Skip to main content
PLOS ONE logoLink to PLOS ONE
. 2011 Sep 23;6(9):e25380. doi: 10.1371/journal.pone.0025380

The Eukaryotic-Type Serine/Threonine Protein Kinase Stk Is Required for Biofilm Formation and Virulence in Staphylococcus epidermidis

Qian Liu 1,#, Jiajia Fan 1,#, Chen Niu 1, Decheng Wang 1, Jianping Wang 1, Xing Wang 1, Amer E Villaruz 2, Min Li 3, Michael Otto 2, Qian Gao 1,*
Editor: J Ross Fitzgerald4
PMCID: PMC3179523  PMID: 21966513

Abstract

Background

Serine/threonine kinases are involved in gene regulation and signal transduction in prokaryotes and eukaryotes. Here, we investigated the role of the serine/threonine kinase Stk in the opportunistic pathogen Staphylococcus epidermidis.

Methodology/Principal Findings

We constructed an isogenic stk mutant of a biofilm-forming clinical S. epidermidis isolate. Presence of stk was important for biofilm formation in vitro and virulence in a murine subcutaneous foreign body infection model. Furthermore, the stk mutant exhibited phenotypes indicating an impact of stk on metabolic pathways. Using different constructs for the genetic complementation of the stk mutant strain with full-length Stk or specific Stk domains, we determined that the Stk intracellular kinase domain is important for biofilm formation and regulation of purine metabolism. Site-specific inactivation of the Stk kinase domain led to defective biofilm formation, in further support of the notion that the kinase activity of Stk regulates biofilm formation of S. epidermidis. According to immunological detection of the biofilm exopolysaccharide PIA and real-time PCR of the PIA biosynthesis genes, the impact of stk on biofilm formation is mediated, at least in part, by a strong influence on PIA expression.

Conclusions

Our study identifies Stk as an important regulator of biofilm formation and virulence of S. epidermidis, with additional involvement in purine metabolism and the bacterial stress response.

Introduction

Reversible protein phosphorylation plays a fundamental role in signal transduction pathways in pro- and eukaryotes [1]. Various protein kinases mediate protein phosphorylation, which is generally coupled to dephosphorylation reactions catalyzed by protein phosphatases and enables translation of extracellular signals into cellular responses [2]. Since the first characterization of a eukaryote-like serine/threonine kinase (ESTK) in Myxococcus xanthus, similar ESTKs have been identified in numerous bacteria [3], [4], [5]. In particular, the Stk serine/threonine kinase has emerged as a critical signaling molecule in prokaryotes. In several bacterial species, Stk and similar proteins have been implicated in various phenotypes, including biofilm formation, cell wall biosynthesis, stress responses, metabolic pathways, autolysis and virulence [6], [7]. For example, a PknB-like sensor kinase with similarity to Stk proteins was found essential for growth in Mycobacterium tuberculosis [8] and further Stk-like proteins were reported to be involved in biofilm formation in Streptococcus mutans, Bacillus subtilis and Mycobacterium smegmatis [9], [10], [11]. Furthermore, Stk was shown to play a role in virulence in streptococci, M. tuberculosis, Yersinia pseudotuberculosis and Staphylococcus aureus [12], [13], [14], [15]. Hence, Stk homologues are widely distributed in bacteria and involved in diverse steps of bacterial pathogenesis.

The opportunistic pathogen Staphylococcus epidermidis, a member of the coagulase-negative staphylococci group, colonizes the skin and mucous membranes of the human body [16]. Unlike S. aureus, which produces a series of aggressive virulence determinants and frequently causes severe acute infections, S. epidermidis mainly causes persistent infections associated with biofilm formation on indwelling medical devices [17]. With the increasingly frequent application of such devices in recent years, S. epidermidis has drawn substantial interest as one of the most common causes of nosocomial infections [18].

Biofilms are multilayered, surface attached agglomerations of microorganisms which have intrinsic resistance to host immune defenses and antibiotic treatment. S. epidermidis biofilm formation occurs in two stages, including initial attachment to a surface and subsequent accumulation of cells, leading to multicellular structures [19]. Several factors have been identified to play a significant role in biofilm formation of S. epidermidis. Determinants that affect primary attachment to abiotic surfaces include the bifunctional adhesin and autolysin AtlE, the biofilm associated protein Bap, the fibrinogen-binding protein Fbe/SdrG and the fibronectin-binding protein Embp [20], [21], [22], [23]. Polysaccharide intercellular adhesin (PIA) is crucial for biofilm formation in vitro and biofilm-associated infections [24]. In particular in PIA-negative S. epidermidis, the accumulation-associated protein (Aap) serves as an intercellular adhesin [25], [26]. Other factors, including the ClpP protease, the DNA-binding protein SarZ, the substrate of ClpP, Spx, and extracellular DNA have also been reported to be directly or indirectly impact S. epidermidis biofilm formation [27], [28], [29], [30].

Biofilm formation in S. epidermidis is under the influence of a diverse range of regulatory mechanisms [17]. For example, the quorum-sensing system agr (accessory gene regulator) regulates adhesin factors during the early stage of biofilm formation [31]. The icaADBC locus, encoding the proteins responsible for the synthesis and deacetylation of PIA, is up-regulated by the global regulator sigma factor SigB [32]. The product of the icaR gene, located adjacent to the ica operon, is a negative regulator of the icaADBC operon [33]. However, the signaling networks that control S. epidermidis biofilm formation remain incompletely understood.

In the present study, we identified a putative ESTK protein-encoding gene (designated stk) and a co-transcribed eukaryotic-like serine/threonine phosphatase gene (designated stp) in S. epidermidis. To explore the function of Stk in S. epidermidis, we constructed and characterized an stk mutant strain, which revealed important roles of Stk in biofilm formation, virulence, and metabolism of S. epidermidis.

Results

Genome context of stk and stp in S. epidermidis

ESTKs have been identified in a wide range of prokaryotes. We performed a genome search (using BlastP, http://blast.ncbi.nlm.nih.gov/Blast.cgi) of S. epidermidis strain RP62A, which revealed the presence of a gene, SERP0786, whose protein product shows pronounced homology to Stk proteins in other species (36% identity with PrkC of B. subtilis and 67% identity with Stk of S. aureus) (Fig. 1A). We therefore designated the gene stk. The 3′ end of stk overlaps with the adjacent gene, which encodes a protein phosphatase (SERP0785, designated stp) (Fig. 1B). Thus, stk and stp are likely co-transcribed [34], which we confirmed by reverse transcription (RT-) PCR analysis using primers 41F and 30R, one of which hybridizes with a sequence within the stk and the other with one within the stp gene. RT-PCR analysis also demonstrated co-transcription of stp and stk with the adjacent up- and downstream genes, encoding a SAM protein and a hypothetical protein, respectively (Fig. 1C). Of note, the 666-amino acid (aa) Stk of S. epidermidis displays conserved motifs that fit the description of a Hank's-type ESTK [35]: it includes an intracellular ATP-binding kinase domain (9–263 aa), a transmembrane spanning domain (347–369 aa) and three extracellular PASTA (penicillin and Ser/Thr kinase associated) repeated domains (376–437 aa, 444–483 aa, 514–572 aa) [36]. Within the N-terminal catalytic kinase domain, the protein harbors an important ATP-binding site (16–39 aa) that is presumably essential for kinase activity (Fig. 2A).

Figure 1. The genomic context of stk and stp in S. epidermidis.

Figure 1

A. Alignment of stk sequences of S. epidermidis 1457 with those of S. aureus and B. subtilis, showing conserved amino acid positions at the bottom. B. Schematic of the stk/stp genetic locus showing primer annealing sites. The four nucleotides by which the two genes overlap are in bold. The stop codon for stp is underlined. C. Co-transcription analysis of the four genes SERP0784 to SERP0787 using reverse transcription (RT-) PCR analysis with genomic DNA (gDNA), RNA or cDNA as templates. Lanes 1, 4, and 7 represent the amplification using primer set 39F and 40R, lanes 2, 5, and 8 represent the amplification using primer set 41F and 30R, lanes 3, 6, and 9 represent the amplification using primer set 35F and 42R.

Figure 2. Stk influences biofilm formation in vitro.

Figure 2

A. Architecture of stk complementation constructs. Slashed lines denote the ATP-binding site of Stk. The primers used for the amplification of specific domains are indicated by arrows. TM, transmembrane. B. Influence of Stk and Stk domains on S. epidermidis biofilm formation. The stk mutant strain was complemented with plasmids expressing different domains of Stk: pQG71, full length; pQG72, kinase domain; pQG73, transmembrane domain; pQG74, PASTA repeated domain; pQG75, C-terminal domain; pQG76, kinase domain without ATP-binding site; pQG80, kinase domain with D133E mutation; pQG81, kinase domain with D126E mutation, and biofilm formation in comparison to the stk mutant and WT strains was determined in vitro by semiquantitative biofilm assays. Data were derived from three independent experiments, with 4 replicates in each experiment. **, P<0.01 (versus WT).

Inactivation of stk in S. epidermidis results in reduced biofilm formation in vitro

To investigate the role of Stk in S. epidermidis physiology and pathogenesis, we constructed an isogenic deletion mutant of the stk gene in the biofilm-forming clinical isolate S. epidermidis 1457. Then, to determine whether stk influences biofilm formation as a main virulence phenotype in S. epidermidis, we analyzed biofilm formation by a semi-quantitative colorimetric assay. We found that in-vitro biofilm formation of the stk mutant strain was significantly impaired compared to the WT strain (Fig. 2B). The impact of stk on biofilm formation was confirmed by genetic complementation with the entire copy of stk expressed from a plasmid (Δstk (pQG71)) (Fig. 2B). The complemented strains showed much higher biofilm-forming capacity compared to the WT, which is likely mainly due to a plasmid copy effect and the use of a strong promoter (ica) to express the stk gene.

To study which stage of biofilm formation is influenced by stk, we performed a primary attachment assay and found that the stk mutant strain displayed decreased attachment ability to polystyrene compared with the WT strain, while this ability was restored in the complemented mutant strain (Fig. 3A). Furthermore, immunoblot analysis of polysaccharide intercellular adhesin (PIA), a key factor contributing to biofilm accumulation of S. epidermidis [37] demonstrated that stk positively affects PIA production and thus the second stage of biofilm formation (Fig. 3B). These observations indicate that stk is an important regulator of S. epidermidis biofilm formation in both the initial and accumulative stages.

Figure 3. Stk influences primary attachment and PIA production in vitro.

Figure 3

A. Influence of Stk and Stk domains on primary attachment. The stk mutant strain was complemented with plasmids expressing different domains of Stk: pQG71, full length; pQG72, kinase domain; pQG73, transmembrane domain; pQG74, PASTA repeated domain; pQG75, C-terminal domain; pQG76, kinase domain without ATP-binding site; pQG80, kinase domain with D133E mutation; pQG81, kinase domain with D126E mutation, and primary attachment was determined. Data were derived from three independent experiments, with 4 replicates in each experiment. *, P<0.05 (versus WT). B. Influence of Stk and Stk domains on polysaccharide intercellular adhesin (PIA) production. PIA was determined in the same strains as in (A) using immunodot blots with anti-PIA serum and photodigital evaluation. Values represent the means ± standard errors of the means from three independent experiments, *, P<0.05 (versus WT).

The kinase activity of Stk is crucial for biofilm formation in S. epidermidis

To determine which domains of the Stk protein are important for its influence on biofilm formation, we genetically complemented the stk mutant strain with constructs expressing different Stk domains (Fig. 2A). Only the strain expressing the kinase domain (Δstk (pQG72)) restored biofilm formation to a level comparable to that of the WT, whereas the strains expressing only the transmembrane segment (Δstk (pQG73)), the PASTA repeated domain (Δstk (pQG74)) or the C-terminal segment (Δstk (pQG75)) did not form a biofilm. Similarly, a strain expressing a truncated kinase domain lacking the conserved ATP-binding site (Δstk (pQG76)) also did not form biofilm (Fig. 2B).

As it has been reported that the conserved aspartic acid residue D126 is crucial for the catalytic activity of the enzyme [13], we confirmed the role of the kinase activity in biofilm formation in S. epidermidis using a D126E mutant (Δstk (pQG81)). In addition, we mutated the D133 residue that is in close proximity to D126 to investigate the specificity of the effect exerted by the D126E exchange. The D126E mutant showed significantly decreased biofilm formation compared to the clone expressing the unaltered kinase domain, while biofilm formation of the D133E mutant (Δstk (pQG80)) was not changed (Fig. 2B). Corresponding results were achieved in the primary attachment and PIA production assays (Fig. 3). These findings indicated that the kinase activity of Stk is crucial for its impact on primary attachment, PIA production, and biofilm formation.

The predicted kinase domain of S. epidermidis Stk has kinase activity

To further confirm the involvement of the kinase domain in kinase activity, we produced GST fusion constructs with the entire Stk protein, only the kinase domain, or an inactivated kinase domain, in which the ATP-binding cassette was deleted. In kinase assays, only the GST fusion construct with the kinase domain lacking the ATP binding cassette did not exhibit activity, showing that the cassette is crucial for kinase activity (Fig. 4A). Staurosporine, a potent protein kinase inhibitor, inhibited the WT Stk activity in a dose-dependent manner, showing significant inhibition at a concentration of 320 µM and above (Fig. 4B).

Figure 4. The kinase activities of GST fusion proteins were measured in vitro.

Figure 4

A. Phosphorylation activities of GST fusion proteins containing full-length Stk (using plasmid pQG77), Stk1–263 (pQG78) or Stk40–263(pQG79) were measured with a Kinase-Glo™ luminescent kinase assay in vitro at 32°C for 4 h. B. Phosphorylation activities of GST fusion proteins containing full-length Stk (using plasmid pQG77) were measured with a Kinase-Glo™ luminescent kinase assay with or without staurosporine in vitro at 32°C for 4 h. GST was used as a negative control. RLU, relative luminescent unit. Data are derived from three independent experiments, **, P<0.01; ***, P<0.001 (versus GST).

Effect of the stk mutation on the transcription of biofilm-related genes

ESTKs commonly serve as global regulators of gene expression [38]. To analyze whether the impact of S. epidermidis Stk on biofilm formation is mediated by altering expression of biofilm-related regulatory or structural genes, we tested the transcriptional levels of several such genes in the stk mutant and wild-type strains by quantitative RT-PCR. We detected a significant positive impact of stk on the expression of the icaB and atlE genes, as expected from our results showing increased PIA production and primary attachment, of which AtlE is a key determinant [21] (Fig. 5A&B). To examine whether stk has an impact on the expression of global regulatory system, we examined transcript levels of sarA and agr, the latter by measuring RNAIII. The transcript levels of agr were up-regulated significantly in the mutant strain compared with WT strain (Fig. 5C). In contrast, stk did not impact expression of sarA (data not shown). Interestingly, we also did not detect an impact on the expression of the icaR regulatory gene (data not shown), indicating that the icaADBC but not the icaR promoter is under the influence of stk-dependent regulation.

Figure 5. Influence of Stk on the expression of the biofilm-associated genes.

Figure 5

The stk mutant strain was complemented with plasmids expressing Stk full length (pQG71) and expression of the icaB (to monitor expression of the icaADBC operon), RNAIII and atlE genes was determined in samples prepared from exponential-phase (OD600 = 0.5) cells grown in BM, using quantitative RT-PCR. Data were derived from three biological repeats. **, P<0.01; ***, P<0.001(versus WT).

The role of stk in the pathogenesis of S. epidermidis biofilm-associated infection

To investigate the impact of stk on biofilm-associated infection in vivo, we performed a murine subcutaneous foreign body infection model. Progression of disease was measured by determining bacterial loads on the implanted catheters after sacrifice of the test animals. We detected a significantly lower bacterial load in animals infected with the stk mutant compared to those infected with the WT strain (Fig. 6A), indicating that stk contributes to pathogen survival during S. epidermidis infection. Furthermore, histopathological analysis demonstrated that inflammatory lesions were stronger in the epithelial tissue around the implanted device of the mice infected with the WT strain compared to those infected with the mutant strain (Fig. 6B–E). Fibrous structures of epithelial tissues were severely damaged and numerous inflammatory cells were found that had infiltrated into the infected tissues in the WT group. Among those cells, neutrophils were the predominant type by microscopic analysis. In contrast, in the epithelial tissues of mutant-infected mice only mild inflammatory responses (few infiltrated inflammatory cells and slight tissue lesions) were observed. These results indicated that stk plays a significant role in biofilm-associated infection in S. epidermidis.

Figure 6. Murine model of subcutaneous catheter infection.

Figure 6

A. Catheters were inserted into the subcutaneous tissue of mice, followed by the injection of 1×107 CFU of the S. epidermidis 1457 WT or stk mutant strain. After 10 days, catheters were removed from all mice and CFUs of recovered bacteria on the catheters were counted. Data were analyzed using a Mann-Whitney test. The horizontal line represents the median. ***, P<0.001. B–E. Histopathological analysis of skin tissues around catheters infected with either S. epidermidis 1457 wild-type (B, D) or its isogenic stk mutant (C, E). B, C: Low magnification (100×); D, E: High magnification (200×). * denotes disseminated inflammatory cells, # denotes disrupted structure, N denotes normal structure. The black arrow in the panel B insert (400× magnification) indicates infiltrating neutrophils.

Phenotypic analysis of an isogenic S. epidermidis stk deletion mutant

We then analyzed whether Stk has an influence on metabolic pathways, as these phenotypes are reportedly under Stk control in other bacteria [7], [39], [40]. Growth of the isogenic stk mutant in TSB was similar to that of the WT strain (data not shown). However, in defined RPMI 1640 medium growth of the stk mutant strain was slower compared to the WT strain, while supplementing the medium with 200 µM adenine partially reversed the growth defect of the stk mutant strain (Fig. 7A). Interestingly, in addition to full-length Stk, the Stk kinase domain alone was able to complement the growth defect of the stk mutant, in contrast to the PASTA domains or an inactivated kinase domain (Fig. 7B). To analyze whether the impact of S. epidermidis Stk on purine biosynthesis is mediated by altering expression of purine-related regulatory genes, we tested the transcriptional levels of several such genes in the stk mutant and WT strains by quantitative RT-PCR. We detected a significant positive impact of stk on the expression of the purA gene (Fig. 7C). In contrast, stk did not impact expression of purR (data not shown). These results indicated that Stk in S. epidermidis is involved in purine biosynthesis through the kinase activity, maybe by regulating the expression of purA gene.

Figure 7. Stk is involved in purine biosynthesis in S. epidermidis.

Figure 7

A. Growth curve of S. epidermidis 1457 WT and the isogenic stk mutant. Growth was determined by measuring OD600 of cell cultures grown in RPMI 1640 synthetic medium at 37°C with or without addition of 200 µM adenine (Ade). B. Growth curves of stk mutant strains with different complementation plasmids: pQG71 (stk full length), pQG72 (stk kinase domain), pQG74 (stk PASTA repeated domain), pQG75 (stk C-terminal domain), pQG76 (stk kinase domain without ATP-binding site). Cell growth was monitored at OD600 in RPMI 1640 synthetic medium at 37°C. C. Expression levels of purA was determined in samples prepared from exponential-phase (OD600 = 0.5) cells grown in BM, using quantitative RT-PCR. Data were derived from three biological repeats. *, P<0.05 (versus WT).

Furthermore, the stk mutant was more resistant to Triton X-100 induced lysis than the WT strain, which could be complemented with the PASTA, but not the kinase domain (Fig. 8A). Moreover, culture filtrate of the stk mutant strain exhibited diminished autolytic activity, which also could be complemented with the PASTA but not the kinase domain (Fig. 8B). These results indicated that Stk in S. epidermidis is involved in the bacterial stress response.

Figure 8. Impact of Stk on cell wall-related phenotypes.

Figure 8

A. Triton X-100-induced autolysis of S. epidermidis strains. Cells of the WT, the stk mutant, and the mutant complemented with the kinase domain (Δstk (pQG72)), or PASTA repeated domain (Δstk (pQG74)), were treated with 0.1% Triton X-100. B. Autolysin activity. Bacteriolytic activities of secreted autolysin in the supernatants of stationary phase cultures of the WT, the stk mutant and the complemented strains (Δstk (pQG72) and Δstk (pQG74)), were determined using heat-killed S. epidermidis 1457 WT cells as the substrate. TSB was used as media control.

Discussion

In this study, we characterized the genetic locus encoding the ESTK-like Stk protein of S. epidermidis and report on the roles of this gene in physiology and virulence. Similar to S. aureus and Streptococcus pyogenes [34], [39], the stk gene is adjacent to, and as we show here co-transcribed with, the stp gene encoding the cognate phosphatase. Deletion of stk did not have an effect on the transcription of stp, as shown by quantitative RT-PCR (data not shown). Since biofilm formation is a crucial mechanism by which S. epidermidis escapes human host defenses, we determined whether stk contributes to biofilm formation in S. epidermidis. Our data show that stk is involved in both the initial attachment and subsequent accumulation stages of biofilm formation and this impact is mediated at least in part by altering expression of the global regulator agr, atlE genes and the ica operon, the latter resulting in increased production of the biofilm exopolysaccharide PIA. Likely as a consequence of the impact of stk on these biofilm- and immune evasion-related genes, we also detected a significantly decreased virulence potential of the stk mutant strain in a murine subcutaneous foreign body infection model. This is consistent with reports on the in-vivo role of Stk in other prokaryotes such as S. aureus, S. pneumoniae and M. tuberculosis [12], [41], [42]. Of note, the effect of stk on S. epidermidis pathogenesis may be largely dependent on the strong regulation of PIA synthesis, since PIA acts both as a matrix and contributes to immune evasion [43], [44], [45].

Similar to other serine/threonine kinases in Gram-positive bacteria, the Stk protein of S. epidermidis has two domains (four segments), including an amino-terminal kinase domain, a transmembrane segment, an extracellular PASTA domain (three PASTA repeats) and a carboxyl-terminal part [46]. We showed here that the kinase domain, whose kinase activity we confirmed, is crucial for the impact of Stk on the detected in-vitro biofilm phenotype.

According to our results, S. epidermidis Stk is also involved in the regulation of metabolism. In particular, delayed growth in RPMI medium, which could be overcome by adding adenine and genetic complementation with the kinase domain, indicated an impact of Stk on purine metabolism that is dependent on the Stk kinase domain. Our results are consistent with previous reports showing that a mutant of the purine biosynthesis gene purR of S. epidermidis displayed lower PIA production and was biofilm-negative [47], [48] and a study that showed regulation of purine biosynthesis by the ESTK protein PknB of S. aureus, which regulates the adenylosuccinate synthase PurA via reversible phosphorylation [38]. It has been reported that kinase-dependent phosphorylation decreases PurA activity and is responsible for regulating purine biosynthesis in Streptococcus agalactiae [49], which seems to contrast our results. However, it is conceivable that PurA activity is regulated at the transcriptional and/or translational levels in different organisms. How exactly PurA function is regulated in S. epidermidis remains to be investigated.

Furthermore, we showed that Stk had a significant influence on the bacterial stress response. The influence was mainly dependent on the extracellular PASTA domains, which are highly conserved and comprise three beta sheets and an alpha helix that binds the beta-lactam stem [50]. Stk proteins containing PASTA domains have been shown to play a key role in cell wall biosynthesis and suggested to sense dissociated peptidoglycan subunits [13], [36], [51]. It is likely that the PASTA repeats of the S. epidermidis Stk protein also recognize unlinked peptidoglycan and binding of those structures activates the Stk cytoplasmic N-terminal kinase domain.

In conclusion, to our knowledge this is the first study to show that Stk influences biofilm formation through its kinase activity and has an impact on virulence in S. epidermidis. Additionally, we showed that stk is involved in purine biosynthesis and stress response in S. epidermidis. While it is likely that Stk exerts its regulatory function directly through phosphorylation of proteins involved in biofilm formation or metabolism, with several such Stk substrates having been identified in other organisms to date [34], [52], [53], the specific substrates of Stk in S. epidermidis remain to be determined.

Materials and Methods

Ethics Statement

Forty BALB/c mice were bought from Laboratory Animal Center of Fudan University. All animal work was approved by the Institutional Animal Care and Use Committee (IACUC), Fudan University Shanghai Medical College. IACUC Animal Project Number (APN): 20061203-gao.

Bacterial strains and growth conditions

The bacteria and plasmids used are listed in Table 1. Escherichia coli DH5α and BL21 DE3 pLysS were grown in Luria-Bertani (LB) medium. Plasmid-containing E. coli strains were grown in the same medium but with ampicillin (100 µg/ml) or kanamycin (20 µg/ml) included, as appropriate. S. aureus RN4220 was used as a gateway strain for plasmid transformation into target S. epidermidis strains. S. epidermidis and its derivative strains were cultured in tryptic soy broth (TSB, Oxoid) or basic medium (BM: 1% (wt/vol) trypton, 0.5% (wt/vol) yeast extract, 0.1% (wt/vol) glucose, 85 mM NaCl, 4 mM K2PO4), and when necessary, erythromycin (10 µg/ml), chloramphenicol (10 µg/ml), and anhydrous tetracycline (1 µg/ml) were supplemented. Media were solidified with 1.5% (wt/vol) agar as needed.

Table 1. Bacterial strains and plasmids used in this study.

Strain or plasmid Descriptiona Source or reference
Strains
S. epidermidis 1457 Clinical isolate, biofilm positive [62]
S. aureus RN4220 Clining host, restriction negative, modification positive [63]
E. coli DH5α supE44 ΔlacU169 (Φ80dlacZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 Invitrogen
E. coli BL21 DE3 pLysS E. coli B F- ompT hsdSB(rB-, mB-) gal dcm (DE3) pLysS CamR Invitrogen
Plasmids
pKOR1 Shuttle vector, temperature sensitive, vector for allelic replacement via lambda recombination and ccdB selection CmR AmpR [56]
pKOR1stk pKOR1 harboring the stk gene, CmR AmpR This study
pYJ90 Shuttle vector, AmpR ErmR [64]
pQG70 pYJ90 harboring the promoter sequence of icaADBC, AmpR ErmR This study
pQG71 pYJ70 harboring the full-length stk gene, AmpR ErmR This study
pQG72 pYJ70 harboring the stk gene kinase domain, AmpR ErmR This study
pQG73 pYJ70 harboring the stk gene transmembrane domain, AmpR ErmR This study
pQG74 pYJ70 harboring the stk gene three repeated PSATA domains, AmpR ErmR This study
pQG75 pYJ70 harboring the stk gene C-terminal domain, AmpR ErmR This study
pQG76 pYJ70 harboring the stk gene kinase domain without ATP-binding site, AmpR ErmR This study
pQG80 pYJ70 harboring the stk gene kinase domain with an Asp to Glu exchange at position 133, AmpR ErmR This study
pQG81 pYJ70 harboring the stk gene kinase domain with an Asp to Glu exchange at position 126, AmpR ErmR This study
pET28a E.coli expression plasmid, KmR Novagen
pGEX-KG E.coli expression plasmid, AmpR Amersham
pQG77 pGEX-KG harboring full-length Stk, AmpR This study
pQG78 pGEX-KG harboring the Stk kinase domain (Stk1–263), AmpR This study
pQG79 pGEX-KG harboring the Stk kinase domain without ATP binding site (Stk40–263), AmpR This study
a

CmR, chloramphenicol resistance; AmpR, ampicillin resistance; ErmR, erythromycin resistance; KmR, kanamycin resistance.

DNA manipulation

Genomic DNA of S. epidermidis 1457 was prepared by a standard protocol for gram-positive bacteria [54]. Plasmid DNA from E. coli was extracted using a plasmid purification kit (Axygen). Plasmid DNA from S. aureus and S. epidermidis was extracted using the same kit except that the cells were incubated for at least 30 min at 37°C in solution I (P1, suspension buffer) with lysostaphin (0.8 µg/µl; Sigma) before solution II (P2, dissociation buffer) was added. PrimStar polymerase and restriction enzymes were obtained from New England Biolabs (NEB). S. epidermidis was transformed by electroporation as described previously [55].

Co-transcription assay

At an OD600 value of 0.5, cells in 1.5-ml TSB cultures were harvested and resuspended in 1.3 ml Trizol (Invitrogen). Cells were disrupted by shaking with a Mini-Beadbeater (Biospec Products) at maximum speed for 30 s. Tubes were then incubated on ice for 5 min. This shaking/cooling cycle was repeated 4 times. Then, the suspension was centrifuged. Total RNA isolation from the supernatant was performed in Trizol (Invitrogen) according to the manufacturer's instructions. After treatment using a TURBO DNA-free™ kit (Ambion), approximately 2 µg total RNA was used to create cDNA using a PrimeScript RT reagent kit (TaKaRa). An identical reaction was performed without reverse transcriptase as a negative control. cDNA with or without reverse transcriptase and genomic DNA (gDNA) were used as templates in PCRs using specific primer sets specific for overlapping (41F/30R), and outermost regions of stp and stk (39F/40R and 35F/42R), as shown in Fig. 1B.

Construction of an isogenic stk deletion mutant and complemented strains

To delete the stk gene in S. epidermidis 1457, ∼1-kb DNA fragments, upstream and downstream of stk, were amplified by PCR from the chromosomal DNA of S. epidermidis 1457 using the primers listed in Table 2, introducing an overlapping sequence of ∼15 bp. The resulting fusion PCR fragment with attB sites at both ends was used for recombination with plasmid pKOR1, yielding plasmid pKOR1stk. It was transferred via electroporation first to S. aureus RN4220 and then to S. epidermidis 1457. Allelic replacement and selection of positive clones were performed as described [56]. The integration site was verified by analytical PCR and sequencing. As the sequence and location of the endogenous promoter that facilitates stk transcription in S. epidermidis are unknown, we used the promoter sequence of the icaADBC operon for the construction of a genetic complementation plasmid. This fragment was amplified from S. epidermidis 1457 genomic DNA by PCR using the primer set Pica1 and Pica2 and cloned into EcoRI and XmaI sites of EcoRI/XmaI-digested pYJ90, yielding pQG70. Plasmid pQG71 (stk full length complementing plasmid) was constructed by cloning the entire coding region of stk (1998 bp) into BamHI/XmaI-digested pQG70, using the primer set stk-F and stk-R. Plasmids pQG72 (stk kinase domain complementing plasmid), pQG73 (stk transmembrane domain complementing plasmid), pQG74 (stk PASTA repeated domain complementing plasmid), pQG75 (stk C-terminal domain complementing plasmid) and pQG76 (stk kinase domain without ATP-binding site complementing plasmid) were constructed by cloning the respective domains into BamHI/XmaI-digested pQG70, using the following primers: 29F and 30R for the kinase domain, 31F and 32R for the transmembrane domain, 33F and 34R for the PASTA domain, 35F and 36R for the C-terminal domain, and 57F and 30R for the kinase domain without ATP-binding segment. All these plasmids (Table 1) were used to transform the stk mutant strain.

Table 2. Primers used in this study.

Primer Sequence (5′-3′)a
SEAtt1 GGGGACCACTTTGTACAAGAAAGCTGGGTTACCGTCCATCACATCAAAG
SERev1 ACTTTATCACCTTCTAACTTTAAAAGGATA
SERev2 CTTTTAAAGTTAGAAGGTGATAAAGTATGAGTAACAACTAATGGGAAGTAGAT
SEAtt2 GGGGACAAGTTTGTACAAAAAAGCAGGCTGTAAAATTGTTTCTACAGATGTTCCGGGA
Stk-F TCCCCCCGGGAGGAGGTGATAAAGTATGATAGGTAAA
Stk-R CGTGGATCCCCCATTAGTTGTTACTCATTTAGCC
29F TCCCCCCGGGAGGAGGATGATAGGTAAAGTCATAAATGAAC
30R CGCGGATCCGCGTTACATTTCTTGAACAGTATGATA
31F TACCCCCGGGAGGAGGATGTGTGACGATTTAACAAGTGCG
32R CGCCGCGGATCCGCGCTATTCTTCATATTTATTTCC
33F TACCCCCGGGAGGAGGATGCCTGATCTTAAAGGGAAA
34R CGCCGCGGATCCGCGCTAAGAAACTACTAATAGTATAGT
35F TCCCCCCGGGAGGAGGATGAAAGGAGAAAAGTCTGATGAA
36R CGCGGATCCTTAGCCATCATAGCTCACATC
57F ATATCCCGGGAGGAGGATGGCGATTTCGATTCCTCCAAGT
39F TGCCACGTTAATTTAATACCA
40R CACGATTCAGCACGATTTATT
41F GGGGCAAATTACTAAAGATGAAGC
42R CGCCCACCACAGGTGAAAACTTC
17F CCGGAATTCATAGGTAAAGTCATAAATGAAC
18R AAGGAAAAAAGCGGCCGCTTAGCCATCATAGCTCACATC
58F ATGAATTCTGATGGCGATTTCGATTCCTCCAAGT
59F CGGAATTCGGATGATAGGTAAAGTCATAAAT
60R GCCAAGCTTTTACATTTCTTGAACAGTATGAT
43F GCGCATGACATGAGAATTGTTCATCGCGAGATTAAACCACAG
44R CTGTGGTTTAATCTCGCGATGAACAATTCTCATGTCATGCGC
53F GAGTGGAATCAAACATGCGCATGAGATGAGAATTGTTCA
54R TGAACAATTCTCATCTCATGCGCATGTTTGATTCCACTC
Pica1 CGGGAATTCAGTGCTTCTGGAGCACTAAAC
Pica2 CGGGATCCACCTACCTTTCGTTAGTTAGG
RT-gyrB1 TGACGAGGCATTAGCAGGTT
RT-gyrB2 GTGAAGACCGCCAGATACTTT
RT-atlE1 GATGGATTGCTGCTAAGGATTT
RT-atlE2 TATCGGTTTGCTTTTGTTGG
RT-icaB1 GAAACAGGCTTATGGGACTTTG
RT-icaB2 CAAGTGCGCGTTCATTTTT
RT-icaR1 CATTGACGGACTTTACCAGTTTT
RT-icaR2 ATCCAAAGCGATGTGCGTAG
RT-purA1 GCATACGTAGATAAAGCACAA
RT-purA2 TGGACAAGTTTCGTTAAACAT
RT-purR1 ACTTGATGCTGTTGTTACCAT
RT-purR2 CCTTCTGTAACTTTATTGTCCT
a

Incorporated restriction sites are in italic and underlined, attB sites are boldfaced and underlined, while the mutation sites are boldfaced and in italic.

Site-directed mutagenesis

Site-directed mutagenesis was performed as described by Ho et al [57]. Briefly, a DNA fragment with the stk gene carrying a distinct single aspartic acid residue codon mutated to glutamic acid at position 133, or 126 was cloned into pQG70, yielding pQG80 and pQG81 respectively. The oligonucleotide primers 43F and 44R were used for mutagenesis at D133, while 53F and 54R were used for mutagenesis at D126. The presence of the mutation was verified by DNA sequencing. The two plasmids (Table 1) were used to transform the stk mutant strain.

Semi-quantitative biofilm assay

Semi-quantitative biofilm assays were performed as described in our previous work [58]. Briefly, overnight cultures of S. epidermidis strains were diluted 1∶100 into fresh TSB. The diluted cultures were pipetted into sterile 96-well flat-bottom tissue culture plates and incubated at 37°C for 24 h. Culture supernatants were gently removed, and wells were washed with phosphate-buffered saline (PBS). The adherent organisms at the bottom of the wells were fixed by Bouin fixative over 1 h. Then the fixative was gently removed, wells were washed with PBS and stained with 0.4% (wt/vol) crystal violet. Biofilm formation was measured with a MicroELISA autoreader.

Primary attachment assay

The assay was performed as described in our previous work [58]. Briefly, overnight cultures of S. epidermidis strains were diluted in fresh BM to an OD600 value of 0.02 and grown at 37°C to an OD600 value of 1.0. The cultures were pipetted into sterile 96-well flat-bottom tissue culture plates and incubated at 37°C for 1 h. The subsequent procedures were the same as those applied for the semi-quantitative biofilm assay.

Immuno-dot blot analysis of PIA production

Immuno-dot blot assays were performed as described in our previous work [59]. PIA samples were isolated from the surface of cells in exponential growth phase (4 h) by boiling with 0.5 M EDTA. PIA production was determined by immuno-dot blot analysis using anti-PIA sera and quantified by photodigital analysis.

Expression and purification of recombinant proteins

Different-length DNA fragments of the 2-kb coding region of stk were produced using genomic DNA of S. epidermidis as a template. The primers are listed in Table 2. The full-length PCR product of stk using primers 17F and 18R was digested with NotI and EcoRI and ligated into pET28a, yielding 6His-tagged protein (pET28a-Stk). As no tagged protein was expressed in pET28a, the stk fragment was acquired from pET28a-Stk plasmid digested with BamHI and XhoI and subcloned into vector pGEX-KG, yielding pQG77 (WT Stk, Stk full length expression plasmid), allowing in-frame fusion with glutathione S-transferase (GST) [60]. Plasmids expressing GST fusions were constructed as follows: Stk codons corresponding to amino acid positions 1 to 263 (kinase domain, Stk1–263) were amplified using primers 59F and 60R introducing EcoRI and HindIII sites, and inserted into pGEX-KG (yielding pQG78). Stk codons corresponding to amino acid positions 40–263 (Stk kinase domain without ATP-binding site, Stk40–263) were amplified using primers 58F and 60R introducing EcoRI and HindIII and ligated into pGEX-KG (yielding pQG79). The resulting plasmids (Table 1) were used to chemically transform E. coli BL21 DE3 pLysS competent cells. The recombinant GST-tagged fusion proteins were expressed by the addition of 0.5 mM isopropyl-β-D-thiogalactopyranoside (IPTG) overnight at 16°C . The purification of the GST-tagged proteins were performed using GST-binding resin (Novagen) according to the manufacturer's instruction. Proteins were eluted with 20 mM glutathione prepared in 50 mM Tris-HCl (pH 8.0). Purified proteins were concentrated and dialyzed against PBS, using a 10 K and 30 K molecular weight dialysis cassette (Sangon Co.). Concentrations of proteins were determined using a Bradford Protein Assay kit (Sangon Co.) using bovine serum albumin as standard.

In vitro kinase assay

For the in vitro kinase assay, 2 µg of WT Stk, Stk1–263 or Stk40–263 and 1 µg histone 1 (H1) were incubated separately in 50 µl kinase buffer (50 mM Tris-HCl [pH 7.5], 100 µM dithiothreitol [DTT], 1 mM MnCl2, 100 µM ATP) for 4 h at 32°C Kinase activity was assayed using a Kinase-Glo™ Luminescent Kinase Assay kit (Promega) and the luminescent signal reflecting the ATP level in the reaction system was measured in a Victor 3 plate reader. Staurosporine (Sangon Co.) was pre-incubated with WT Stk for 30 min at room temperature. The luminescent signal inversely correlates to the amount of kinase activity. All reactions were performed in triplicate.

Quantitative real time polymerase chain reaction (RT-PCR)

S. epidermidis strains were grown in BM. Sample collection and RNA extraction were performed as described above. After treatment using a TURBO DNA-free™ kit (Ambion), approximately 2 µg of total RNA were reverse-transcribed with a PrimeScript RT reagent kit (TaKaRa). The cDNA was used as a template for real-time PCR using SYBR-green PCR reagents (TaKaRa). Reactions were performed in a MicroAmp Optical 96-well reaction plate using a 7500 Sequence Detector (Applied Biosystems). Primers used are listed in Table 2. All RT-PCR experiments were performed in triplicate, with gyrase B (gyrB) used as an internal control.

Animal infection model and histopathological analysis

A murine subcutaneous foreign body infection model was performed as described by Kadurugamuwa et al [61]. Briefly, forty male BALB/c mice (Academia Sinica, weight ∼20 g) were randomly and evenly divided into two groups and infected with WT or stk mutant bacteria. One-centimeter long silicon catheters (14 gauge) were implanted subcutaneously on each side at the flank of each mouse before injection of 107 CFU to the catheter bed. After ten days, the mice were sacrificed. Catheters were aseptically removed and manipulated with the method described previously except with a sonication time of 30 min. Then serial dilutions of the wash fluid were plated on TSB plates and the recovered S. epidermidis colonies were counted. For histological observations, the skin near the catheters were removed and immediately fixed in 2.5% (v/v) glutarildehyde-polyoxymethylene solution. These samples were embedded in paraffin and stained with hematoxylin and eosin (HE) and examined by light microscopy.

Autolysis and bacteriolysis assays

Autolysis assays were performed using exponential-phase cells [13]. In brief, cells were cultured in TSB, harvested at an OD600 of 0.7, washed twice with ice-cold, sterile PBS, resuspended in PBS plus 0.1% Triton X-100, and incubated at 37°C with shaking at 250 rpm, and the optical densities were serially monitored. Bacteriolytic assays were performed as follows. Heat-killed cells were used as substrates and bacterial supernatants as the source of secreted autolysins [41]. Heat-killed cells were resuspended in PBS by heating the bacterial suspension at 65°C for 2 h and normalized to an OD600 value of 5.0. Secreted autolysins in the culture supernatants were normalized to cells at an OD600 value of 5, and sterilized by passage through a 0.22-µm filter. Bacteriolytic activity was assessed by mixing 1 ml of heat-killed cells with 5 ml of supernatant (or media as a control), incubation at 37°C with shaking at 250 rpm, and serial monitoring of the optical densities.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: This study was supported by National Natural Science Foundation of China 30670108 and J0730860, and the Intramural Research Program of the National Institute of Allergy and Infectious Diseases, The National Institutes of Health, USA. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Hunter T. Protein kinases and phosphatases: the yin and yang of protein phosphorylation and signaling. Cell. 1995;80:225–236. doi: 10.1016/0092-8674(95)90405-0. [DOI] [PubMed] [Google Scholar]
  • 2.Shah IM, Laaberki MH, Popham DL, Dworkin J. A eukaryotic-like Ser/Thr kinase signals bacteria to exit dormancy in response to peptidoglycan fragments. Cell. 2008;135:486–496. doi: 10.1016/j.cell.2008.08.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Munoz-Dorado J, Inouye S, Inouye M. A gene encoding a protein serine/threonine kinase is required for normal development of M. xanthus, a gram-negative bacterium. Cell. 1991;67:995–1006. doi: 10.1016/0092-8674(91)90372-6. [DOI] [PubMed] [Google Scholar]
  • 4.Cozzone AJ. ATP-dependent protein kinases in bacteria. J Cell Biochem. 1993;51:7–13. doi: 10.1002/jcb.240510103. [DOI] [PubMed] [Google Scholar]
  • 5.Perez J, Castaneda-Garcia A, Jenke-Kodama H, Muller R, Munoz-Dorado J. Eukaryotic-like protein kinases in the prokaryotes and the myxobacterial kinome. Proc Natl Acad Sci U S A. 2008;105:15950–15955. doi: 10.1073/pnas.0806851105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Prisic S, Dankwa S, Schwartz D, Chou MF, Locasale JW, et al. Extensive phosphorylation with overlapping specificity by Mycobacterium tuberculosis serine/threonine protein kinases. Proc Natl Acad Sci U S A. 2010;107:7521–7526. doi: 10.1073/pnas.0913482107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Saskova L, Novakova L, Basler M, Branny P. Eukaryotic-type serine/threonine protein kinase StkP is a global regulator of gene expression in Streptococcus pneumoniae. J Bacteriol. 2007;189:4168–4179. doi: 10.1128/JB.01616-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Fernandez P, Saint-Joanis B, Barilone N, Jackson M, Gicquel B, et al. The Ser/Thr protein kinase PknB is essential for sustaining mycobacterial growth. J Bacteriol. 2006;188:7778–7784. doi: 10.1128/JB.00963-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hussain H, Branny P, Allan E. A eukaryotic-type serine/threonine protein kinase is required for biofilm formation, genetic competence, and acid resistance in Streptococcus mutans. J Bacteriol. 2006;188:1628–1632. doi: 10.1128/JB.188.4.1628-1632.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Madec E, Laszkiewicz A, Iwanicki A, Obuchowski M, Seror S. Characterization of a membrane-linked Ser/Thr protein kinase in Bacillus subtilis, implicated in developmental processes. Mol Microbiol. 2002;46:571–586. doi: 10.1046/j.1365-2958.2002.03178.x. [DOI] [PubMed] [Google Scholar]
  • 11.Gopalaswamy R, Narayanan S, Jacobs WR, Jr, Av-Gay Y. Mycobacterium smegmatis biofilm formation and sliding motility are affected by the serine/threonine protein kinase PknF. FEMS Microbiol Lett. 2008;278:121–127. doi: 10.1111/j.1574-6968.2007.00989.x. [DOI] [PubMed] [Google Scholar]
  • 12.Perez J, Garcia R, Bach H, de Waard JH, Jacobs WR, Jr, et al. Mycobacterium tuberculosis transporter MmpL7 is a potential substrate for kinase PknD. Biochem Biophys Res Commun. 2006;348:6–12. doi: 10.1016/j.bbrc.2006.06.164. [DOI] [PubMed] [Google Scholar]
  • 13.Debarbouille M, Dramsi S, Dussurget O, Nahori MA, Vaganay E, et al. Characterization of a serine/threonine kinase involved in virulence of Staphylococcus aureus. J Bacteriol. 2009;191:4070–4081. doi: 10.1128/JB.01813-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Wiley DJ, Nordfeldth R, Rosenzweig J, DaFonseca CJ, Gustin R, et al. The Ser/Thr kinase activity of the Yersinia protein kinase A (YpkA) is necessary for full virulence in the mouse, mollifying phagocytes, and disrupting the eukaryotic cytoskeleton. Microb Pathog. 2006;40:234–243. doi: 10.1016/j.micpath.2006.02.001. [DOI] [PubMed] [Google Scholar]
  • 15.Rajagopal L, Clancy A, Rubens CE. A eukaryotic type serine/threonine kinase and phosphatase in Streptococcus agalactiae reversibly phosphorylate an inorganic pyrophosphatase and affect growth, cell segregation, and virulence. J Biol Chem. 2003;278:14429–14441. doi: 10.1074/jbc.M212747200. [DOI] [PubMed] [Google Scholar]
  • 16.Fey PD, Olson ME. Current concepts in biofilm formation of Staphylococcus epidermidis. Future Microbiol. 2010;5:917–933. doi: 10.2217/fmb.10.56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Otto M. Staphylococcus epidermidis–the ‘accidental’ pathogen. Nat Rev Microbiol. 2009;7:555–567. doi: 10.1038/nrmicro2182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.National Nosocomial Infections Surveillance (NNIS) System Report, data summary from January 1992 through June 2004, issued October 2004. Am J Infect Control. 2004;32:470–485. doi: 10.1016/S0196655304005425. [DOI] [PubMed] [Google Scholar]
  • 19.Vuong C, Otto M. Staphylococcus epidermidis infections. Microbes Infect. 2002;4:481–489. doi: 10.1016/s1286-4579(02)01563-0. [DOI] [PubMed] [Google Scholar]
  • 20.Williams RJ, Henderson B, Sharp LJ, Nair SP. Identification of a fibronectin-binding protein from Staphylococcus epidermidis. Infect Immun. 2002;70:6805–6810. doi: 10.1128/IAI.70.12.6805-6810.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Heilmann C, Hussain M, Peters G, Gotz F. Evidence for autolysin-mediated primary attachment of Staphylococcus epidermidis to a polystyrene surface. Mol Microbiol. 1997;24:1013–1024. doi: 10.1046/j.1365-2958.1997.4101774.x. [DOI] [PubMed] [Google Scholar]
  • 22.Tormo MA, Knecht E, Gotz F, Lasa I, Penades JR. Bap-dependent biofilm formation by pathogenic species of Staphylococcus: evidence of horizontal gene transfer? Microbiology. 2005;151:2465–2475. doi: 10.1099/mic.0.27865-0. [DOI] [PubMed] [Google Scholar]
  • 23.Pei L, Flock JI. Lack of fbe, the gene for a fibrinogen-binding protein from Staphylococcus epidermidis, reduces its adherence to fibrinogen coated surfaces. Microb Pathog. 2001;31:185–193. doi: 10.1006/mpat.2001.0462. [DOI] [PubMed] [Google Scholar]
  • 24.Rohde H, Frankenberger S, Zahringer U, Mack D. Structure, function and contribution of polysaccharide intercellular adhesin (PIA) to Staphylococcus epidermidis biofilm formation and pathogenesis of biomaterial-associated infections. Eur J Cell Biol. 2009;89:103–111. doi: 10.1016/j.ejcb.2009.10.005. [DOI] [PubMed] [Google Scholar]
  • 25.Hussain M, Herrmann M, von Eiff C, Perdreau-Remington F, Peters G. A 140-kilodalton extracellular protein is essential for the accumulation of Staphylococcus epidermidis strains on surfaces. Infect Immun. 1997;65:519–524. doi: 10.1128/iai.65.2.519-524.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Rohde H, Burdelski C, Bartscht K, Hussain M, Buck F, et al. Induction of Staphylococcus epidermidis biofilm formation via proteolytic processing of the accumulation-associated protein by staphylococcal and host proteases. Mol Microbiol. 2005;55:1883–1895. doi: 10.1111/j.1365-2958.2005.04515.x. [DOI] [PubMed] [Google Scholar]
  • 27.Wang L, Li M, Dong D, Bach TH, Sturdevant DE, et al. SarZ is a key regulator of biofilm formation and virulence in Staphylococcus epidermidis. J Infect Dis. 2008;197:1254–1262. doi: 10.1086/586714. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Wang C, Li M, Dong D, Wang J, Ren J, et al. Role of ClpP in biofilm formation and virulence of Staphylococcus epidermidis. Microbes Infect. 2007;9:1376–1383. doi: 10.1016/j.micinf.2007.06.012. [DOI] [PubMed] [Google Scholar]
  • 29.Wang C, Fan J, Niu C, Villaruz AE, Otto M, et al. Role of spx in biofilm formation of Staphylococcus epidermidis. FEMS Immunol Med Microbiol. 2010;59:152–160. doi: 10.1111/j.1574-695X.2010.00673.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Qin Z, Ou Y, Yang L, Zhu Y, Tolker-Nielsen T, et al. Role of autolysin-mediated DNA release in biofilm formation of Staphylococcus epidermidis. Microbiology. 2007;153:2083–2092. doi: 10.1099/mic.0.2007/006031-0. [DOI] [PubMed] [Google Scholar]
  • 31.Vuong C, Gerke C, Somerville GA, Fischer ER, Otto M. Quorum-sensing control of biofilm factors in Staphylococcus epidermidis. J Infect Dis. 2003;188:706–718. doi: 10.1086/377239. [DOI] [PubMed] [Google Scholar]
  • 32.Knobloch JK, Bartscht K, Sabottke A, Rohde H, Feucht HH, et al. Biofilm formation by Staphylococcus epidermidis depends on functional RsbU, an activator of the sigB operon: differential activation mechanisms due to ethanol and salt stress. J Bacteriol. 2001;183:2624–2633. doi: 10.1128/JB.183.8.2624-2633.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Conlon KM, Humphreys H, O'Gara JP. icaR encodes a transcriptional repressor involved in environmental regulation of ica operon expression and biofilm formation in Staphylococcus epidermidis. J Bacteriol. 2002;184:4400–4408. doi: 10.1128/JB.184.16.4400-4408.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Jin H, Pancholi V. Identification and biochemical characterization of a eukaryotic-type serine/threonine kinase and its cognate phosphatase in Streptococcus pyogenes: their biological functions and substrate identification. J Mol Biol. 2006;357:1351–1372. doi: 10.1016/j.jmb.2006.01.020. [DOI] [PubMed] [Google Scholar]
  • 35.Hanks SK, Hunter T. Protein kinases 6. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J. 1995;9:576–596. [PubMed] [Google Scholar]
  • 36.Yeats C, Finn RD, Bateman A. The PASTA domain: a beta-lactam-binding domain. Trends Biochem Sci. 2002;27:438. doi: 10.1016/s0968-0004(02)02164-3. [DOI] [PubMed] [Google Scholar]
  • 37.Fujimoto K, Hara M, Yamada H, Sakurai M, Inaba A, et al. Role of the conserved Ser-Tyr-Lys triad of the SDR family in sepiapterin reductase. Chem Biol Interact. 2001;130–132:825–832. doi: 10.1016/s0009-2797(00)00238-6. [DOI] [PubMed] [Google Scholar]
  • 38.Donat S, Streker K, Schirmeister T, Rakette S, Stehle T, et al. Transcriptome and functional analysis of the eukaryotic-type serine/threonine kinase PknB in Staphylococcus aureus. J Bacteriol. 2009;191:4056–4069. doi: 10.1128/JB.00117-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Beltramini AM, Mukhopadhyay CD, Pancholi V. Modulation of cell wall structure and antimicrobial susceptibility by a Staphylococcus aureus eukaryote-like serine/threonine kinase and phosphatase. Infect Immun. 2009;77:1406–1416. doi: 10.1128/IAI.01499-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Liebeke M, Meyer H, Donat S, Ohlsen K, Lalk M. A metabolomic view of Staphylococcus aureus and Its Ser/Thr kinase and phosphatase deletion mutants: involvement in cell wall biosynthesis. Chem Biol. 2010;17:820–830. doi: 10.1016/j.chembiol.2010.06.012. [DOI] [PubMed] [Google Scholar]
  • 41.Tamber S, Schwartzman J, Cheung AL. Role of PknB kinase in antibiotic resistance and virulence in community-acquired methicillin-resistant Staphylococcus aureus strain USA300. Infect Immun. 2010;78:3637–3646. doi: 10.1128/IAI.00296-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Echenique J, Kadioglu A, Romao S, Andrew PW, Trombe MC. Protein serine/threonine kinase StkP positively controls virulence and competence in Streptococcus pneumoniae. Infect Immun. 2004;72:2434–2437. doi: 10.1128/IAI.72.4.2434-2437.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Fey PD. Modality of bacterial growth presents unique targets: how do we treat biofilm-mediated infections? Curr Opin Microbiol. 2010;13:610–615. doi: 10.1016/j.mib.2010.09.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Rupp ME, Ulphani JS, Fey PD, Mack D. Characterization of Staphylococcus epidermidis polysaccharide intercellular adhesin/hemagglutinin in the pathogenesis of intravascular catheter-associated infection in a rat model. Infect Immun. 1999;67:2656–2659. doi: 10.1128/iai.67.5.2656-2659.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Vuong C, Voyich JM, Fischer ER, Braughton KR, Whitney AR, et al. Polysaccharide intercellular adhesin (PIA) protects Staphylococcus epidermidis against major components of the human innate immune system. Cell Microbiol. 2004;6:269–275. doi: 10.1046/j.1462-5822.2004.00367.x. [DOI] [PubMed] [Google Scholar]
  • 46.Ohlsen K, Donat S. The impact of serine/threonine phosphorylation in Staphylococcus aureus. Int J Med Microbiol. 2010;300:137–141. doi: 10.1016/j.ijmm.2009.08.016. [DOI] [PubMed] [Google Scholar]
  • 47.Knobloch JK, Nedelmann M, Kiel K, Bartscht K, Horstkotte MA, et al. Establishment of an arbitrary PCR for rapid identification of Tn917 insertion sites in Staphylococcus epidermidis: characterization of biofilm-negative and nonmucoid mutants. Appl Environ Microbiol. 2003;69:5812–5818. doi: 10.1128/AEM.69.10.5812-5818.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Mack D, Rohde H, Dobinsky S, Riedewald J, Nedelmann M, et al. Identification of three essential regulatory gene loci governing expression of Staphylococcus epidermidis polysaccharide intercellular adhesin and biofilm formation. Infect Immun. 2000;68:3799–3807. doi: 10.1128/iai.68.7.3799-3807.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Rajagopal L, Vo A, Silvestroni A, Rubens CE. Regulation of purine biosynthesis by a eukaryotic-type kinase in Streptococcus agalactiae. Mol Microbiol. 2005;56:1329–1346. doi: 10.1111/j.1365-2958.2005.04620.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Kristich CJ, Wells CL, Dunny GM. A eukaryotic-type Ser/Thr kinase in Enterococcus faecalis mediates antimicrobial resistance and intestinal persistence. Proc Natl Acad Sci U S A. 2007;104:3508–3513. doi: 10.1073/pnas.0608742104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Dias R, Felix D, Canica M, Trombe MC. The highly conserved serine threonine kinase StkP of Streptococcus pneumoniae contributes to penicillin susceptibility independently from genes encoding penicillin-binding proteins. BMC Microbiol. 2009;9:121. doi: 10.1186/1471-2180-9-121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Novakova L, Bezouskova S, Pompach P, Spidlova P, Saskova L, et al. Identification of multiple substrates of the StkP Ser/Thr protein kinase in Streptococcus pneumoniae. J Bacteriol. 2010 doi: 10.1128/JB.01564-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Novakova L, Saskova L, Pallova P, Janecek J, Novotna J, et al. Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates. FEBS J. 2005;272:1243–1254. doi: 10.1111/j.1742-4658.2005.04560.x. [DOI] [PubMed] [Google Scholar]
  • 54.Li M, Lai Y, Villaruz AE, Cha DJ, Sturdevant DE, et al. Gram-positive three-component antimicrobial peptide-sensing system. Proc Natl Acad Sci U S A. 2007;104:9469–9474. doi: 10.1073/pnas.0702159104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Augustin J, Gotz F. Transformation of Staphylococcus epidermidis and other staphylococcal species with plasmid DNA by electroporation. FEMS Microbiol Lett. 1990;54:203–207. doi: 10.1016/0378-1097(90)90283-v. [DOI] [PubMed] [Google Scholar]
  • 56.Bae T, Schneewind O. Allelic replacement in Staphylococcus aureus with inducible counter-selection. Plasmid. 2006;55:58–63. doi: 10.1016/j.plasmid.2005.05.005. [DOI] [PubMed] [Google Scholar]
  • 57.Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene. 1989;77:51–59. doi: 10.1016/0378-1119(89)90358-2. [DOI] [PubMed] [Google Scholar]
  • 58.Wang X, Niu C, Sun G, Dong D, Villaruz AE, et al. ygs Is a Novel Gene That Influences Biofilm Formation and the General Stress Response of Staphylococcus epidermidis. Infect Immun. 2010;79:1007–1015. doi: 10.1128/IAI.00916-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Xu L, Li H, Vuong C, Vadyvaloo V, Wang J, et al. Role of the luxS quorum-sensing system in biofilm formation and virulence of Staphylococcus epidermidis. Infect Immun. 2006;74:488–496. doi: 10.1128/IAI.74.1.488-496.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Guan KL, Dixon JE. Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Anal Biochem. 1991;192:262–267. doi: 10.1016/0003-2697(91)90534-z. [DOI] [PubMed] [Google Scholar]
  • 61.Kadurugamuwa JL, Sin L, Albert E, Yu J, Francis K, et al. Direct continuous method for monitoring biofilm infection in a mouse model. Infect Immun. 2003;71:882–890. doi: 10.1128/IAI.71.2.882-890.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Mack D, Siemssen N, Laufs R. Parallel induction by glucose of adherence and a polysaccharide antigen specific for plastic-adherent Staphylococcus epidermidis: evidence for functional relation to intercellular adhesion. Infect Immun. 1992;60:2048–2057. doi: 10.1128/iai.60.5.2048-2057.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Kreiswirth BN, Lofdahl S, Betley MJ, O'Reilly M, Schlievert PM, et al. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature. 1983;305:709–712. doi: 10.1038/305709a0. [DOI] [PubMed] [Google Scholar]
  • 64.Ji Y, Marra A, Rosenberg M, Woodnutt G. Regulated antisense RNA eliminates alpha-toxin virulence in Staphylococcus aureus infection. J Bacteriol. 1999;181:6585–6590. doi: 10.1128/jb.181.21.6585-6590.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES