F pathway. THAP1 knock-down was associated with decreased expression of 8 pRB/E2F cell-cycle target genes. These data suggest that THAP1 promoter, UTR and intronic sequence variants associated with alterations in THAP1 expression may exert deleterious effects on neural function and/or neural development and serve as risk factors for dystonia. However, based on the data presented herein, the c.-237_236GA>TT THAP1 sequence variant has no effect on the risk of developing adult-onset primary dystonia in Caucasians. Moreover, the TT allele does not appear to exert important effects on either transcription or translation in leukocytes and lymphoblastoid cell lines.

In contrast to previous investigations of the c.-237_236GA>TT THAP1 sequence variant, our study was much larger and focused on late-onset dystonia.4,7 The previously described cohorts from Germany4 and England7 contained a higher percentage of subjects with generalized, segmental and multifocal dystonia. Although the GA>TT variant did not increase overall risk in our cohort of Caucasian subjects, we did not eliminate the possibility that this variant could contribute to dystonia risk in other populations. Similarly, several of our anatomical subgroups may have been underpowered to detect an effect of the TT allele. In this regard, the sole individual homozygous for the TT allele manifests segmental craniocervical dystonia16 with blepharospasm and oromandibular dystonia. Finally, our data do not exclude a role for the TT allele in epistatic interactions with other genes.

Although the results of THAP1 mRNA and protein expression in leukocytes and lymphoblastoid cell lines suggest that the TT allele does not contribute to dystonia risk, our analysis may have been underpowered to detect a small effect. Moreover, it is possible that the effect size of the TT allele on THAP1 expression is developmentally regulated in a tissue specific fashion. Ideally, RNA and protein expression should be examined in several regions of human brain from individuals with GA/GA and GA/TT genotypes at several time points during development. Given the important role for THAP1 in primary dystonia, other sequence variants in promoter, UTR and intronic regions of THAP1 are also worthy of investigation.

Supplementary Material

Supp Figure S1
Supp Figure S2
Supplementary Data

Acknowledgments

This study was supported by the Neuroscience Institute at the University of Tennessee Health Science Center (M.S.L.), Dystonia Medical Research Foundation (M.S.L.), NIH grants R01NS048458 and R01NS069936 (M.S.L.), NIH U54 Dystonia Coalition (1U54NS065701) Pilot Projects Program (M.S.L.), and the Parkinson’s & Movement Disorder Foundation (M.S.L.). At Washington University School of Medicine, work was supported by the NIH National Institute of Neurological Disease and Stroke grants P30NS05710 (Neuroscience Blueprint Grant) and Clinical Sciences Translation Award RR024992, K24 ES017765 (BAR), the American Parkinson’s Disease Association (APDA) Advanced Research Center, the Greater St. Louis Chapter of the APDA, the Barnes-Jewish Hospital Foundation (Jack Buck Fund for PD Research and the Elliot H. Stein Family Fund), the Missouri Chapter of the Dystonia Medical Research Foundation and the Murphy Fund. At Mayo Clinic Florida, work was supported by the NIH National Institute of Neurological Disease and Stroke Morris K. Udall Center of Excellence for Parkinson Disease Research grant (P50-NS40256), NIA R01AG015866 and Bolch Family Foundation (Z.K.W., R.J.U., and J.A.V.G.); NINDS R01 NS057567-01A2, Pacific Alzheimer’s Research Foundation (PARF-C06-01), and CR 90052025 Mayo Clinic Jacksonville Research Committee (Z.K.W. and R.J.U.); and NIA P01AG017216 (Z.K.W.). At the Parkinson's & Movement Disorder Institute, work was supported by the Long Beach Memorial Foundation, Orange Coast Memorial Foundation, and the Parkinson’s & Movement Disorder Foundation. Collection of control specimens at Emory University was supported by the Alzheimer’s Disease Research Center Grant AG025688 and Emory NINDS Neuroscience Core Facilities Grant NS055077. We gratefully acknowledge the assistance of C. Lohnes, J. Dennhardt, A. Fitzgerald, E. Heintzen, L. Carpenter, Ling Yan, J. Hartlein, T. Pretorius, A. Strongosky, J. Searcy, H. Lam and C. Lim with subject enrollment and data collection.

Financial Disclosures

Dr. Xiao has nothing to disclose. Dr. Zhao has nothing to disclose. Dr. Bastian serves on the Scientific Advisory Board of Olympus Surgical; and received honoraria from Olympus Surgical Education event. Dr. Perlmutter Dr. Perlmutter serves on the scientific advisory boards of the American Parkinson Disease Association, Dystonia Medical Research Foundation, MO Chapter of the Dystonia Medical Research Fund, Greater St. Louis Chapter of the APDA; serves as an editorial board member of Neurology; received travel expenses and/or honoraria for lectures or educational activities not sponsored by industry; received honoraria from Parkinson Disease Study Group for grant reviews, from Univ Toronto for visiting lectureship, from Univ of Maryland for visiting lectureship, from the Movement Disorders Society for invited lecture. Receives research support from NIH [1R01 NS41509 (PI), R01 NS050425 (PI), R01 NS058714 (PI), P30 NS057105 (Project co-leader), NIH/NCRR RR024992 (Core leader), R01ES013743 (Coinvestigator), R01 NS039821 (coinvestigator), R01NS058797 (Coinvestigator); RO1 HD056015 (Coinvestigator), RO1 DK085575 (coinvestigator); U54 NS065701 (Co-PI and Project leader), receives research support from the Huntington Disease Society of American (HDSAO for the HDSA Center of Excellence at Washington Univesity (PI), Michael J. Fox Foundation, HiQ Foundation, McDonnell Center for Higher Brain Function, Greater St. Louis Chapter of the American Parkinson Disease Association, American Parkinson Disease Association (APDA) for the Advanced PD Research Center at Washington University (PI) , Bander Foundation for Medical Ethics and received research support from the BJH Foundation. Dr. Racette received research support from Teva (PI), Eisai (PI), and Solvay (PI); receives research support from Schwarz (PI), Solstice (PI), Eisai (PI), Allergan (PI), and Neurogen (PI); received government research support from NIH [5R01 NS037167-10 (PI-Foroud, T)]; received research support for “Epidemiology of Parkinsonism in Welders” Administrative Supplement to Support College Undergraduate Research (NIEHS) (PI); receives research support from NIH [U10 NS44455 (PI), R01HG02449 (PI-Shoulson, I), R01 ES013743-01A2 (PI), P42 ES04696 (PI-Checkoway, H), K24 NS060825 (PI), R21 ES017504 (PI), K23 NS43351 (PI)]; received research support from BJHF/ICTS [Neuropathology of Chronic Manganese Exposure” (PI)]; and received research support from received research support from the Michael J. Fox Foundation. Dr. Tabbal has nothing to disclose. Dr. Karimi has nothing to disclose. Dr. Paniello has nothing to disclose. Dr. Wszolek serves as co-Editor-in-Chief of Parkinsonism and Related Disorders and Regional Editor of European Journal of Neurology, serves as an editorial board member of Neurologia i Neurochirurgia Polska, Advances in Rehabilitation, Medical Journal of the Rzeszow University, and Clinical and Experimental Medical Letters; holds patents that may accrue revenue, Mayo 2004-185, 2004-291, and 2007-104; receives royalties from Parkinsonism and Related Disorders (Elsevier) and European Journal of Neurology (Wiley-Blackwell); received educational support from Allergan, Inc. (MCF Educational grant); received research support from NIH NINDS [R01 NS057567-03 (Co.-Investigator), 1RC2 NS070276-01 (Project Leader), P50 NS 072187-01 (Clinical Core Leader)]; and support from Mayo Clinic Florida, Research Committee CR program [MCF Activity #90052018 (Primary Investigator) and MCF Activity #90052030 (Primary Investigator)]; received research support from Carl Edward Bolch, Jr. and Susan Bass Bolch Gift [MCF Activity #90052031/PAU #90052 (Primary Investigator)]. Dr. Uitti received research support form Novartis, Medtronic, Inc., Eisai Inc., and Advanced Neuromodulations Systems; receives research support from NIH/NINDS (P50NS 40256 (Co.-Investigator); serves as an Associate Editor for Neurology; His institution has received annual royalties from the licensing of the technology related to PARK8/LRRK2 greater than the federal threshold for significant financial interest. Dr. Van Gerpen has nothing to disclose. Dr. Simon has received research support from the NINDS [1R01NS058988 (PI), U10 NS44482 (PI at BIDMC), NINDS R01NS037167 (subcontract/Investigator)]; received research support from NINDS [1R03NS053840 (PI)]; and served as a consultant to the Gerson Lehrman Group (GLG) and Link Medicine; received research support from Michael J. Fox, National Parkinson Foundation Center of Excellence Research Grant, and National Parkinson Foundation “Mega-Research Project” Award (Co-PI). Dr. Simon has received honoraria for lectures or consultation from Link Medicine and from UCB Pharma, and compensation for expert testimony relating to movement disorders from the Commonwealth of Massachusetts.

Dr. Tarsy serves on the editorial board of Parkinsonism & Related Disorders; receives royalties from UpToDate; served on the speakers’ bureau of Boehringer Ingelheim Pharmaceuticals, Inc.; has received research support from UCB Pharma, Schwarz Biosciences, Merck & Co., Inc., Solvay, and Kyowa. Dr. Hedera receives research support from NIH/NINDS (K02NS057666 [PI]) and serves on the speakers’ bureau for Lundbeck. Dr. Truong served on the speakers’ bureau of Allergan; serves on the speakers’ bureau for Teva; served as a consultant for Schering Plough; received compensation for activities with Solstice Neurosciences and GlaxoSmithKline, Inc.; received funding for travel from Ipsen, Allergan, and Teva; received research support from UCB Pharma Merz, Ipsen, Schering Plough, and Acadia. Dr. Frei served on the speakers’ bureau for Allergan. Dr. Blitzer serves as an editor for Laryngoscope and the Journal of the American Academy of Otolaryngology - Head and Neck Surgery; served on the scientific advisory boards for Allergan, Inc. and Revance Therapeutics; has received honoraria for activities with Myotech; has received research support from Allergan, Inc., Merz Pharma, and Revance Therapeutics; and has received royalty payments from Xomed/Medtronics. Dr. Pfeiffer has served as co-Editor-in-Chief of Parkinsonism and Related Disorders, Editor-in-Chief of the Polish Edition of Neurology, and Regional Editor of the European Journal of Neurology, serves as an editorial board member of Neurologia i Neurochirurgia Polska, Advances in Rehabilitation, Medical Journal of the Rzeszow University, and Clinical and Experimental Medical Letters; holds patents that may accrue revenue, Mayo file #: 2004-185, 2004-291, and 2007-104; receives royalties from Parkinsonism and Related Disorders (Elsevier), Polish Edition of Neurology (Medycyna Praktyczna), and European Journal of Neurology (Wiley-Blackwell); received educational grant support from Allergan, Inc; received research support from NIH P01A 017216-1 (Co.-Investigator), R01AG015866-1 (Co.-Investigator), P50NS 40256 (Clinical Core Leader); and CIHR P121849 (Co.-Inestigator); received research support from Mayo Clinic Florida Research Committee CR program; received research support from PARF C06-01 and through gift of Carl Edward Bolch, Jr. and Susan Bass Bolch. Carrie Le has nothing to disclose. Dr. LeDoux serves on the scientific advisory board for the Dystonia Medical Research Foundation; serves on the editorial board of Parkinsonism and Related Disorders; serves on the speakers’ bureaus for Lundbeck, Inc., and Teva Neuroscience; serves on the Xenazine advisory board for Lundbeck, Inc.; receives research support from NIH, Bachmann-Strauss Dystonia & Parkinson Foundation, Parkinson’s & Movement Disorder Foundation, NeuroSearch, Boehringer Ingelheim Pharmaceuticals, Inc., and HP Therapeutics Foundation; and receives royalty payments from for Animal Models of Movement Disorders (Elsevier, 2005).

Footnotes

Potential conflict of interest: None of the authors has any financial interest or conflicts of interest in the work presented in this manuscript.

Authors’ Roles:
  1. Research project: A. Conception, B. Organization, C. Execution;
  2. Statistical Analysis: A. Design, B. Execution, C. Review and Critique;
  3. Manuscript: A. Writing of the first draft, B. Review and Critique.
Xiao, 1, 2, 3; Zhao, 1C, 2, 3B; Bastian, 1C, 2C, 3B; Perlmutter, 1C, 2C, 3B; Racette, 1C, 2C, 3B; Tabbal, 1C, 2C, 3B; Karimi, 1C, 2C, 3B; Paniello, 1C, 2C, 3B; Wszolek, 1C, 2C, 3B; Uitti, 1C, 2C, 3B; Van Gerpen, 1C, 2C, 3B; Simon, 1C, 2C, 3B; Tarsy, 1C, 2C, 3B; Hedera, 1C, 2C, 3B; Truong, 1C, 2C, 3B; 1C, 2C, Frei, 1C, 2C, 3B; Blitzer, 1C, 2C, 3B; Rudzińska, 1C, 2C, 3B; Pfeiffer, 1C, 2C, 3B; Carrie Le, 1C, 2C, 3B; LeDoux, 1, 2, 3

REFERENCES

  • 1.Almasy L, Bressman SB, Raymond D, et al. Idiopathic torsion dystonia linked to chromosome 8 in two Mennonite families. Ann Neurol. 1997;42:670–673. doi: 10.1002/ana.410420421. [DOI] [PubMed] [Google Scholar]
  • 2.Fuchs T, Gavarini S, Saunders-Pullman R, et al. Mutations in the THAP1 gene are responsible for DYT6 primary torsion dystonia. Nat Genet. 2009;41:286–288. doi: 10.1038/ng.304. [DOI] [PubMed] [Google Scholar]
  • 3.Bressman SB, Raymond D, Fuchs T, Heiman GA, Ozelius LJ, Saunders-Pullman R. Mutations in THAP1 (DYT6) in early-onset dystonia: a genetic screening study. Lancet Neurol. 2009;8:441–446. doi: 10.1016/S1474-4422(09)70081-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Djarmati A, Schneider SA, Lohmann K, et al. Mutations in THAP1 (DYT6) and generalised dystonia with prominent spasmodic dysphonia: a genetic screening study. Lancet Neurol. 2009;8:447–452. doi: 10.1016/S1474-4422(09)70083-3. [DOI] [PubMed] [Google Scholar]
  • 5.Xiao J, Zhao Y, Bastian RW, et al. Novel THAP1 sequence variants in primary dystonia. Neurology. 2010;74:229–238. doi: 10.1212/WNL.0b013e3181ca00ca. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Paisan-Ruiz C, Ruiz-Martinez J, Ruibal M, et al. Identification of a novel THAP1 mutation at R29 amino-acid residue in sporadic patients with early-onset dystonia. Mov Disord. 2009;24:2428–2429. doi: 10.1002/mds.22849. [DOI] [PubMed] [Google Scholar]
  • 7.Houlden H, Schneider SA, Paudel R, et al. THAP1 mutations (DYT6) are an additional cause of early-onset dystonia. Neurology. 2010;74:846–850. doi: 10.1212/WNL.0b013e3181d5276d. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bonetti M, Barzaghi C, Brancati F, et al. Mutation screening of the DYT6/THAP1 gene in Italy. Mov Disord. 2009;24:2424–2427. doi: 10.1002/mds.22861. [DOI] [PubMed] [Google Scholar]
  • 9.Walter M, Bonin M, Pullman RS, et al. Expression profiling in peripheral blood reveals signature for penetrance in DYT1 dystonia. Neurobiol Dis. 2010;38:192–200. doi: 10.1016/j.nbd.2009.12.019. [DOI] [PubMed] [Google Scholar]
  • 10.Purcell S, Cherny SS, Sham PC. Genetic Power Calculator: design of linkage and association genetic mapping studies of complex traits. Bioinformatics. 2003;19:149–150. doi: 10.1093/bioinformatics/19.1.149. [DOI] [PubMed] [Google Scholar]
  • 11.Faul F, Erdfelder E, Lang AG, Buchner A. G*Power 3: a flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behav Res Methods. 2007;39:175–191. doi: 10.3758/bf03193146. [DOI] [PubMed] [Google Scholar]
  • 12.Defazio G, Abbruzzese G, Livrea P, Berardelli A. Epidemiology of primary dystonia. Lancet Neurol. 2004;3:673–678. doi: 10.1016/S1474-4422(04)00907-X. [DOI] [PubMed] [Google Scholar]
  • 13.Bessiere D, Lacroix C, Campagne S, et al. Structure-function analysis of the THAP zinc finger of THAP1, a large C2CH DNA-binding module linked to Rb/E2F pathways. J Biol Chem. 2008;283:4352–4363. doi: 10.1074/jbc.M707537200. [DOI] [PubMed] [Google Scholar]
  • 14.Clouaire T, Roussigne M, Ecochard V, Mathe C, Amalric F, Girard JP. The THAP domain of THAP1 is a large C2CH module with zinc-dependent sequence-specific DNA-binding activity. Proc Natl Acad Sci U S A. 2005;102:6907–6912. doi: 10.1073/pnas.0406882102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Cayrol C, Lacroix C, Mathe C, et al. The THAP-zinc finger protein THAP1 regulates endothelial cell proliferation through modulation of pRB/E2F cell-cycle target genes. Blood. 2007;109:584–594. doi: 10.1182/blood-2006-03-012013. [DOI] [PubMed] [Google Scholar]
  • 16.LeDoux MS. Meige syndrome: what's in a name? Parkinsonism Relat Disord. 2009;15:483–489. doi: 10.1016/j.parkreldis.2009.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Figure S1
Supp Figure S2
Supplementary Data

RESOURCES