Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2011 Oct;55(10):4908–4911. doi: 10.1128/AAC.00535-11

Bacteriophages Carrying Antibiotic Resistance Genes in Fecal Waste from Cattle, Pigs, and Poultry▿

Marta Colomer-Lluch 1, Lejla Imamovic 1, Juan Jofre 1, Maite Muniesa 1,*
PMCID: PMC3187014  PMID: 21807968

Abstract

This study evaluates the occurrence of bacteriophages carrying antibiotic resistance genes in animal environments. blaTEM, blaCTX-M (clusters 1 and 9), and mecA were quantified by quantitative PCR in 71 phage DNA samples from pigs, poultry, and cattle fecal wastes. Densities of 3 to 4 log10 gene copies (GC) of blaTEM, 2 to 3 log10 GC of blaCTX-M, and 1 to 3 log10 GC of mecA per milliliter or gram of sample were detected, suggesting that bacteriophages can be environmental vectors for the horizontal transfer of antibiotic resistance genes.

TEXT

Antibiotics are widely used to protect human health and to increase the growth rate of animals in livestock husbandry. The use and abuse of antibiotics in humans and animals have exerted selective pressure on bacterial communities, resulting in the emergence of resistances (1, 22). There are concerns about the potential impact of antibiotic residues in the aquatic environment, where many antibiotics are discharged (26, 36).

In addition to the antibiotics synthesized for therapy, many antibiotics are produced by environmental microorganisms (15, 34). These organisms host antibiotic resistance genes (ARGs) that protect them from the antibiotics they produce (16). Environmental bacteria that do not produce antibiotics themselves also carry ARGs conserved as a consequence of the selective pressure of antibiotics in certain environments (26, 36) or used for different purposes (14). Therefore, when bacteria reach clinical settings, these ARGs from environmental origins are challenged with high concentrations of antibiotics and antibacterial resistance evolves and emerges under the strong selective pressure that occurs during the treatment of infections (26).

Many ARGs are acquired by bacteria through conjugative transfer by mobile elements (plasmids or integrative and conjugative elements), by transformation by naked DNA, or by transduction by bacteriophages (36). Compared with other genetic vectors, less is known about the contribution of phages to antibiotic resistance transfer. Recent reports (1, 7, 10) suggest that the horizontal transfer of ARGs by phages is much more widespread than previously believed and that the environment plays a crucial role in it (7).

This study was focused on blaTEM and blaCTX-M, which encode β-lactamases that are widespread among Gram-negative pathogens (11), and mecA, which encodes penicillin-binding protein 2a (PBP2a), associated with methicillin resistance in staphylococci (32). Quantification of these genes by quantitative PCR (qPCR) was done in the viral DNA fraction of animal fecal wastes. Assuming that phages are the major part of the viral fraction in most environments (17), we sought to highlight the potential role of phages in the spread of ARGs in animal settings.

This study was conducted with archived fecal wastes collected from several slaughterhouses and farms in Spain. We analyzed 8 cattle slurries, 9 wastewater samples from abattoirs slaughtering pigs and 16 from poultry slaughter, 10 wastewater samples containing mixed fecal wastes of poultry, ducks, rabbits, and domestic dogs and cats, and 28 fecal samples aseptically collected from cowpats in summer pastures in the Pyrenees mountains. The fecal contamination in the samples was established by enumerating fecal coliforms and Escherichia coli (9). Somatic coliphages, proposed as fecal viral indicators, allowed evaluation of the levels of bacteriophages (2, 5) The samples showed levels of bacterial and viral indicators that were relatively homogeneous (Table 1) and similar to those previously reported (5, 23).

Table 1.

Fecal coliforms and E. coli as bacterial indicators and somatic coliphages as viral indicators detected in animal waste and fecal samples

Sample type No. of samples No. [CFU/ml or CFU/g (SD)] of:
No. [PFU/ml or PFU/g (SD)] of somatic coliphages
Fecal coliforms E. coli
Cattle slurry 8 1.7 × 105 (1.5 × 105) 3.3 × 104 (8.2 × 103) 1.1 × 104 (1.4 × 104)
Pig wastewater 9 1.4 × 106 (1.4 × 106) 4.6 × 105 (1.1 × 105) 7.6 × 105 (1.1 × 106)
Poultry wastewater 16 9.4 × 105 (3.6 × 105) 7.8 × 104 (2.2 × 104) 1.8 × 104 (1.8 × 104)
Mixed slurrya 10 3.2 × 105 (1.0 × 106) 2.2 × 104 (6.5 × 104) 8.5 × 103 (1.2 × 104)
Cowpats 28 7.9 × 103 (3.2 × 103) 3.9 × 103 (7.2 × 103) 4.0 × 103 (4.2 × 103)
a

Slurries were from a farm with fecal loads from diverse animal origins.

Phage DNA was purified from the samples as described previously (10, 23). Samples were treated with DNase (100 units/ml) to rule out the possibility of nonphage DNA contamination. For this, an aliquot taken after DNase treatment and before disencapsidation was evaluated using conventional PCR of eubacterial 16S ribosomal DNA (rDNA) (Table 2) and using qPCR.

Table 2.

Oligonucleotides used in this study

Target gene Reaction Oligonucleotide Sequence Amplimer size (bp) Reference
blaTEM TEM PCR UP CTCACCCAGAAACGCTGGTG 569 10
LP ATCCGCCTCCATCCAGTCTA
TEM qPCR UP CACTATTCTCAGAATGACTTGGT 85 24
LP TGCATAATTCTCTTACTGTCATG
Probe 6FAM-CCAGTCACAGAAAAGCATCTTACGG-MGBNFQ
blaCTX-M CTX-M-1 PCR UP ACGTTAAACACCGCCATTCC 356 10
    cluster 1 LP TCGGTGACGATTTTAGCCGC
CTX-M-1 qPCR UP CTX-M ACCAACGATATCGCGGTGAT 101 10
LP CTX-M ACATCGCGACGGCTTTCT
Probe 6FAM-TCGTGCGCCGCTG-MGBNFQ
blaCTX-M CTX-M-9 PCR UP ACGCTGAATACCGCCATT 346 This study
    cluster 9 LP CGATGATTCTCGCCGCTG
CTX-M-9 qPCR UP CTX-M ACCAATGATATTGCGGTGAT 85 This study
LP CTX-M CTGCGTTCTGTTGCGGCT
Probe 6FAM-TCGTGCGCCGCTG-MGBNFQ
mecA MecA PCR UP ATACTTAGTTCTTTAGCGAT 434 10
LP GATAGCAGTTATATTTCTA
MecA qPCR UP CGCAACGTTCAATTTAATTTTGTTAA 92 33
LP TGGTCTTTCTGCATTCCTGGA
Probe FAM-AATGACGCTATGATCCCAATCTAACTTCCACA-TAMRA
16S rDNA UP AAGAGTTTGATCCTGGCTCAG 1,503 29
LP TACGGCTACCTTGTTACGACTT

Conventional PCRs for ARGs were performed as described previously (10) (Table 2), using environmental E. coli strains and a clinical isolate of methicillin-resistant Staphylococcus aureus (MRSA) as controls for blaTEM, blaCTX-M, and mecA, respectively. TaqMan qPCR assays (Table 2) were used for quantification of ARGs using standards as previously described (10).

A real-time qPCR oligonucleotide set for blaCTX-M cluster 1 (10) and a new set for blaCTX-M cluster 9, developed in this study, were used to detect CTX-M in phage DNA isolated from animal wastes. The new qPCR oligonucleotides for blaCTX-M cluster 9 detect the most abundant variants of the cluster (CTX-M-9, 13, 14, 16 to 19, 21, and 27) (6) and showed a detection limit of 13 gene copies (GC) (threshold cycle of 31).

blaCTX-M clusters 1 and 9 were detected in phage DNA (Fig. 1A and B) without significant differences (P > 0.05, analysis of variance [ANOVA]) between the occurrence of the clusters. The densities of cluster 1 were slightly higher in swine samples, while poultry samples showed a significantly (P < 0.05) higher prevalence of cluster 9. CTX-M-1 was previously detected in phage DNA from municipal sewage of the same area (10), although at lower densities than in animal wastes. CTX-M is currently the most prevalent β-lactamase family in many countries (11). CTX-M cluster 1 is the most prevalent in pig isolates in Spain (13), and within this cluster, CTX-M-15 is the most widely distributed (12, 27). CTX-M cluster 9 is the most prevalent in poultry in Spain (13, 27), and within it, CTX-M-9 and CTX-M-14 are the most frequent in animal isolates (11). Both CTX-M-15 and CTX-M-9 have been linked to E. coli O25b:H4, a serious human pathogen worldwide (12).

Fig. 1.

Fig. 1.

Number of detected copies (log GC/ml or log GC/g) of each ARG in DNA isolated from farm fecal wastes (mixed samples), cattle, pigs, and poultry. Shown are the number of detected copies of blaCTX-M genes of cluster 1 (A), blaCTX-M genes of cluster 9 (B), blaTEM genes (C), and mecA genes (D). White circles indicate those samples showing results that were negative or below the detection limit. Asterisks indicate cattle slurries from a farm, while the rest of the cattle samples were fecal samples from summer pastures.

The qPCR oligonucleotide set for blaTEM (Table 2) (24) showed positive results in all samples and higher densities (P < 0.05) than were found for the other ARGs (Fig. 1C). Poultry waste carried the highest number of copies, and pig waste the lowest. blaTEM is the most prevalent β-lactamase in E. coli isolates from food of animal origin and from healthy livestock (8). This prevalence is consistent with the high densities of blaTEM detected in phage DNA in this study and in municipal sewage (10).

The qPCR for mecA (33) showed lower densities than qPCR for the other ARGs (Fig. 1D) and registered more negative samples. This was expected because this qPCR oligonucleotide set detects a specific gene instead of a family (TEM or CTX-M) spread among numerous bacterial genera. Swine and poultry showed a significantly (P < 0.05) higher prevalence than the other sources (Fig. 1D). mecA has been detected in isolates from domestic animals (20, 21, 25, 31) and in phage DNA from municipal sewage (10). The presence of mecA in animals has been associated with antimicrobial usage, contact with humans, and farm hygiene. Transmission is from humans to domestic animals (31) or from animals to farmers (20).

Twenty-four amplicons of the ARGs, selected according to the highest GC densities, were generated by conventional PCR and sequenced (23). All amplicons were confirmed as to their identity, although for some β-lactamase genes, discrimination between allelic variants was not possible, since the sequences were partial.

Indirect evidence suggests that selective pressures have mobilized ARGs from their initial chromosomal location in bacteria (4, 32). Phages persist better in aquatic environments than their bacterial hosts (3, 18) and, due to their structural characteristics, better than free DNA (37). This higher survival and the abundance of phages carrying ARGs in animal and human wastewater (10, 28) support the notion that phages are vehicles for mobilization of the environmental pool of ARGs that contribute to the maintenance and emergence of new resistances.

Despite the recent efforts of many international health organizations (19, 20, 30, 35) that recommend a controlled use of antibiotics and to withdraw their use in animal husbandry, new resistances continue to emerge. This could suggest that the origin of resistances is not the antibiotic pressure but the ARGs present in the environmental pool. The results for cattle feces presented here support this hypothesis, since these animals graze on pasture outside the farms and, thus, are not exposed to antibiotics. The study of this environmental pool and of the mechanisms of ARG mobilization, such as bacteriophages, could provide an early warning system for future clinically relevant resistance mechanisms.

Acknowledgments

This work was supported by the Generalitat de Catalunya (grant 2009SGR1043), the Spanish Ministry of Education and Science (grant AGL2009-07576), and the Xarxa de Referència en Biotecnologia (XRB). M. Colomer-Lluch is the recipient of a grant FI from the Generalitat de Catalunya. L. Imamovic is the recipient of a grant from the Spanish Ministry of Education and Science (FPI 20060054361).

Footnotes

▿

Published ahead of print on 1 August 2011.

REFERENCES

  • 1. American Academy of Microbiology 2009. Antibiotic resistance: an ecological perspective on an old problem. Report of a colloquium, 12 to 14 October 2008, Annecy, France. American Academy of Microbiology, Washington, DC: [PubMed] [Google Scholar]
  • 2. Anonymous. 2000. Water quality. Detection and enumeration of bacteriophages, part 2: enumeration of somatic coliphages. ISO 10705-2. International Organisation for Standardisation, Geneva, Switzerland [Google Scholar]
  • 3. Baggi F., Demarta A., Peduzzi R. 2001. Persistence of viral pathogens and bacteriophages during sewage treatment: lack of correlation with indicator bacteria. Res. Microbiol. 152:743–751 [DOI] [PubMed] [Google Scholar]
  • 4. Barlow M., et al. 2008. High rate of mobilization for blaCTX-M. Emerg. Infect. Dis. 14:423–428 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Blanch A. R., et al. 2006. Integrated analysis of established and novel microbial and chemical methods for microbial source tracking. Appl. Environ. Microbiol. 72:5915–5926 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Bonnet R. 2004. Growing group of extended-spectrum β-lactamases: the CTX-M enzymes. Antimicrob. Agents Chemother. 48:1–14 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Brabban A. D., Hite E., Callaway T. R. 2005. Evolution of foodborne pathogens via temperate bacteriophage-mediated gene transfer. Foodborne Pathog. Dis. 2:287–303 [DOI] [PubMed] [Google Scholar]
  • 8. Briñas L., Zarazaga M., Sáenz Y., Ruiz-Larrea F., Torres C. 2002. Beta-lactamases in ampicillin-resistant Escherichia coli isolates from foods, humans, and healthy animals. Antimicrob. Agents Chemother. 46:3156–3163 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Clesceri L. S., Greenberg A. E., Eaton A. D. (ed.). 1998. Standard methods for the examination of water and wastewater, 20th ed American Public Health Association, Washington, DC [Google Scholar]
  • 10. Colomer-Lluch M., Jofre J., Muniesa M. 2011. Antibiotic resistance genes in the bacteriophage DNA fraction of environmental samples. PLoS One 6:e17549. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Coque T. M., Baquero F., Cantón R. 2008. Increasing prevalence of ESBL-producing Enterobacteriaceae in Europe. Euro Surveill. 1347:19044. [PubMed] [Google Scholar]
  • 12. Coque T. M., et al. 2008. Dissemination of clonally related Escherichia coli strains expressing extended-spectrum β-lactamase CTX-M-15. Emerg. Infect. Dis. 14:195–200 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Cortés P., et al. 2010. Isolation and characterization of potentially pathogenic antimicrobial resistant Escherichia coli strains from chicken and pig farms in Spain. Appl. Environ. Microbiol. 76:2799–2805 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Dantas G., Sommer M. O. A., Oluwasegun R. D., Church G. M. 2008. Bacteria subsisting on antibiotics. Science 320:100. [DOI] [PubMed] [Google Scholar]
  • 15. Davies J. 1994. Inactivation of antibiotics and the dissemination of resistance genes. Science 264:375–382 [DOI] [PubMed] [Google Scholar]
  • 16. D'Costa V. M., McGrann K. M., Hughes D. W., Wright G. D. 2006. Sampling the antibiotic resistome. Science 311:374–377 [DOI] [PubMed] [Google Scholar]
  • 17. Dinsdale E. A., et al. 2008. Functional metagenomic profiling of nine biomes. Nature 452:629–632 [DOI] [PubMed] [Google Scholar]
  • 18. Durán A. E., et al. 2002. Removal and inactivation of indicator bacteriophages in fresh waters. J. Appl. Microbiol. 92:338–347 [DOI] [PubMed] [Google Scholar]
  • 19. European Technology Assessment Group et al. 2006. Antibiotic resistance. IP/A/STOA/ST/2006-4 Policy Department, Economic and Scientific Policy, European Parliament, Brussels, Belgium [Google Scholar]
  • 20. Goldburg R., Roach S., Wallinga D., Mellon M. 2008. The risks of pigging out on antibiotics. Science 321:1294. [DOI] [PubMed] [Google Scholar]
  • 21. Graveland H., et al. 2010. Methicillin resistant Staphylococcus aureus ST398 in veal calf farming: human MRSA carriage related with animal antimicrobial usage and farm hygiene. PLoS One 5:e10990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Hawkey P. M., Jones A. M. 2009. The changing epidemiology of resistance. J. Antimicrob. Chemother. 64(Suppl. 1):i3–i10 [DOI] [PubMed] [Google Scholar]
  • 23. Imamovic L., Ballesté E., Jofre J., Muniesa M. 2010. Quantification of Shiga toxin-converting bacteriophages in wastewater and in faecal samples by real-time quantitative PCR. Appl. Environ. Microbiol. 76:5693–5701 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Lachmayr K. L., Kerkhof L. J., Dirienzo A. G., Cavanaugh C. M., Ford T. E. 2009. Quantifying nonspecific TEM beta-lactamase blaTEM genes in a wastewater stream. Appl. Environ. Microbiol. 75:203–211 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Lee J. H. 2006. Occurrence of methicillin-resistant Staphylococcus aureus strains from cattle and chicken, and analyses of their mecA, mecR1 and mecI genes. Vet. Microbiol. 114:155–159 [DOI] [PubMed] [Google Scholar]
  • 26. Martinez J. L. 2008. Antibiotics and antibiotic resistance genes in natural environments. Science 321:365–367 [DOI] [PubMed] [Google Scholar]
  • 27. Mora A., et al. 2010. Recent emergence of clonal group O25b:K1:H4-B2-ST131 ibeA strains among Escherichia coli poultry isolates, including CTX-M-9-producing strains, and comparison with clinical human isolates. Appl. Environ. Microbiol. 76:6991–6997 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Muniesa M., et al. 2004. Bacteriophages and diffusion of beta-lactamase genes. Emerg. Infect. Dis. 10:1134–1137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Sander M., Schmieger H. 2001. Method for host-independent detection of generalized transducing bacteriophages in natural habitats. Appl. Environ. Microbiol. 67:1490–1493 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Shryock T. M., Richwine A. 2010. The interface between veterinary and human antibiotic use. Ann. N. Y. Acad. Sci. 1213:92–105 [DOI] [PubMed] [Google Scholar]
  • 31. Strommenger B., et al. 2006. Molecular characterization of methicillin-resistant Staphylococcus aureus strains from pet animals and their relationship to human isolates. J. Antimicrob. Chemother. 57:461–465 [DOI] [PubMed] [Google Scholar]
  • 32. Tsubakishita S., Kuwahara-Arai K., Sasaki T., Hiramatsu K. 2010. Origin and molecular evolution of the determinant of methicillin resistance in staphylococci. Antimicrob. Agents Chemother. 54:4352–4359 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Volkmann H., Schwartz T., Bischoff P., Kirchen S., Obst U. 2004. Detection of clinically relevant antibiotic-resistance genes in municipal wastewater using real-time PCR TaqMan. J. Microbiol. Methods 56:277–286 [DOI] [PubMed] [Google Scholar]
  • 34. Waksman S. A., Woodruff H. B. 1940. The soil as a source of microorganisms antagonistic to disease-producing bacteria. J. Bacteriol. 40:581–600 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. World Health Organization 1996. The world health report. World Health Organization, Geneva, Switzerland [Google Scholar]
  • 36. Zhang X. X., Zhang T., Fang H. H. 2009. Antibiotic resistance genes in water environment. Appl. Microbiol. Biotechnol. 82:397–414 [DOI] [PubMed] [Google Scholar]
  • 37. Zhu B. 2006. Degradation of plasmid and plant DNA in water microcosms monitored by natural transformation and real-time polymerase chain reaction PCR. Water Res. 40:3231–3238 [DOI] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES