Abstract
Background
Pathogenic bacteria maintain a multifaceted apparatus to resist damage caused by external stimuli. As part of this, the universal stress protein A (UspA) and its homologues, initially discovered in Escherichia coli K-12 were shown to possess an important role in stress resistance and growth in several bacterial species.
Methods and Findings
We conducted a study to assess the role of three homologous proteins containing the UspA domain in the facultative intracellular human pathogen Listeria monocytogenes under different stress conditions. The growth properties of three UspA deletion mutants (Δlmo0515, Δlmo1580 and Δlmo2673) were examined either following challenge with a sublethal concentration of hydrogen peroxide or under acidic conditions. We also examined their ability for intracellular survival within murine macrophages. Virulence and growth of usp mutants were further characterized in invertebrate and vertebrate infection models.
Tolerance to acidic stress was clearly reduced in Δlmo1580 and Δlmo0515, while oxidative stress dramatically diminished growth in all mutants. Survival within macrophages was significantly decreased in Δlmo1580 and Δlmo2673 as compared to the wild-type strain. Viability of infected Galleria mellonella larvae was markedly higher when injected with Δlmo1580 or Δlmo2673 as compared to wild-type strain inoculation, indicating impaired virulence of bacteria lacking these usp genes. Finally, we observed severely restricted growth of all chromosomal deletion mutants in mice livers and spleens as compared to the load of wild-type bacteria following infection.
Conclusion
This work provides distinct evidence that universal stress proteins are strongly involved in listerial stress response and survival under both in vitro and in vivo growth conditions.
Introduction
Universal stress proteins (Usps) comprise a group of proteins induced by different stress conditions and are found in numerous prokaryotic as well as eukaryotic organisms [1], [2]. Among these, universal stress protein A (UspA) of Escherichia coli K-12 is best characterized and found to be highly expressed in response to heat, substrate starvation, exposure to antimicrobial agents and oxidative stress [1].
Subsequently, additional Usps have been described for E. coli K-12 and several other bacterial species, including Haemophilus influenza [3], [4], Mycobacterium smegmatis [5], Mycobacterium tuberculosis [2], [6], Pseudomonas aeruginosa [7]–[9], Porphyromonas gingivialis [10], Shigella sonnei [11], Salmonella typhimurium [12]–[14] and Lactobacillus plantarum [15], [16].
The majority of usp genes are monocistronically expressed, and different transcription factors, such as σ32, σ70 and σE promote transcription of Usps [1].
The significance of Usps in the model pathogen Listeria monocytogenes is presently unknown. L. monocytogenes is a ubiquitously occuring gram-positive, facultative intracellular bacterium that causes food-borne infections, which mainly affect pregnant women, newborns, elderly and immunocompromised patients [17], [18]. L. monocytogenes possesses the remarkable ability to grow under a wide range of temperatures, pH conditions and high osmolarity, allowing the pathogen to survive in nature, food preservation methods as well as in infected host cells [18].
Here we present first evidence that UspA domain containing stress proteins are of importance for L. monocytogenes to survive under different stress conditions both in vitro and in vivo.
Materials and Methods
Bacterial strains, plasmids and culture conditions
All bacterial strains and plasmids used in this study are listed in Table 1.
Table 1. Bacterial strains and plasmids used in this study.
Strain or plasmid | Description | Reference or source |
L. monocytogenes EGD-e | wild-type | [19] |
DH10β | electrocompetent | Life technologies |
Δlmo0515 | lmo0515 deletion (379 nt) strain of EGD-e | This study |
Δlmo1580 | lmo1580 deletion (409 nt) strain of EGD-e | This study |
Δlmo2673 | lmo2673 deletion (471 nt) strain of EGD-e | This study |
Δlmo0515Δlmo1580Δlmo2673 | lmo0515, lmo1580 and lmo2673 deletion strain of EGD-e | This study |
Δlmo0515+pPL2lmo0515 | complementation of lmo0515 deletion strain of EGD-e | This study |
Δlmo1580+pPL2lmo1580 | complementation of lmo1580 deletion strain of EGD-e | This study |
Δlmo2673+pPL2lmo2673 | complementation of lmo2673 deletion strain of EGD-e | This study |
pPL2 | site specific phage integration vector | [23] |
pCR2.1-TOPO® | single 3′-thymidine (T) overhangs for TA Cloning® 3.9 kb | Life technologies |
pAUL-A | temperature sensitive shuttle vector 9.2 kb | [21] |
The wild type strain L. monocytogenes EGD-e serotype 1/2a [19] and its isogenic usp deletion mutants or complemented strains were cultivated aerobically in Brain Heart Infusion medium (BHI; Difco) at 37°C or on BHI agar plates at 37°C.
E. coli strain (DH10βM) was grown in Luria-Bertani broth or LB agar plates at 37°C. When required, antibiotics were added to the following concentrations: erythromycin (Sigma), 300 µg/ml for E. coli and 5 or 10 µg/ml for Listeria; ampicillin (Sigma), 50 µg/ml for E. coli and 200 µg/ml for Listeria.
Construction of chromosomal usp deletion mutants
Generation of the usp in frame deletion mutants was done as previously described [20]–[22]. Briefly, the flanking regions of each usp gene were amplified by PCR (Taq polymerase; Fermentas) using primer pairs 1 and 2b for the 5′ flanking region and 3b and 4 for the 3′ flanking region (Table 2), respectively. The resulting PCR products were fused to each other by using primers 1 and 4 in a second PCR reaction with Taq polymerase and the product was cloned into pCR2.1-TOPO®.
Table 2. Primers used in this study.
Name | 5′-3′ Sequence |
lmo0515-1 | GCATTGCCACAAACTGGTGA |
lmo0515-2b | AAGTGTCGCTGCTACAAGAATGCGATG |
lmo0515-3b | CTTGTAGCAGCGACACTTTAATAGCTA |
lmo0515-4 | TTTTGGGGCTGATCCTACGC |
lmo0515-5 | ATTATTGTGAATTCATTAG |
lmo0515-6 | TACTTCGATCCATTTTGAT |
lmo0515-7 | CGACAGTGGACATGTTGATC |
lmo0515-8 | ACCCAATTTGGTCATGCGAT |
lmo1580-1 | GGGTCATTGCCACCCTATT |
lmo1580-2b | ACATCGCAAGAATAATTCCTCCAATCAAAA |
lmo1580-3b | AGGAATTATTCTTGCGATGTTCTTGTAGTTCG |
lmo1580-4 | GTTTTCGTTGACCGTATCCA |
lmo1580-5 | CTAAATCACTCTCCTCGTTA |
lmo1580-6b | GCACTTAACCAAGTGCGCG |
lmo1580-7 | TCTACAATTTTTGCTCCCGC |
lmo1580-8 | GTAAAACTGCAGAACAAGTA |
lmo2673-1 | TAAGAGCTGCACTCGGTAGA |
lmo2673-2b | TATACATGAATTTGTATCACCCTCTCAAAAGTTTTC |
lmo2673-3b | GTGATACAAATTCATGTATAATGAAGGTATTG |
lmo2673-4 | CCAACAAGCGCGCAACGAATACC |
lmo2673-5 | AAAGAGACCCCCTTTTCCTC |
lmo2673-6 | TTTTTCTCCTCCTGCCGTAT |
lmo2673-7 | AGCATCCGTCACTAGCCCTG |
lmo2673-8 | GCTATCTTCGTAAGCAGTGA |
lmo0515-forward | GATGGTTCAGAACCAGCAAA |
lmo0515-reverse | GCTTTTTCTTCTAAGCTGCCAT |
lmo1580-forward | GCAGTTGATGGATCCAAAGAA |
lmo1580-reverse | TTTATCCGCCATGCTTGTATC |
lmo2673-forward | ATAACGCGAAATTTTGAACCCG |
lmo2673-reverse | CCAAGGTTTTGCGTGAACAA |
For the generation of Δlmo0515 and Δlmo2673 the pCR2.1-TOPO® vector containing the flanking region of the respective gene was digested with BamHI, XhoI and NcoI (Fermentas) and inserted into pAUL-A [21], that was previously digested with BamHI and SalI (Fermentas). The pCR2.1-TOPO® vector containing the flanking region of Δlmo1580 was digested with XbaI and SacI (Fermentas) and ligated with pAUL-A, also previously digested with the same restriction endonucleases.
We designated resulting pAUL-A vectors containing the flanking regions of the respective usp genes, pCS1 for Δlmo0515, pCS2 for Δlmo1580 and pCS3 for Δlmo2673. These vectors were transformed into E. coli and were isolated, sequenced and subsequently electroporated into L. monocytogenes wild-type strain. Gene replacement was performed as previously described by Schaeferkordt et al. [21], [22]. To create a triple mutant (Δlmo0515Δlmo1580Δlmo2673) for all three usp genes, gene replacement were carried out as described above starting with the electroporation of pCS2 into Δlmo0515. Finally, pCS3 was electroporated into the resulting double mutant to generate the isogenic triple mutant (Δlmo0515Δlmo1580Δlmo2673). The chromosomal deletion was confirmed by DNA sequencing of PCR products using primer 7 and 8 (Table 2).
The complementation of the Δlmo0515, Δlmo1580 and Δlmo2673 deletion mutants was carried out using the L. monocytogenes site specific phage integration vector pPL2 [23]. PCR products were generated using primer pairs 5 and 6 with Taq polymerase. The product was cloned into pCR 2.1-TOPO®. The pCR 2.1-TOPO® vector containing the usp gene region of lmo0515 or lmo2673 was digested with BamHI and XhoI (Fermentas) and for lmo1580 with XhoI and SacI (Fermentas), respectively. The insert was ligated with pPL2, also previously digested with the same restriction endonucleases. Primer sequences used for the complementation of the deleted genes are listed in table 2.
Acid stress assay
Single colonies of the wild type L. monocytogenes and its usp deletion mutants grown on BHI agar plates were used to inoculate 100 ml Erlenmeyer flasks containing 10 ml of BHI broth, followed by overnight incubation at 37°C with shaking (180 rpm, Unitron Infors). The overnight cultures were then subcultured (1∶50) in 40 ml of BHI and grown to an optical density at 600 nm (OD600) of 0.4 prior to our experiments. Then each culture was divided into two aliquots, 20 ml each and cells were harvested by centrifugation at 6,000×g for 15 min. at 37°C. Furthermore the supernatant was removed and cells were resuspended in a BHI broth that was acidified with a 6 N HCL solution (Sigma) to pH 2.5. These tubes were incubated with shaking (180 rpm) at 37°C. At time point zero (t = 0) and after 10, 20 and 30 minutes intervals samples were taken from each culture, serially diluted with phosphate-buffered saline (1×PBS) and plated on BHI agar plates. The colony forming units (CFU) were counted after overnight incubation at 37°C. The percentage of survivors was calculated by comparing the number of survivors in BHI (pH 2.5) after 10, 20 and 30 minutes with the number of cells in BHI (pH 2.5) at t = 0, respectively. Results are reported as means of data collected from three independent biological replicates.
Hydrogen peroxide sensitivity assay
BHI broth was used to dilute a 3% hydrogen peroxide (H2O2) solution (Ottmar Fischer, Germany) to obtain 0.045% H2O2 final concentration.
Overnight cultures in 10 ml BHI broth (in 100 ml Erlenmeyer flasks) were prepared and were diluted 1∶50 in 20 ml fresh BHI broth or in 20 ml of different fresh BHI supplemented with 0.045% H2O2 (in 100 ml Erlenmeyer flasks) as mentioned before. The optical density (OD600) of the bacterial culture was measured at the indicated times after incubation at 37°C (180 rpm, Unitron, Infors).
Macrophage survival assay
P388D1 murine macrophages, cultured in 24-well plates in RPMI (Life Technologies) supplemented with 10% fetal calf serum (FCS) and 1% nonessential amino acids (NEAs), were infected with 1×107 bacteria to obtain an MOI of 10. After 30 min. RPMI was removed, and cells were washed twice with 1×PBS and incubated for 1 h in RPMI medium containing 50 µg/ml gentamicin. Macrophages were then washed three times with 1×PBS and lysed with ice-cold 0.2% Triton X-100 in H2O. The released bacteria were plated on BHI agar plates in appropriate dilutions and quantified after overnight incubation at 37°C.
For the determination of macrophage survival rates the CFU numbers in the inoculum of the wild-type and the mutants used to infect P388D1 were compared and a factor was calculated. The wild-type factor was set to 1 and depending on the CFU numbers of the mutant inoculums their factor was <1 or >1. For the calculation of the survival in % we set the CFU number of wild-type to 100% and percentage survival of the mutants was set in relation to wild-type.
cDNA synthesis and quantitative Real-Time Polymerase Chain Reaction
Messenger RNA levels of lmo0515, lmo1580 and lmo2673 isolated from extracellular grown bacteria in BHI and intracellular replicating bacteria in murine macrophages as previously described [24] were assessed in L. monocytogenes wild-type strain using quantitative Real-Time-PCR (qRT-PCR). Complementary DNA (cDNA) was obtained from bacteria from each setting by reverese transcription of RNA isolated and purified using the RNeasy Mini kit (Qiagen). Triplicates were performed for each forward and reverse primer pair combination. Primers were purchased from Qiagen (Quantitect Primer Assay) (see Table 2).
Primers were diluted to 1 pmol/µl for further procedure and qRT-PCR was run (7900 HT Fast Real Time System, Applied Biosystems). 16sRNA was used as for normalization and calculation of relative expression.
Threshold cycle values (CT) of the tested genes were determined and normalized expression of each target gene was given as the ΔCT between the log2 transformed CT of the target gene and the log2 transformed CT of the internal control (ACTB). Log2 transformed gene expression levels (ΔCT) of each target gene for i5ntra- and extracellular bacteria were expressed as log2 differences from control ( = log2 ΔΔCT method). Data was acquired and analyzed with the SDS 2.3 and RQ-Manager 1.2, respectively.
Animals and insects
Six to eight week-old female BALB/c mice, purchased from Harlan Winkelmann (Borchen, Germany), were kept at our breeding facilities in specific-pathogen-free conditions and used in all experiments. Galleria mellonella larvae, purchased from fauna topics (Marbach, Germany) were reared at 32°C in darkness and on an artificial diet (22% maize meal, 22% wheat germ, 11% dry yeast, 17.5% bee wax, 11% honey and 11% glycerine) prior to use. Last instar larvae, each weighing between 250 and 350 mg, were used in all experiments [20].
Insect and animal models of infection
In all experiments, fresh cultures of bacteria, prepared from an overnight culture, were used. Briefly, bacteria were grown in Brain heart Infusion (BHI) at 37°C, harvested in the exponential growth phase and washed twice with 1×PBS. The pellet was resuspended in 1×PBS and the bacterial concentration was calibrated by optical absorption. Further dilutions were prepared in 1×PBS to obtain required numbers of bacteria for infection. The infection of G. mellonella was performed as previously described by Mukkerjee et al [20]. Briefly, the human pathogenic L. monocytogenes and its isogenic usp deletion mutants or complemeted strains were separately injected (106 CFU/larva) into the hemocoel of the last instar larvae and the infection was monitored at 37°C.
In all experiments, fresh cultures of bacteria, prepared from an overnight culture, were used. Briefly, bacteria were grown in Brain heart Infusion (BHI) at 37°C, harvested in the exponential growth phase and washed twice with 1×PBS. The pellet was resuspended in 1×PBS and the bacterial concentration was calibrated by optical absorption. Further dilutions were prepared in 1×PBS to obtain required numbers of bacteria for infection.
Primary mice infections in vivo infection with L. monocytogenes wild-type, Δlmo0515, Δlmo1580, Δlmo2673 or Δlmo0515Δlmo1580Δlmo2673 were performed by an intravenous injection of viable bacteria in a volume of 0.2 ml of 1×PBS. Spleens and livers were harvested three days after infection. Bacterial growth in spleens and livers was determined by plating 10-fold serial dilutions of the organ homogenates on BHI agar plates. Colonies were counted after 24 h of incubation at 37°C.
Ethics statement
This study was carried out in strict accordance with the regulation of the National Protection Animal Act (§7-9a Tierschutzgesetz). The protocol was approved by the local Committee on the Ethics of Animal Experiments (Regierungsbezirk Mittelhessen) and permission was given by the local authority (Regierungspraesidium Giessen, Permit Number: GI 15/5-Nr.63/2007).
Statistical analysis
All experimental work was performed for a minimum of three times. Significant differences between two values were compared with a paired Student's t-test. Values were considered significantly different when P<0.05.
Results
Comparative genomic analysis and promoter prediction
All three Usps of L. monocytogenes harbor an UspA domain based on the Pfam analysis (data not shown), and thus represent paralogues of the UspA family of E. coli [1]. The structure and function of UspA is highly conserved among several bacteria and eukaryotic organisms. In line with this, comparative analysis in 19 listerial strains including all serotypes using GECO [25] (cut-off protein identity 80%, 90%) revealed a common chromosomal location for all three usp genes (Figure S1, S2, S3). Previously identified regulatory RNAs [26] were not located in the flanking regions of the usp genes. Furthermore, promoter box analysis of the upstream regions indicated that all usp genes habour a σB box upstream of their trancriptional start sites (Figure 1).
Figure 1. Transcriptional overview of chromosomal loci of lmo0515 (A), lmo1580 (B), and lmo2673 (C) derived from sequencing data of L. monocytogenes (data not shown).
σB boxes are depicted as orange arrows, the primary transcripts from their start sites by grey bars, the ribosome binding site as a yellow box and the respective coding sequence from their start sites by green bars.
Universal stress proteins contribute to extracellular survival of L. monocytogenes at low pH condition
L. monocytogenes is able to resist and survive at low pH conditions, which may occur in acidic food, in the gastric milieu and within the macrophage phagosome [27], [28]. In order to assess the role of listerial Usps at low pH environment we challenged exponentially grown L. monocytogenes and its isogenic usp deletion mutants (Δlmo0515, Δlmo1580 and Δlmo2673) with acidic BHI-medium (pH = 2.5) and determined the percentage of CFU at 10, 20 and 30 min after inoculation (Figure 2).
Figure 2. Effect of low acidic condition (pH = 2.5) on survival of usp deletion mutants compared to L. monocytogenes EGD-e wild-type.
Δlmo0515 and Δlmo1580 display decreased growth at all observations, while impaired resistance in Δlmo2673 was visible only at 20 min post challenge. Statistically significant differences were identified using a two-tailed Student t test. (*, p<0.05 and **, p<0.005).
The CFU counts of both, Δlmo0515 and Δlmo1580 were significantly lower compared to wild-type bacteria at each time point. We observed no significant difference in survival rate between wild-type and Δlmo2673. Δlmo1580 was most susceptible to an increase in acid over the time course which was reflected by a more than 100 fold lower survival rate of the culture as compared to the wild-type strain.
Universal stress proteins are crucial for oxidative stress resistance of L. monocytogenes
L. monocytogenes is known to be resistant to oxidative stress, occurring in the macrophage phagosome, where reactive oxygen species (ROS), such as H2O2 are produced to kill engulfed pathogens [29].
To elucidate the role of listerial Usps in response to oxidative stress, we determined the survival of Δlmo0515, Δlmo1580 and Δlmo2673 using optical density measurement in BHI medium supplemented with H2O2 following a 3 h incubation period (Figure 3).
Figure 3. Survival of L. monocytogenes EGD-e wild-type and usp deletion mutants after exposure to H2O2.
As appreciable, resistance of all deletion mutants was strongly impaired, resulting in decreased growth as compared to wild-type strain. Statistically significant differences were identified using a two-tailed Student t test. (*, p<0.05; **, p<0.005, and ***, p<0.0005).
Exposure to H2O2 significantly impaired the growth of the mutants compared to the wild-type strain (OD600 = 0.55). While growth attenuation was moderate in Δlmo0515 (OD600 = 0.3), a dramatic effect was seen for the lmo2673 mutant (OD600 = 0.16). The strongest effect was observed in Δlmo1580 with barely any growth detectable at any observation point. These results indicate a gradual order in susceptibility to oxidative stress in the three usp mutants as follows: Δlmo1580>Δlmo2673>Δlmo0515.
Survival attenuation of Δlmo1580 and Δlmo2673 in murine macrophages
Macrophages play a key role in the phagocytosis and intracellular killing of L. monocytogenes by generating ROS and acidic conditions in the phagosome. To examine the impact of Usps for intracellular survival, we determined the number of CFU isolated from P388D1 murine macrophages upon infection with either wild-type strain or the usp deletion mutants [30].
In agreement with our results at low pH condition and the oxidative stress response, the Δlmo1580 deletion had the strongest effect on intracellular listerial survival. Compared to the wild-type strain, only 72% of Δlmo1580 were able to resist the hostile macrophage environment. Δlmo2673 exhibited similar survival attenuation with 76% viable bacteria compared to wild-type strain. No significant effect on intracellular survival was detected in the Δlmo0515 mutant (Figure 4). To confirm that the usp genes are intracellular induced we appllied quantitative RT-PCR. The analysis showed that usp transcripts obtained from intracellular versus extracellular grown bacteria displayed a strong induction of usp genes (Figure 5).
Figure 4. The intracellular survival of L. monocytogenes EGD-e wild-type and usp deletion mutants was assessed in murine macrophages according to [30].
Intracellular bacteria burden was decreased in macrophages inoculated with Δlmo1580 and Δlmo2673, but no effect was visible for Δlmo0515. Statistically significant differences were identified using a two-tailed Student t test. (*, p<0.05 and **, p<0.005).
Figure 5. qRT-PCR analysis of lmo0515, lmo1580 and lmo2673 expressed in L. monocytogenes EGD-e.
The graph displays the relative expression of the respective usp gene in the intracellular vs. extracellular setting. High fold changes indicate that the particular gene was higher expressed in intracellularly localized bacteria as compared to expression in bacteria that were grown in BHI. The expression of lmo0515 and lmo2673 is strongly enhanced in intracellular pathogens, while levels of lmo1580 remain relatively constant. This is consistent with the observation made in this study, which shows a strong dependence on lmo2673 and lmo0515 in the murine infection model experiments as compared to extracellular in vitro challenges, while lmo1580 seems to play an important role in both conditions.
Decreased virulence of usp mutants in an invertebrate in vivo model
G. mellonella is currently a well established model host for studying the virulence attributes of the human pathogenic L. monocytogenes [20]. In this work, we used this invertebrate model to evaluate the pathogenicity of listerial usp deletion mutants. G. mellonella larvae were infected with pathogenic EGD-e and its isogenic usp mutants namely Δlmo1580, Δlmo2673 and Δlmo0515 respectively. Survival rate of the infected larvae was determined at 37°C for over a period of 7 days.
Attenuated virulence associated with higher survival rates of larvae (Figure 6) were observed in Δlmo1580, Δlmo2673 and Δlmo0515 (75%, 65% and 50% respectively) as compared to wild-type infection (37%). The difference between Δlmo0515 and wild-type did however not reach statistical significance. As observed previously with intracellular growth in macrophages, the Δlmo1580 mutation had the strongest effect on the pathogenicity, exhibiting nearly avirulent characteristics. A similar result was obtained for the triple mutant Δlmo0515Δlmo1580Δlmo2673 (Figure S4). To confirm that the deletion of usp genes is responsible for the effects in invertebrate infections we complemented the single usp mutants. Complementation restored the ability to kill insect larvae to levels comparable to the wild-type bacteria (Figure S5).
Figure 6. Survival of G. mellonella larvae after inoculation with usp deletion mutants.
As compared to L. monocytogenes EGD-e wild-type, all usp deletion mutants exhibited impaired virulence, resulting in higher survival rates of G. mellonella larvae. Strongest effects were observed for Δlmo1580 and Δlmo2673, while deletion of lmo0515 was not associated with significant increase in survival of G. mellonella. Results represent mean values of at least three independent experiments with a total of 80 larvae per treatment. Statistically significant differences were identified using a two-tailed Student t test. (***, p<0.0005 and ns-not significant).
We observed no differences in growth of usp mutants and wild-type strain when cultured in BHI (data not shown) which excludes the possibility that varying numbers of inoculum CFUs of usp deletion mutants affected the survival of insect larvae.
Growth and survival of Listeria usp deletion mutants is profoundly impaired in a murine infection model
Although several studies have investigated the role of Usps in different bacteria, an important role of Usps in vivo has only been shown for the regulation of growth in S. typhimurium [12] and M. tuberculosis [6]. To elucidate the influence of listerial Usps on the growth and survival in vivo, we injected BALB/c mice with three different usp deletion mutants or wild-type and determined the number of bacteria isolated from the liver.
Remarkably, the number of CFU of all mutants compared to wild-type was dramatically diminished in this mouse model (Figure 7). The number of viable bacteria lacking the respective usp gene was significantly lower in livers and spleens of infected mice. In this setting, growth of Δlmo0515 was reduced to 22% in spleen and 32% in liver as compared to wild-type strain. The number of Δlmo2673 was reduced to 68% and 60%, and the Δlmo1580 count declined to 38% and 68%, respectively. The isogenic usp triple mutant showed comparable results as the single usp mutants.
Figure 7. Survival rates of intravenously inoculated L. monocytogenes EGD-e or usp deletion mutants in mice livers and spleens.
Survival of mutant bacteria are impaired in both organs, reflecting a role of Usps in listerial resistance and growth in vivo. Statistically significant differences were identified using a two-tailed Student t test. (*, p<0.05).
Discussion
L. monocytogenes is capable of withstanding a variety of stressors encountered in nature and within infected host cells [18]. The ability to rapidly adjust to the changing environment is essential for its pathogenic lifestyle [18]. In this study, we provide strong evidence that universal stress proteins (Usps) are highly conserved among Listeriae and are important for resistance and growth of L. monocytogenes by investigating usp deletion mutants exposed to different stress conditions both in vitro and in vivo.
Universal stress proteins were shown to be important in response to stress in gram-negative bacteria, including E. coli [31], S. typhimurium [12] and Azospirillium brasilense [32]. However, the role of these proteins in gram-positive bacteria is not as well delineated. We have previously revealed an induction of three genes, lmo0515, lmo2673 and lmo1580 in L. monocytogenes in response to heat shock and acid stress [33], [34]. In accordance with effects described for E. coli lacking the uspA gene, L. monocytogenes usp deletion mutations investigated in this study displayed impaired capability to resist exposure to H2O2 and low pH conditions. Variable susceptibility to stress conditions between deletion mutants may represent a non-redundant role of Usps in stress responses. Similar observations were made for E. coli and addressed in a recent study testing several usp deletion mutants [31]. Nachin et al. uncovered that the UspA proteins differ in their responses to oxidative stress and DNA damaging agents and defined similarities as well as differences in expression pattern based on their biological role in stress response [31]. Thus, certain environmental changes may not require the induction of all usp genes, but allow adjustment depending on the specialized role of a particular Usp.
Generally, usp genes are expressed in monocistronic units and the production of UspA seems to be primarily regulated at the level of transcription initiation [1]. We and others have previously reported an important role for σB, a transcription factor that controls an inducible regulon in L. monocytogenes induced following challenge to different stress conditions, such as acids, high osmolarity or carbohydrate starvation [17], [34], [35]. As previously reported, a single σB promoter has been identified for lmo1580; and promoter analysis revealed σB boxes for lmo2673 and lmo0515. Thus, it appears likely that σB possesses a major role in stress induced transcriptional regulation of usp genes in L. monocytogenes. Furthermore, phenolic acids and fructose-6-phosphate were shown to influence usp gene expression in Lactobacillus plantarum and E coli, respectively. L. monocytogenes mobilizes a large set of metabolic genes in response to stress [24]. Especially, genes of the carbohydrate metabolism are strongly expressed. Possible effects of metabolic constituents on usp gene regulation may therefore not be excluded and require further investigation. [15], [36].
In this regard, the temporal and coordinated activities of different Usps of L. monocytogenes may enable the bacteria to survive in acid-rich niches such as in the upper intestinal tract or mediate resistance to oxidative stress and bile acids in the spleen and liver.
Following ingestion by phagocytic cells, Listeriae are faced with the hostile environment in the phagosome [18]. As shown previously, virulence and intracellular growth adaption of L. monocytogenes depends on a concerted gene expression program including the up-regulation of universal stress proteins [24], [37]. In this study, we demonstrate that survival of Listeriae in murine macrophages is dependent on the presence of Usps. This was reflected by decreased virulence, resulting in a significant reduction of bacteria lacking the respective usp genes. In addition we observed intracellular transcriptional induction of all three usp genes which supports the evidence that the particular stress proteins are involved in the intracellular pathogenic lifestyle of L. monocytogenes.
The impact of Usps in infection has only been examined for a few bacteria and their role, if any, in gram-positive pathogens has not been described [6], [12], [31], [37]. For this reason, we further characterized the effect of listerial Usps in in vivo infection models. First we tested their effects on the viability of G. mellonella larvae, a recently described alternative infection model for L. monocytogenes [20]. Lack of usp genes resulted in improved survival of infected larvae as compared to wild-type infection. In accordance with our in vitro results, Δlmo1580 was nearly avirulent demonstrating its importance in pathogenicity of L. monocytogenes. As also demonstrated here, Usps contribute strongly to the survival and proliferation of these bacteria in livers and spleens of infected mice, while no major differences were apparent when comparing both organs. We have also constructed a triple mutant to investigate the cooperative nature of the three usp genes. We could not observe any synergistic effect for the usp triple mutant in mice experiments, but in the invertebrate infection model the isogenic triple mutant indicated a similar survival rate for larvae infected with Δlmo1580. Thus, we suspect that Δlmo1580 might be the major player among the three usp genes involved in pathogenicity.
Previously, Usps were implicated in the resistance to antibiotics [38], biofilm formation by P. gingivalis [10] and survival of P. aeruginosa under anaerobic conditions [7]. In this study however, we did not identify a significant impact of usp gene deletion on biofilm formation or altered resistance under anaerobic/microaerophilic conditions and in response to treatment with several antibiotics (data not shown).
In conclusion, we have identified an important role of three universal stress proteins in resistance and survival of L. monocytogenes in response to low pH conditions and oxidative stress as well as intracellular survival within macrophages. We subsequently confirmed our observations in two in vivo infection models and show for the first time that universal stress proteins are important for survival and growth in the vertebrate and invertebrate hosts. Finally, we propose the designation of genes for lmo0515, lmo1580 and lmo2673 as uspL-1 (universal stress protein Listeria), uspL-2 and uspL-3, respectively in the species L. monocytogenes.
Supporting Information
Comparative analysis of flanking regions of listerial universal stress protein lmo0515 among 19 L. monocytogenes species including all known serotypes.
(PDF)
Comparative analysis of flanking regions of listerial universal stress protein lmo1580 among 19 L. monocytogenes species including all known serotypes.
(PDF)
Comparative analysis of flanking regions of listerial universal stress protein lmo2673 among 19 L. monocytogenes species including all known serotypes.
(PDF)
Survival of G. mellonella larvae after inoculation with usp deletion mutants. As compared to L. monocytogenes EGD-e wild-type, triple deletion mutant of lmo1580, lmo2673 and lmo0515 exhibited impaired virulence similar to the single gene deletion mutant Δlmo1580, resulting in significant higher survival rates of G. mellonella larvae. Results represent mean values of at least three independent experiments and each repetition contained 30 larvae per treatment. Statistically significant differences were identified using a two-tailed Student t test. (***, p<0.005).
(TIF)
Complemetation of lmo1580, lmo2673 and lmo0515 into their respective isogenic deletion mutants Δlmo1580, Δlmo2673 and Δlmo0515 resulted in induced virulence. Artificial introduction of the individual usp genes lmo1580, lmo2673 and lmo0515 into their respective isogenic deletion mutants Δlmo1580, Δlmo2673 and Δlmo0515 resulted in an increase of virulence similar to the wild-type EGD-e. Results represent means of at least three independent determinations ± standard deviations. Each repetition contained 20 larvae per treatment.
(TIF)
Acknowledgments
We would like to thank Alexandra Amend, Juri and Nelli Schklarenko, Silke Silva and Martina Hudel for excellent advice and technical assistance.
Footnotes
Competing Interests: The authors have declared that no competing interests exist.
Funding: This work was supported by the German Federal Ministry of Education and Research (BMBF, ERA-NET PathoGenomics Network projects sncRNAomics 0315437A to TH and LISTRESS 0315907A to TH and TC) and through the LOEWE program of the state Hessia by the collaborative research project Insect Biotechnology to TH and TC. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Kvint K, Nachin L, Diez A, Nystrom T. The bacterial universal stress protein: function and regulation. Curr Opin Microbiol. 2003;6:140–145. doi: 10.1016/s1369-5274(03)00025-0. [DOI] [PubMed] [Google Scholar]
- 2.O'Toole R, Williams HD. Universal stress proteins and Mycobacterium tuberculosis. Res Microbiol. 2003;154:387–392. doi: 10.1016/S0923-2508(03)00081-0. [DOI] [PubMed] [Google Scholar]
- 3.Sousa MC, McKay DB. Structure of the universal stress protein of Haemophilus influenzae. Structure. 2001;9:1135–1141. doi: 10.1016/s0969-2126(01)00680-3. [DOI] [PubMed] [Google Scholar]
- 4.Fleischmann RD, Adams MD, White O, Clayton RA, Kirkness EF, et al. Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science. 1995;269:496–512. doi: 10.1126/science.7542800. [DOI] [PubMed] [Google Scholar]
- 5.O'Toole R, Smeulders MJ, Blokpoel MC, Kay EJ, Lougheed K, et al. A two-component regulator of universal stress protein expression and adaptation to oxygen starvation in Mycobacterium smegmatis. J Bacteriol. 2003;185:1543–1554. doi: 10.1128/JB.185.5.1543-1554.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Drumm JE, Mi K, Bilder P, Sun M, Lim J, et al. Mycobacterium tuberculosis universal stress protein Rv2623 regulates bacillary growth by ATP-Binding: requirement for establishing chronic persistent infection. PLoS Pathog. 2009;5:e1000460. doi: 10.1371/journal.ppat.1000460. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Schreiber K, Boes N, Eschbach M, Jaensch L, Wehland J, et al. Anaerobic survival of Pseudomonas aeruginosa by pyruvate fermentation requires an Usp-type stress protein. J Bacteriol. 2006;188:659–668. doi: 10.1128/JB.188.2.659-668.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Boes N, Schreiber K, Hartig E, Jaensch L, Schobert M. The Pseudomonas aeruginosa universal stress protein PA4352 is essential for surviving anaerobic energy stress. J Bacteriol. 2006;188:6529–6538. doi: 10.1128/JB.00308-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Boes N, Schreiber K, Schobert M. SpoT-triggered stringent response controls usp gene expression in Pseudomonas aeruginosa. J Bacteriol. 2008;190:7189–7199. doi: 10.1128/JB.00600-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Chen W, Honma K, Sharma A, Kuramitsu HK. A universal stress protein of Porphyromonas gingivalis is involved in stress responses and biofilm formation. FEMS Microbiol Lett. 2006;264:15–21. doi: 10.1111/j.1574-6968.2006.00426.x. [DOI] [PubMed] [Google Scholar]
- 11.Chen J. uspA of Shigella sonnei. J Food Prot. 2007;70:2392–2395. doi: 10.4315/0362-028x-70.10.2392. [DOI] [PubMed] [Google Scholar]
- 12.Liu WT, Karavolos MH, Bulmer DM, Allaoui A, Hormaeche RD, et al. Role of the universal stress protein UspA of Salmonella in growth arrest, stress and virulence. Microb Pathog. 2007;42:2–10. doi: 10.1016/j.micpath.2006.09.002. [DOI] [PubMed] [Google Scholar]
- 13.Fink RC, Evans MR, Porwollik S, Vazquez-Torres A, Jones-Carson J, et al. FNR is a global regulator of virulence and anaerobic metabolism in Salmonella enterica serovar Typhimurium (ATCC 14028s). J Bacteriol. 2007;189:2262–2273. doi: 10.1128/JB.00726-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Sagurthi SR, Panigrahi RR, Gowda G, Savithri HS, Murthy MR. Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of universal stress protein F (YnaF) from Salmonella typhimurium. Acta Crystallogr Sect F Struct Biol Cryst Commun. 2007;63:957–960. doi: 10.1107/S1744309107048610. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Licandro-Seraut H, Gury J, Tran NP, Barthelmebs L, Cavin JF. Kinetics and intensity of the expression of genes involved in the stress response tightly induced by phenolic acids in Lactobacillus plantarum. J Mol Microbiol Biotechnol. 2008;14:41–47. doi: 10.1159/000106081. [DOI] [PubMed] [Google Scholar]
- 16.Gury J, Seraut H, Tran NP, Barthelmebs L, Weidmann S, et al. Inactivation of PadR, the repressor of the phenolic acid stress response, by molecular interaction with Usp1, a universal stress protein from Lactobacillus plantarum, in Escherichia coli. Appl Environ Microbiol. 2009;75:5273–5283. doi: 10.1128/AEM.00774-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Hain T, Hossain H, Chatterjee SS, Machata S, Volk U, et al. Temporal transcriptomic analysis of the Listeria monocytogenes EGD-e sigma B regulon. BMC Microbiol. 2008;8:20. doi: 10.1186/1471-2180-8-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Vazquez-Boland JA, Kuhn M, Berche P, Chakraborty T, Dominguez-Bernal G, et al. Listeria pathogenesis and molecular virulence determinants. Clin Microbiol Rev. 2001;14:584–640. doi: 10.1128/CMR.14.3.584-640.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Glaser P, Frangeul L, Buchrieser C, Rusniok C, Amend A, et al. Comparative genomics of Listeria species. Science. 2001;294:849–852. doi: 10.1126/science.1063447. [DOI] [PubMed] [Google Scholar]
- 20.Mukherjee K, Altincicek B, Hain T, Domann E, Vilcinskas A, et al. Galleria mellonella as a model system for studying Listeria pathogenesis. Appl Environ Microbiol. 2010;76:310–317. doi: 10.1128/AEM.01301-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Schaferkordt S, Chakraborty T. Vector plasmid for insertional mutagenesis and directional cloning in Listeria spp. Biotechniques. 1995;19:720–725. [PubMed] [Google Scholar]
- 22.Gaillard JL, Berche P, Mounier J, Richard S, Sansonetti P. In vitro model of penetration and intracellular growth of Listeria monocytogenes in the human enterocyte-like cell line Caco-2. Infect Immun. 1987;55:2822–2829. doi: 10.1128/iai.55.11.2822-2829.1987. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Lauer P, Chow MY, Loessner MJ, Portnoy DA, Calendar R. Construction, characterization, and use of two Listeria monocytogenes site-specific phage integration vectors. J Bacteriol. 2002;184:4177–4186. doi: 10.1128/JB.184.15.4177-4186.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Chatterjee SS, Hossain H, Otten S, Kuenne C, Kuchmina K, et al. Intracellular gene expression profile of Listeria monocytogenes. Infect Immun. 2006;74:1323–1338. doi: 10.1128/IAI.74.2.1323-1338.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Kuenne CT, Ghai R, Chakraborty T, Hain T. GECO–linear visualization for comparative genomics. Bioinformatics. 2007;23:125–126. doi: 10.1093/bioinformatics/btl556. [DOI] [PubMed] [Google Scholar]
- 26.Mraheil MA, Billion A, Mohamed W, Mukherjee K, Kuenne C, et al. The intracellular sRNA transcriptome of Listeria monocytogenes during growth in macrophages. Nucleic Acids Res. 2011;39:4235–4248. doi: 10.1093/nar/gkr033. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Cotter PD, Gahan CG, Hill C. Analysis of the role of the Listeria monocytogenes F0F1 -ATPase operon in the acid tolerance response. Int J Food Microbiol. 2000;60:137–146. doi: 10.1016/s0168-1605(00)00305-6. [DOI] [PubMed] [Google Scholar]
- 28.Ferreira A, Sue D, O'Byrne CP, Boor KJ. Role of Listeria monocytogenes sigma B in survival of lethal acidic conditions and in the acquired acid tolerance response. Appl Environ Microbiol. 2003;69:2692–2698. doi: 10.1128/AEM.69.5.2692-2698.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Rea R, Hill C, Gahan CG. Listeria monocytogenes PerR mutants display a small-colony phenotype, increased sensitivity to hydrogen peroxide, and significantly reduced murine virulence. Appl Environ Microbiol. 2005;71:8314–8322. doi: 10.1128/AEM.71.12.8314-8322.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Machata S, Tchatalbachev S, Mohamed W, Jansch L, Hain T, et al. Lipoproteins of Listeria monocytogenes are critical for virulence and TLR2-mediated immune activation. J Immunol. 2008;181:2028–2035. doi: 10.4049/jimmunol.181.3.2028. [DOI] [PubMed] [Google Scholar]
- 31.Nachin L, Nannmark U, Nystrom T. Differential roles of the universal stress proteins of Escherichia coli in oxidative stress resistance, adhesion, and motility. J Bacteriol. 2005;187:6265–6272. doi: 10.1128/JB.187.18.6265-6272.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Galindo Blaha CA, Schrank IS. An Azospirillum brasilense Tn5 mutant with modified stress response and impaired in flocculation. Antonie Van Leeuwenhoek. 2003;83:35–43. doi: 10.1023/a:1022937828186. [DOI] [PubMed] [Google Scholar]
- 33.van d V, Hain T, Wouters JA, Hossain H, de Vos WM, et al. The heat-shock response of Listeria monocytogenes comprises genes involved in heat shock, cell division, cell wall synthesis, and the SOS response. Microbiology. 2007;153:3593–3607. doi: 10.1099/mic.0.2007/006361-0. [DOI] [PubMed] [Google Scholar]
- 34.Wemekamp-Kamphuis HH, Wouters JA, de Leeuw PP, Hain T, Chakraborty T, et al. Identification of sigma factor sigma B-controlled genes and their impact on acid stress, high hydrostatic pressure, and freeze survival in Listeria monocytogenes EGD-e. Appl Environ Microbiol. 2004;70:3457–3466. doi: 10.1128/AEM.70.6.3457-3466.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Kazmierczak MJ, Mithoe SC, Boor KJ, Wiedmann M. Listeria monocytogenes sigma B regulates stress response and virulence functions. J Bacteriol. 2003;185:5722–5734. doi: 10.1128/JB.185.19.5722-5734.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Persson O, Valadi A, Nystrom T, Farewell A. Metabolic control of the Escherichia coli universal stress protein response through fructose-6-phosphate. Mol Microbiol. 2007;65:968–978. doi: 10.1111/j.1365-2958.2007.05838.x. [DOI] [PubMed] [Google Scholar]
- 37.Camejo A, Buchrieser C, Couve E, Carvalho F, Reis O, et al. In vivo transcriptional profiling of Listeria monocytogenes and mutagenesis identify new virulence factors involved in infection. PLoS Pathog. 2009;5:e1000449. doi: 10.1371/journal.ppat.1000449. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Schobert M, Jahn D. Anaerobic physiology of Pseudomonas aeruginosa in the cystic fibrosis lung. Int J Med Microbiol. 2010;300:549–556. doi: 10.1016/j.ijmm.2010.08.007. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Comparative analysis of flanking regions of listerial universal stress protein lmo0515 among 19 L. monocytogenes species including all known serotypes.
(PDF)
Comparative analysis of flanking regions of listerial universal stress protein lmo1580 among 19 L. monocytogenes species including all known serotypes.
(PDF)
Comparative analysis of flanking regions of listerial universal stress protein lmo2673 among 19 L. monocytogenes species including all known serotypes.
(PDF)
Survival of G. mellonella larvae after inoculation with usp deletion mutants. As compared to L. monocytogenes EGD-e wild-type, triple deletion mutant of lmo1580, lmo2673 and lmo0515 exhibited impaired virulence similar to the single gene deletion mutant Δlmo1580, resulting in significant higher survival rates of G. mellonella larvae. Results represent mean values of at least three independent experiments and each repetition contained 30 larvae per treatment. Statistically significant differences were identified using a two-tailed Student t test. (***, p<0.005).
(TIF)
Complemetation of lmo1580, lmo2673 and lmo0515 into their respective isogenic deletion mutants Δlmo1580, Δlmo2673 and Δlmo0515 resulted in induced virulence. Artificial introduction of the individual usp genes lmo1580, lmo2673 and lmo0515 into their respective isogenic deletion mutants Δlmo1580, Δlmo2673 and Δlmo0515 resulted in an increase of virulence similar to the wild-type EGD-e. Results represent means of at least three independent determinations ± standard deviations. Each repetition contained 20 larvae per treatment.
(TIF)