Skip to main content
PLOS One logoLink to PLOS One
. 2011 Sep 28;6(9):e25119. doi: 10.1371/journal.pone.0025119

A New Variant of the Capsule 3 Cluster Occurs in Streptococcus pneumoniae from Deceased Wild Chimpanzees

Dalia Denapaite 1, Regine Hakenbeck 1,*
Editor: Michael Hensel2
PMCID: PMC3182177  PMID: 21969869

Abstract

The presence of new Streptococcus pneumoniae clones in dead wild chimpanzees from the Taï National Park, Côte d'Ivoire, with previous respiratory problems has been demonstrated recently by DNA sequence analysis from samples obtained from the deceased apes. In order to broadenour understanding on the relatedness of these pneumococcal clones to those from humans, the gene locus responsible for biosynthesis of the capsule polysaccharide (CPS) has now been characterized. DNA sequence analysis of PCR fragments identified a cluster named cps3Taï containing the four genes typical for serotype 3 CPS, but lacking a 5′-region of ≥2 kb which is degenerated in other cps3 loci and not required for type 3 biosynthesis. CPS3 is composed of a simple disaccharide repeat unit comprising glucose and glucuronic acid (GlcUA). The two genes ugd responsible for GlcUA synthesis and wchE encoding the type 3 synthase are essential for CPS3 biosynthesis, whereas both, galU and the 3′-truncated gene pgm are not required due to the presence of homologues elsewhere in the genome. The DNA sequence of cps3Taï diverged considerably from those of other cps3 loci. Also, the gene pgm Taï represents a full length version with a nonsense mutation at codon 179. The two genes ugd Taï and wchE Taï including the promoter region were transformed into a nonencapsulated laboratory strain S. pneumoniae R6. Transformants which expressed type 3 capsule polysaccharide were readily obtained, documenting that the gene products are functional. In summary, the data indicate that cps3Taï evolved independent from other cps3 loci, suggesting the presence of specialized serotype 3 S. pneumoniae clones endemic to the Taï National Park area.

Introduction

Streptococcus pneumoniae is one of the major bacterial human pathogens. Its polysaccharide capsule is an essential virulence factor [1][6]. In fact, the capsule gene cluster appears to be among the few components of S. pneumoniae described as virulence factors that distinguishes the pathogen from its closest commensal relative S. mitis [7]. Up to now over 90 capsular serotypes have been described that can be distinguished immunologically by antisera specific for the capsule polysaccharide (CPS), biochemically and genetically [8][11]. All cps clusters are located at a specific region in the genome flanked by conserved sequences of the two genes dexA and aliA [10].

The capsular serotype is also an important epidemiological marker for S. pneumoniae. Clones of genetically closely related strains can be characterized by multi locus sequence typing (MLST), i.e. comparative sequence analysis of seven house keeping genes, and thus individual strains are characterized by their allelic profile which constitutes the sequence type (ST) [12]. Generally, isolates with the same ST share the same serotype, although serotype switch occurs occasionally due to horizontal gene transfer of capsular genes [13][16].

S. pneumoniae is considered to be a human specific pathogen. Nevertheless pneumococci have been isolated from a variety of animals held in captivity (pets, zoo or laboratory animals), either as carriage isolates or causing a variety of disease symptoms [17][23]. There is only one case where S. pneumoniae were demonstrated in wild animals [24]. DNA sequencing using samples obtained from deceased wild chimpanzees from the Taï National Park revealed genes encoding typical S. pneumoniae proteins such as the major autolysin LytA, pneumolysin Ply, and the penicillin binding protein 2× (PBP2×). Moreover, MLST analysis identified two new clones that have not been found within the human population including workers on the Taï chimpanzee project. The closest human isolates differed in four out of seven alleles, and it has been suggested that S. pneumoniae virulent to great apes occur endemically in this area [24].

Since live bacteria could not be isolated from the wild chimpanzees, we have used DNA samples from three apes covering both STs to investigate the capsular type of the S. pneumoniae clones. Recently, a multiplex PCR scheme has been developed to differentiate 29 serotypes most common in the US [25]. In the present study a modulated system was used which covers the serotype distribution in Africa (http://www.cdc.gov/ncidod/biotech/strep/pcr.htm). The results document the presence of genes involved in CPS of type 3 in all samples. Comparison with known sequences of the cps3 locus from human isolates revealed major differences. Transformation experiments were performed using the laboratory strain R6 as recipient to verify their function.

Results

PCR amplification of the cps cluster from chimpanzee samples

In order to identify genes related to biosynthesis of the pneumococcal capsule, first a multiplex PCR was applied on DNA samples obtained from three chimpanzees (here referred to as ‘Taï’ samples) representing the three ape communities and the two S. pneumoniae clones identified by MLST analysis previously [24]. Each of the seven PCR reactions includes four to five primer pairs specific for distinct cps clusters. In addition, each reaction contains one primer pair which is specific for the gene cpsA (wzg) which is present in all cps clusters and thus serves as positive control ([25]. Forty serotype specificities are covered by a modulated version to include clinical specimen from Africa (http://www.cdc.gov/ncidod/biotech/strep/pcr.htm). Each serotype gives rise to one DNA fragment in only one of the PCR reactions. The size of the PCR fragment specifies the cps clusters and the serotype has to be confirmed by DNA sequence analysis.

An appr. 0.4 kb DNA fragment was obtained with all Taï samples in one of the multiplex reactions (for example, see lane 4 in Fig. 1A). However, no product corresponding to the expected cpsA fragment was detected in any of the PCR reactions, suggesting some unusual composition of the cps Taï cluster. One PCR reaction resulted in several DNA fragments which did not correspond to any of the potential products, and these were not investigated further (lane 2 in Fig. 1A). DNA sequencing identified the same 371 nucleotide (nt) sequence in all three Taï samples corresponding to a galU fragment typical for the S. pneumoniae cps3 cluster (also named cps3U or cap3C [26], [27]). In this context it should be pointed out that the nomenclature proposed by Bentley et al. for cps genes was used throughout the manuscript [10].

Figure 1. PCR products obtained from the Taï chimpanzee (Loukoum) sample.

Figure 1

A. Multiplex PCR. Seven PCR reactions were performed as described in Materials and Methods (lanes 1–7). M: Marker DNA (GeneRuler 50 bp DNA Ladder; Fermentas). Lane 4 shows the 371 bp PCR fragment of cps3Taï. B. Amplification of the cps Taï locus. With the primers dexB-for and aliA-rev, a long-range PCR reaction was performed. 1: Taï sample; 2: negative control (no DNA); M: GeneRuler 1 kb DNA Ladder (Fermentas).

In order to understand why the control cpsA fragment was not obtained, and to gain more information about the genetic arrangement of the cps Taï cluster, a long-range PCR reaction was performed to obtain the DNA sequence of the entire cps3Taï cluster. Primers specific for the genes dexB (spr0310) and aliA (spr0327) which are flanking all S. pneumoniae cps clusters were used. The PCR products from all three Taï samples were approximately 8 kb long (for example, see Fig. 1B). However, the cps3 region of strain S. pneumoniae SP3- BS71, a representative of a major type 3 clone of ST180 whose genome sequence is available, is predicted to be 12.8 kb [28], and of another type 3 S. pneumoniae 524/62 of unknown ST is 10.3 kb [10], a variation due to the presence of highly variable transposase fragments. The smaller size of the Taï PCR product suggests either a modified cps3 cluster with large deletions, or the presence of a novel capsular type in the Taï samples. DNA sequence analysis of all three 8 kb fragments clearly identified the four genes specifying the cps3 cluster, and all samples produced identical DNA sequences. However, the cps3Taï region bears special features as outlined below.

DNA sequence analysis of the cps3Taï cluster

The cps3 cluster can be devided into three regions (Fig. 2) [10], [26], [29]. The first region contains sequences common to all serotypes (region I in Fig. 2), but is not required in cps3 since it is mutated and contains mainly pseudogenes of variable size. This entire region I is missing in cps3Taï, which explains the smaller size of the PCR product and the failure to detect the control wzg fragment in the multiplex PCR.

Figure 2. Schematic representation of the cps3 locus of S. pneumoniae SP3-BS71 compared to cps3Taï.

Figure 2

Homologous genes are illustrated by the same colour. The S. pneumoniae SP3-BS71 genes (Acc. No. NZ_AAZZ01000001) missing in cps3Taï are indicated by black arrows. Grey areas designate regions of >97% identity. ★: authentic stop codon in pgm Taï.

Region II contains the two genes essential for biosynthesis of the type 3 capsule which is composed of cellobiuronic acid units connected in a β(1→3) linkage [30]: ugd encoding the UDP-glucose dehydrogenase responsible for UDP-glucuronic acid (UDP-GlcUA) synthesis, and the type 3 synthase gene wchE encoding a processive β-glucosyltransferase linking the alternating glucose and GlcUA moieties (Fig. 3) [27], [29], [31]. WchE represents the simplest synthesis and export pathway for cps. In cps3Taï, region II is intact.

Figure 3. Biosynthetic pathway for type 3 capsular polysaccharide.

Figure 3

The two genes coloured in red are specific for cps3. The blue colour indicates the two genes that are dispensable in the cps3 locus because homologues occur elsewhere in the S. pneumoniae genome. The nomenclature suggested by Bentley et al. was used [10]. Alternative gene names introduced by Dillard et al. [27] and Arrecubieta et al. [26] are indicated in brackets.

Region III contains the two genes galU and pgm. GalU and Pgm are required for synthesis of UDP-Glc (Fig. 3), a precursor for all capsular types and other cell wall polymers as well. These two genes are non essential for CPS3 biosynthesis since homologues of both genes occur elsewhere in the pneumococcal genome, here referred to as galU 2 and pgm 2, [27], [32]. Also, pgm within the cps3 cluster is truncated, and the putative product is probably non functional due to the lack of a C-terminal domain important for phosphomutase activity [29], [33].

Region III of cps3Taï contains downstream of galU a pgm homologue which has some peculiar properties. The DNA sequence of pgm Taï reveals a full size gene (1740 nt) similar in length to pgm 2 (1719 nt) in contrast to e.g. pgm SP3- BS71 (1218 nt). A mutation within the ATGpgm start codon in combination with a single nucleotide deletion four nucleotides upstream results in an 8 amino acid (aa) extended N-terminal sequence of the putative pgm Taï gene product; these mutations also affect galU so that it lacks the last codon. Moreover, the pgm codon 179 is changed into a premature stop codon resulting in a pseudogene. The DNA-sequence of the 5′-region of pgm Taï is highly related to pgm SP3-BS71 (1.2% difference), but largely different to pgm 2 SP3-BS71 (26%). Interestingly, BLAST analysis revealed a homologue pgmA of S. dysgalactiae subsp. equisimilis of similar size (1719 nt) which differed in only 4.5% (Fig. 4 and S1; Table 1). This strongly suggests that the Pgm gene which is located in the cps3 cluster is an orthologue of the chromosomal gene pgm2 of S. pneumoniae.

Figure 4. Schematic representation of PgmTaï and homologues.

Figure 4

The numbers indicate % difference in nucleotide sequence; % differences in amino acid (aa) composition are given in brackets. The black arrow indicates an extra aa in Pgm2 at position 509. PgmTaï has an eight aa N-terminal extension, and PgmA of S. dysgalactiae subsp. equisimilis GGS_124 has one extra C-terminal amino acid. The sequences from the following strains were used (Acc.No.): S. pneumoniae SP3_BS71 (Acc. No. NZ_AAZZ01000001); pgmA: S. dysgalactiae subsp. equisimilis GGS_124 (BAH81542.1). pgm2: SP3_BS71 (ZP_01818094).

Table 1. Comparative sequence analysis of cps3 genes.

Nucleotides
ugd wchE galU 1 pgm
524/62 4 (0.3%) 3 (0.2%) 1 (0.1%) 13 (1.4%)
WU2 4 (0.3%) 15 (1.4%) 3 (0.3%) n.a.
406 4 (0.3%) 4 (0.3%) 2 (0.2%) 7 (0.6%)
Taï 9 (0.8%) 19 (1.5%) 8 (0.9%) 15 (1.2%)

The number of changes compared to those of S. pneumoniae SP3_BS71 are given.

1

pgm in strain 406 terminates with codon 306.

n.a.: not available.

In addition to the SP3-BS71 cps3 sequence [28], there are another three sequences of S. pneumoniae cps3 clusters available: those from strains 524/62 [10], 406 [26], and WU2 [27]. The genes of all clusters are closely related when compared among each other differing in between 1–4 nucleotides per gene except for a short highly variable region within wchE of the WU2 strain. However, they all differed considerably to the cps3Taï sequence with 9 to 18 bp changes per gene (Fig. S2 and Table 1). Figure 5 shows a neighbour joining tree for the 3823 bp region including the promoter and udg/wchE/galU, clearly documenting that the cps3Taï genes are more distantly related to any of the human samples than these are to each other (Fig. 5).

Figure 5. Tree showing the position of cps3Taï within other cps3 clusters.

Figure 5

A neighbour-joining radial tree was constructed as described in Materials and Methods using the region including ugd, wchE and galU together with the promoter region common to all samples. The optimal tree with the sum of branch length = 0.02199305 is shown. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. There were a total of 3823 positions in the final dataset.

In the regions flanking the cps3 cluster differences between the ape and the human samples are also noteworthy. In the 3′-region flanking aliA Taï, a large 1.6 kb deletion has occurred (see Fig. 2). However, the AliA gene in the genome of SP3-BS71 is also affected, since the integration of a transposase resulted in deletion of a small part of the aliA 5′-region.

Expression of the cps3 genes is driven by a strong promoter upstream of udg [34]; and references within] and 112 bp of cps3Taï correspond to this region. There are 12 alterations (10 substitutions, one deletion A−48 and one insertion T−23 with A1TG representing the start codon of udg). However, they do not include a mutation described within the −35 region that affects expression considerably [34], and the +1 position as well as −10 and −35 regions are well conserved in cps3Taï sample. It is therefore likely that all genes in the cps3Taï cluster can be expressed.

Transformation of the unencapsulated S. pneumoniae R6 gene with cps3Taï

In order to see whether the genes of the cps3Taï cluster can be expressed from its promoter, and whether they indeed encode functional products, a 3 kb PCR fragment including the promoter region plus ugd and wchE was ligated into pSW1 as described in the Materials and Methods section. The ligation mixture was then used to transform the unencapsulated laboratory strain R6 which contains a deletion in its cps2 cluster [35]. Since S. pneumoniae R6 contains pgm2 and galU2 corresponding to spr1351 and spr1903, respectively, their functions were expected to complement the enzymatic machinery required for CPS3 synthesis. The ligation mixture was used as donor DNA, since wildtype colonies resulting from transformation with the religated vector fragment should easily be distinguishable from transformants containing the vector plus the 3 kb fragment and thus expressing a polysaccharide capsule. Trimethoprim resistant colonies were obtained readily, and indeed two types of colonies were apparent: appr. 40% showed no difference to the small colonies of the parental strain R6, whereas 60% had a striking mucoid phenotype typical for the type 3 capsule (Fig. 6A). This phenotype was stably maintained during several passages of single colonies (Fig. 6B). The presence of capsular material of type 3 was further verified using type 3 antiserum in a Quellung reaction (not shown). Integration of the 3 kb fragment into the bgaA locus was confirmed in six mucoid colonies by PCR using primers flanking the integration site. Thus, ugd Taï and wchE Taï in combination with pgm2-R6 and galU2-R6 were sufficient to drive biosynthesis of the capsule 3 polysaccharide.

Figure 6. Colony morphology of S. pneumoniae type 3 strains.

Figure 6

A. S. pneumoniae R6 transformants. After transformation with the ligation mixture (Taï-DNA and pSW1) cells were plated on trimethoprim containing D-agar. Black arrows: mucoid capsular colonies; yellow arrows: non capsulated colonies carrying religated vector. B. Serotype type 3 strains. 1: R6bgaA::udg-wchE contains the cps3 locus of the Taï sample; 2: SP3-BS71 represents a type 3 human isolate. 3: the parental strain R6 and 4: R6bgaA::pSW1 carrying only the vector pSW1 are shown as unencapsulated control strains. Pictures were taken using a Sony DFW-X700 camera.

Discussion

The presence of the S. pneumoniae specific cps3 cluster in samples from dead wild apes confirmed the presence of pneumococci in the deceased animals. The samples investigated here represent both clones that were identified previously STs 2308 and 2309 [24], and were taken seven years apart. Although the allelic profile of the two clones is completely distinct, they contained identical DNA sequences of the cps3 cluster that differed largely from that of other type 3 isolates. It is also remarkable, that among the over 6300 STs listed in the MLST data base in April 2011, no human isolate has the same ST compared to that of the chimpanzee associated S. pneumoniae but differs in at least four out of the seven alleles used for MLST. Several distinct STs for type 3 isolates are known, with ST458 predominating in South Africa [36], whereas ST180 is the dominant clone in many other countries [37][40]. The unique cps3Taï sequence adds further evidence that the two clones in the Taï National Park occur endemically, and suggests some selective advantage favouring recent acquisition of this CPS type. Serotype 3 is among the serotypes with the highest invasive capacity in human [41], and it is thus likely that S. pneumoniae played a substantial role in causing the death of the chimpanzees even though other pathogens have probably contributed to the disease [24].

The capsule is one of the major virulence factors of S. pneumoniae. Clones associated with animals held in captivity or as pets expressed many different serotypes, and most clones were identical to human isolates. However, guinea pigs seemed to be infected by a new clone of serotype 19F [17], and new clones of serotype 3 were isolated from racing horses [17], [22]. The identification of serotype 3 clones in wild animals described in the present manuscript is another example suggesting that specialized S. pneumoniae clones can be associated with animals. It has been suggested that the animal host of the Taï clones is not the chimpanzee but small rodents or monkeys that are part of the ape's diet [24]. The reason for the persistence of the S. pneumoniae clones in the Taï National Park is not clear. We do not believe that the capsule itself is involved in this property, since there is no indication that the capsule of the Taï samples is biochemically distinct from the known type 3 structure. It is more likely that other genomic components of these pneumococcal clones are responsible for their capacity to persist in this area. Also studies on the virulence potential of these clones have to await the isolation of the bacteria which has not been possible so far.

There are only four genes required for biosynthesis of CPS3 (Fig. 3). The two genes ugd (UDP-Glc dehydrogenase) and wchE (CPS3 synthase) involved in the last two steps are essential. The other two genes located in the cps3 locus - pgm catalyzing the production of Glc-1-P from Glc-6-P, and galU converting Glc-1-P to UDP-Glc - are dispensable, since homologues galU2 and pgm2 are present elsewhere in the S. pneumoniae genome. It is peculiar, that not only the truncated pgm gene within the cps3 cluster can be deleted without affecting CPS3 production, but that also deletion of galU has no effect, whereas mutants in galU2 or pgm2 produced almost no CPS3 and were strongly affected in virulence [32], [42]. This documents that it is the two genomic genes outside the cps locus that are mainly involved for CPS3 biosynthesis rather than their homologues in the cps3 cluster. The fact that transformation of the ugd-wchE Taï region into the unencapsulated S. pneumoniae R6 strain results in type 3 colonies as shown here documents that the absence of both genes galU and pgm simultaneously in the cps locus has no apparent impact on CPS3 production and thus clearly defines the minimal size of the cps3 region required for CPS3 synthesis. It also proves that the cps3Taï cluster is functional despite considerable alterations in the promoter region as well as in udg and wchE.

The comparative DNA sequence analysis of cps3Taï revealed several features that document an evolutionary history distinct from all other known cps3 loci. RFLP analysis of restriction digests from WU2 and another four type 3 strains confirmed a high degree of uniformity of this locus including the transposon upstream of the AliA gene flanking the cps cluster [29]. However, cps3Taï is at least 2 kb shorter due to the absence of region I (see Fig. 2), and a 3′-region that includes a transposon as well as substantial parts of aliA is also missing. The AliA gene is generally truncated in cps3 clusters [29]. Probably aliA is not required in S. pneumoniae due to the presence of several other related oligopeptide permease genes [43]. Nevertheless, AliA mutants have been shown to colonize the nasopharynx considerably less using the type 2 strain D39 [44], and thus other factors might compensate this defect in the serotype 3 isolates of high virulence potential.

The four cps3 loci where sequence information is available are more similar to each other than they are to cps3Taï (Figs. 5, S1, S2 and Table 1). Furthermore, the PgmTaï gene is unique in that it represents a full size homologue in contrast to the truncated pgm versions in the other cps3 loci including those found among recently shot gun sequenced S. pneumoniae isolates (http://www.ncbi.nlm.nih.gov/sutils/genom_table.cgi), and again the PgmTaï gene is more different compared to all others (Fig. 4). Remarkably, the G+C content of pgm resembles that of S. pneumoniae genomes and other streptococci with 41.3%, whereas the G+C of other cps3 genes is significantly lower (34–37%), similar to CPS synthesizing genes in other cps loci [10]. In summary, two conclusions can be drawn from these data. The cps3 cluster contains genes from at least two sources as judged from the G+C content. Furthermore, cps3Taï has evolved separately for a certain time period before diversification of the other cps3 clusters has occurred, resulting in a higher percentage of mutations and distinct deletion events. The availability of sequences from other type 3 S. pneumoniae clones would be desirable to broaden our understanding on the evolution of this cluster.

Methods

Bacterial strains and media

S. pneumoniae R6, a nonencapsulated derivative of the Rockefeller University strain R36A [45], was used for transformation experiments. Cells were grown at 37°C without aeration in C-medium [46] supplemented with 0.2% yeast extract (Difco) or on blood agar plates (D-agar supplemented with 3% defibrinated sheep blood (Oxoid) [47]. Growth in liquid culture was monitored by nephelometry.

Escherichia coli strain DH5α was used for propagation of plasmid pSW1. E. coli strains were grown aerobically at 37°C either in LB medium or on LB agar plates [48]. Plasmid pSW1 was selected in E. coli with 200 µg/ml ampicillin.

Transformation procedure

Transformation of S. pneumoniae R6 strains was performed according to published procedures [49]. Transformants containing pSW1 were selected with trimethoprim at 15 µg/ml.

DNA manipulations

All DNA techniques were performed using standard methods [48]. Multiplex PCR for 39 capsular serotypes/serogroups was performed by using seven sequential reactions as described by Pai et al. [25]. The primer sets specific for Africa clinical specimen were used as described by the CDC (http://www.cdc.gov/ncidod/biotech/strep/pcr.htm). PCR reactions were performed using GoldStar Taq polymerase (Eurogentec) according to the manufacturer's instructions. DNA isolated from three deceased chimpanzee lung tissue samples was used: Loukoum (1999, North community, ST2308), Candy (2006, East community, ST2308) and Ophelia (2004, South community, ST2309) [24]. The cps cluster was amplified using primers located in the genes dexB (dexB-for CATCATGGACTTGGTGGTCAATCATACCTCGGATGAG) and aliA (aliA-rev TAGACAAGATTGGACGCCCTGTACGAGATGTAGTTGG). Long-range PCR were performed using high-fidelity iProof polymerase (Bio-Rad) according to the manufacturer's instructions. The amplified products were sequenced by primer walking.

PCR products were purified using the PCR clean-up gel extraction kit (Macherey-Nagel). Chromosomal DNA was isolated from S. pneumoniae as described previously [50]. Plasmids from E. coli were isolated using the QIAprep Spin Miniprep kit (Qiagen). Restriction nucleases and T4 DNA ligase were purchased from BioLabs and used according to the recommendations of the suppliers.

Construction of R6bgaA::udg-wchE

The region covering promoter and the two genes udg and wchE essential for type 3 capsular polysaccharide biosynthesis was PCR amplified using oligonucleotides pDD01 (CGCGGATCCACCGATAGTGTGGTTAATGTTG) and pDD02 (CTAGCTAGCCCAGCCCTGCTGCAGGAATAACAG), treated with BamHI and NheI, and ligated to pSW1 previously digested with the same enzymes. The ligation mixture was used to transform S. pneumoniae R6, and trimethoprim resistance colonies were selected. Approximately 60% of the transformants displayed mucoid colony appearance and correct integration of the insert into the genome was confirmed by PCR.

pSW1 plasmid contains a pBR322-derived origin of replication for replication in E. coli but not in S. pneumoniae, and details will be described elsewhere. Briefly, it carries a trimethoprim resistance marker [51] which can be used for selection of the transformants in S. pneumoniae, and the β-lactamase gene (bla) confers ampicillin resistance in E. coli. Genes of interest can be cloned via multiple cloning sites with recognition sequences for KpnI, SmaI, XbaI, BamHI, SalI. Flanking regions are homologous to S. pneumoniae sequences allowing integration into the chromosome by double crossover at the bgaA locus thereby replacing an intergenic region between bgaA and the adjacent gene spr0566.

Quellung reaction

The strains were serotyped by Quellung reaction using type serum 3 provided by the Statens Serum Institut, Copenhagen, Denmark [52].

Phylogenetic analysis

The evolutionary history of cps genes was inferred using the Neighbour-Joining method [53]. Evolutionary distances were computed using the Maximum Composite Likelihood method [54]. All positions containing gaps and missing data were eliminated from the dataset (complete deletion option). Phylogenetic analyses were conducted in MEGA4 [55].

Nucleotide sequence accession number

The DNA sequence described here (cps3Taï) is deposited in GenBank under accession No. JF836868.

Supporting Information

Figure S1

Comparative sequence analysis of the PgmTaï gene. Shown are sites where at least one sequence differs from the reference sequence. A: nucleotide sequence; B: amino acid sequence. The codon numbers (amino acids) are indicated vertically in the first three rows; sites 1, 2 and 3 refer to the first, second and third positions in the respective codon. The authentic stop codon in pgm Taï occurs at codon 179 and is indicated by (*) in the amino acid alignment. The sequences from the following strains were used (Acc.No.): S. pneumoniae 524/62 (CR931634); 406 (Z47210), SP3_BS71 (Acc. No. NZ_AAZZ01000001); pgmA: S. dysgalactiae subsp. equisimilis GGS_124 (BAH81542.1).

(TIF)

Figure S2

Comparative sequence analysis of cps 3Taï genes and deduced proteins. Shown are sites where at least one sequence differed from the reference sequence. Top: amino acid sequence; bottom: nucleotide sequence. The codons (amino acids) as indicated vertically in the first three rows are numbered according to published sequences; sites 1, 2 and 3 refer to the first, second and third positions in the respective codon. A region in wchE highly divergent in S. pneumoniae WU2 between codon 223.2 until 235.3 is shaded in grey; it includes 12 nt substitutions and 3 nt deletions resulting in two frameshifts within this region and the deletion of one amino acid in the deduced gene product. Sequences: WU2 (Acc. No. SPU15171); other Acc. Nos.: see legend to Fig. S1.

(TIF)

Acknowledgments

We thank Fabian Leendertz and Sophie Köndgen for continuous supply of DNA samples, and Niels Frimodt-Møler for providing anti-CPS3 antiserum and the type 3 strain S. pneumoniae 68034 used in the Quellung reaction. We also thank Reinhold Brückner and Patrick Maurer for helpful discussions. We acknowledge the use of the pneumococcal MLST database which is located at Imperial College London and is funded by the Wellcome Trust.

Footnotes

Competing Interests: The authors have declared that no competing interests exist.

Funding: This work was supported by the Stiftung Rheinland Pfalz für Innovation (Project 838) and the Network of Excellence EuroPathoGenomics, LSHB-CT-2005-512061. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1.Avery OT, Dubos R. The protective action of a specific enzyme against type III pneumococcus infection in mice. J Exp Med. 1931;54:73–89. doi: 10.1084/jem.54.1.73. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Watson DA, Musher DM. A brief history of the pneumococcus in biomedical research. Semin Respir Infect. 1999;14:198–208. [PubMed] [Google Scholar]
  • 3.Griffith F. The significance of pneumococcal types. J Hygiene. 1928;27:113–159. doi: 10.1017/s0022172400031879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Mitchell TJ. The pathogenesis of streptococcal infections: from tooth decay to meningitis. Nat Rev Microbiol. 2003;1:219–230. doi: 10.1038/nrmicro771. [DOI] [PubMed] [Google Scholar]
  • 5.Austrian R. Some observations on the pneumococcus and on the current status of pneumococcal disease and its prevention. Rev Infect Dis. 1981;3:S1–S17. doi: 10.1093/clinids/3.supplement_1.s1. [DOI] [PubMed] [Google Scholar]
  • 6.Bruyn GAW, Zegers BJM, Van Furth R. Mechanisms of host defense against infection with Streptococcus pneumoniae. Clin Infect Dis. 1992;14:251–262. doi: 10.1093/clinids/14.1.251. [DOI] [PubMed] [Google Scholar]
  • 7.Denapaite D, Brückner R, Nuhn M, Reichmann P, Henrich B, et al. The genome of Streptococcus mitis B6 - what is a commensal? PLoS ONE. 2010;5:e9426. doi: 10.1371/journal.pone.0009426. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Henrichsen J. Six newly recognized types of Streptococcus pneumoniae. J Clin Microbiol. 1995;33:2759–2762. doi: 10.1128/jcm.33.10.2759-2762.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Park IH, Pritchard DG, Cartee R, Brandao A, Brandileone MC, et al. Discovery of a new capsular serotype (6C) within serogroup 6 of Streptococcus pneumoniae. J Clin Microbiol. 2007;45:1225–1233. doi: 10.1128/JCM.02199-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Bentley SD, Aanensen DM, Mavroidi A, Saunders D, Rabbinowitsch E, et al. Genetic analysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes. PLoS Genet. 2006;2:e31. doi: 10.1371/journal.pgen.0020031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Bratcher PE, Park IH, Hollingshead SK, Nahm MH. Production of a unique pneumococcal capsule serotype belonging to serogroup 6. Microbiology. 2009;155:576–583. doi: 10.1099/mic.0.024521-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Maiden MCJ, Bygraves JA, Feil E, Morelli G, Russel JE, et al. Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms. Proc Natl Acad Sci USA. 1998;95:3140–3145. doi: 10.1073/pnas.95.6.3140. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Coffey TJ, Dowson CG, Daniels M, Zhou J, Martin C, et al. Horizontal transfer of multiple penicillin-binding protein genes, and capsular biosynthetic genes, in natural populations of Streptococcus pneumoniae. Mol Microbiol. 1991;5:2255–2260. doi: 10.1111/j.1365-2958.1991.tb02155.x. [DOI] [PubMed] [Google Scholar]
  • 14.Coffey TJ, Enright MC, Daniels M, Morona JK, Morona R, et al. Recombinational exchanges at the capsular polysaccharide biosynthetic locus lead to frequent serotype changes among natural isolates of Streptococcus pneumoniae. Mol Microbiol. 1998;27:73–83. doi: 10.1046/j.1365-2958.1998.00658.x. [DOI] [PubMed] [Google Scholar]
  • 15.Coffey TJ, Daniels M, Enright MC, Spratt BG. Serotype 14 variants of the Spanish penicillin-resistant serotype 9V clone of Streptococcus pneumoniae arose by large recombinational replacements of the cpsA-pbp1a region. Microbiology. 1999;145:2023–2031. doi: 10.1099/13500872-145-8-2023. [DOI] [PubMed] [Google Scholar]
  • 16.Nesin M, Ramirez M, Tomasz A. Capsular transformation of a multidrug-resistant Streptococcus pneumoniae in vivo. J Infect Dis. 1998;177:707–713. doi: 10.1086/514242. [DOI] [PubMed] [Google Scholar]
  • 17.van der Linden M, Al-Lahham A, Nicklas W, Reinert RR. Molecular characterization of pneumococcal isolates from pets and laboratory animals. PLoS ONE. 2009;4:e8286. doi: 10.1371/journal.pone.0008286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fox JG, Soave OA. Pneumococcic meningoencephalitis in a rhesus monkey. J Am Vet Med Assoc. 1971;159:1595–1597. [PubMed] [Google Scholar]
  • 19.Fox JG, Wikse SE. Bacterial meningoencephalitis in rhesus monkeys: clinical and pathological features. Lab Anim Sci. 1971;21:558–563. [PubMed] [Google Scholar]
  • 20.Benson CE, Sweeney CR. Isolation of Streptococcus pneumoniae type 3 from equine species. J Clin Microbiol. 1984;20:1028–1030. doi: 10.1128/jcm.20.6.1028-1030.1984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Solleveld HA, van Zwieten MJ, Heidt PJ, van Eerd PM. Clinicopathologic study of six cases of meningitis and meningoencephalitis in chimpanzees (Pan troglodytes). Lab Anim Sci. 1984;34:86–90. [PubMed] [Google Scholar]
  • 22.Whatmore AM, King SJ, Doherty NC, Sturgeon D, Chanter N, et al. Molecular characterization of equine isolates of Streptococcus pneumoniae: natural disruption of genes encoding the virulence factors pneumolysin and autolysin. Infect Immun. 1999;67:2776–2782. doi: 10.1128/iai.67.6.2776-2782.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Huber L, Willoughby R, Lynch J. Ontario. Streptococcus pneumoniae Type 3 in an Ontario racehorse. Can Vet J. 1988;29:665–666. [PMC free article] [PubMed] [Google Scholar]
  • 24.Chi F, Leider M, Leendertz F, Bergmann C, Boesch C, et al. New Streptococcus pneumoniae clones in deceased wild chimpanzees. J Bacteriol. 2007;189:6085–6088. doi: 10.1128/JB.00468-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pai R, Gertz RE, Beall B. Sequential multiplex PCR approach for determining capsular serotypes of Streptococcus pneumoniae isolates. J Clin Microbiol. 2006;44:124–131. doi: 10.1128/JCM.44.1.124-131.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Arrecubieta C, López R, García E. Molecular characterization of cap3A, a gene from the operon required for the synthesis of the capsule of Streptococcus pneumoniae type 3: Sequencing of mutations responsible for the unencapsulated phenotype and localization of the capsular cluster on the pneumococcal chromosome. J Bacteriol. 1994;176:6375–6383. doi: 10.1128/jb.176.20.6375-6383.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Dillard JP, Vandersea MW, Yother J. Characterization of the cassette containing genes for type 3 capsular polysaccharide biosynthesis in Streptococcus pneumoniae. J Exp Med. 1995;181:973–983. doi: 10.1084/jem.181.3.973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Hiller NL, Janto B, Hogg JS, Boissy R, Yu S, et al. Comparative genomic analyses of seventeen Streptococcus pneumoniae strains: insights into the pneumococcal supragenome. J Bacteriol. 2007;189:8186–8195. doi: 10.1128/JB.00690-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Caimano MJ, Hardy GG, Yother J. Capsule genetics in Streptococcus pneumoniae and a possible role for transposition in the generation of the type 3 locus. Microb Drug Resist. 1998;4:11–23. doi: 10.1089/mdr.1998.4.11. [DOI] [PubMed] [Google Scholar]
  • 30.Reeves RE, Goebel WF. Chemoimmunological studies on the soluble specific substance of pneumococcus. V. The structure of the type III polysaccharide. J Biol Chem. 1941;139:511–519. [Google Scholar]
  • 31.Mavroidi A, Aanensen DM, Godoy D, Skovsted IC, Kaltoft MS, et al. Genetic relatedness of the Streptococcus pneumoniae capsular biosynthetic loci. J Bacteriol. 2007;189:7841–7855. doi: 10.1128/JB.00836-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Mollerach M, Lopez R, Garcia E. Characterization of the galU gene of Streptococcus pneumoniae encoding a uridine diphosphoglucose pyrophosphorylase: a gene essential for capsular polysaccharide biosynthesis. J Exp Med. 1998;188:2047–2056. doi: 10.1084/jem.188.11.2047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Dai JB, Liu Y, Ray WJ, Jr, Konno M. The crystal structure of muscle phosphoglucomutase refined at 2.7-angstrom resolution. J Biol Chem. 1992;267:6322–6337. [PubMed] [Google Scholar]
  • 34.Domenech M, Garcia E, Moscoso M. Versatility of the capsular genes during biofilm formation by Streptococcus pneumoniae. Environ Microbiol. 2009;11:2542–2555. doi: 10.1111/j.1462-2920.2009.01979.x. [DOI] [PubMed] [Google Scholar]
  • 35.Iannelli F, Pearce BJ, Pozzi G. The type 2 capsule locus of Streptococcus pneumoniae. J Bacteriol. 1999;181:2652–2654. doi: 10.1128/jb.181.8.2652-2654.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Mothibeli KM, Du Plessis M, von Gottberg A, de Gouveia L, Adrian P, et al. An unusual pneumococcal sequence type is the predominant cause of serotype 3 invasive disease in South Africa. J Clin Microbiol. 2010;48:184–191. doi: 10.1128/JCM.01011-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Brueggemann AB, Griffiths DT, Meats E, Peto T, Crook DW, et al. Clonal relationships between invasive and carriage Streptococcus pneumoniae and serotype- and clone-specific differences in invasive disease potential. J Infect Dis. 2003;187:1424–1432. doi: 10.1086/374624. [DOI] [PubMed] [Google Scholar]
  • 38.Sadowy E, Skoczynska A, Fiett J, Gniadkowski M, Hryniewicz W. Multilocus sequence types, serotypes, and variants of the surface antigen PspA in Streptococcus pneumoniae isolates from meningitis patients in Poland. Clin Vaccine Immunol. 2006;13:139–144. doi: 10.1128/CVI.13.1.139-144.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Beall B, McEllistrem MC, Gertz RE, Wedel S, Boxrud DJ, et al. Pre- and postvaccination clonal compositions of invasive pneumococcal serotypes for isolates collected in the United States in 1999, 2001, and 2002. J Clin Microbiol. 2006;44:999–1017. doi: 10.1128/JCM.44.3.999-1017.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Clarke SC, Scott KJ, McChlery SM. Serotypes and sequence types of pneumococci causing invasive disease in Scotland prior to the introduction of pneumococcal conjugate polysaccharide vaccines. J Clin Microbiol. 2004;42:4449–4452. doi: 10.1128/JCM.42.10.4449-4452.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Yildirim I, Hanage WP, Lipsitch M, Shea KM, Stevenson A, et al. Serotype specific invasive capacity and persistent reduction in invasive pneumococcal disease. Vaccine. 2010;29:283–288. doi: 10.1016/j.vaccine.2010.10.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Hardy GG, Magee AD, Ventura CL, Caimano MJ, Yother J. Essential role for cellular phosphoglucomutase in virulence of type 3 Streptococcus pneumoniae. Infect Immun. 2001;69:2309–2317. doi: 10.1128/IAI.69.4.2309-2317.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Alloing G, De Philip P, Claverys J-P. Three highly homologous membrane-bound lipoproteins participate in oligopeptide transport by the Ami system of the Gram-positive Streptococcus pneumoniae. J Mol Biol. 1994;241:44–58. doi: 10.1006/jmbi.1994.1472. [DOI] [PubMed] [Google Scholar]
  • 44.Kerr AR, Adrian PV, Estevao S, de Groot R, Alloing G, et al. The Ami-AliA/AliB permease of Streptococcus pneumoniae is involved in nasopharyngeal colonization but not in invasive disease. Infect Immun. 2004;72:3902–3906. doi: 10.1128/IAI.72.7.3902-3906.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Avery OT, MacLeod CM, McCarty M. Studies on the chemical nature of the substance inducing transformation of pneumococcal types. Induction of transformation by a desoxyribonucleic acid fraction isolated from pneumococcus type III. J Exp Med. 1944;79:137–158. doi: 10.1084/jem.79.2.137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Lacks S, Hotchkiss RD. A study of the genetic material determining an enzyme activity in pneumococcus. Biochim Biophys Acta. 1960;39:508–517. doi: 10.1016/0006-3002(60)90205-5. [DOI] [PubMed] [Google Scholar]
  • 47.Alloing G, Granadel C, Morrison DA, Claverys J-P. Competence pheromone, oligopeptide permease, and induction of competence in Streptococcus pneumoniae. Mol Microbiol. 1996;21:471–478. doi: 10.1111/j.1365-2958.1996.tb02556.x. [DOI] [PubMed] [Google Scholar]
  • 48.Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press: Plainview, New York; 1989. [Google Scholar]
  • 49.Mascher T, Merai M, Balmelle N, de Saizieu A, Hakenbeck R. The Streptococcus pneumoniae cia regulon: CiaR target sites and transcription profile analysis. J Bacteriol. 2003;185:60–70. doi: 10.1128/JB.185.1.60-70.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Laible G, Hakenbeck R, Sicard MA, Joris B, Ghuysen J-M. Nucleotide sequences of the pbpX genes encoding the penicillin-binding protein 2× from Streptococcus pneumoniae R6 and a cefotaxime-resistant mutant, C506. Mol Microbiol. 1989;3:1337–1348. doi: 10.1111/j.1365-2958.1989.tb00115.x. [DOI] [PubMed] [Google Scholar]
  • 51.Burchall JJ, Hitchings GH. Inhibitor binding analysis of dihydrofolate reductases from various species. Mol Pharmacol. 1965;1:126–136. [PubMed] [Google Scholar]
  • 52.Sorensen UB. Typing of pneumococci by using 12 pooled antisera. J Clin Microbiol. 1993;31:2097–2100. doi: 10.1128/jcm.31.8.2097-2100.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–425. doi: 10.1093/oxfordjournals.molbev.a040454. [DOI] [PubMed] [Google Scholar]
  • 54.Tamura K, Nei M, Kumar S. Prospects for inferring very large phylogenies by using the neighbor-joining method. Proc Natl Acad Sci U S A. 2004;101:11030–11035. doi: 10.1073/pnas.0404206101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol. 2007;24:1596–1599. doi: 10.1093/molbev/msm092. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Comparative sequence analysis of the PgmTaï gene. Shown are sites where at least one sequence differs from the reference sequence. A: nucleotide sequence; B: amino acid sequence. The codon numbers (amino acids) are indicated vertically in the first three rows; sites 1, 2 and 3 refer to the first, second and third positions in the respective codon. The authentic stop codon in pgm Taï occurs at codon 179 and is indicated by (*) in the amino acid alignment. The sequences from the following strains were used (Acc.No.): S. pneumoniae 524/62 (CR931634); 406 (Z47210), SP3_BS71 (Acc. No. NZ_AAZZ01000001); pgmA: S. dysgalactiae subsp. equisimilis GGS_124 (BAH81542.1).

(TIF)

Figure S2

Comparative sequence analysis of cps 3Taï genes and deduced proteins. Shown are sites where at least one sequence differed from the reference sequence. Top: amino acid sequence; bottom: nucleotide sequence. The codons (amino acids) as indicated vertically in the first three rows are numbered according to published sequences; sites 1, 2 and 3 refer to the first, second and third positions in the respective codon. A region in wchE highly divergent in S. pneumoniae WU2 between codon 223.2 until 235.3 is shaded in grey; it includes 12 nt substitutions and 3 nt deletions resulting in two frameshifts within this region and the deletion of one amino acid in the deduced gene product. Sequences: WU2 (Acc. No. SPU15171); other Acc. Nos.: see legend to Fig. S1.

(TIF)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES