Abstract
Listeria monocytogenes is an intracytosolic bacterial pathogen. Among the factors contributing to escape from vacuoles are a phosphatidylcholine phospholipase C (PC-PLC) and a metalloprotease (Mpl). Both enzymes are translocated across the bacterial membrane as inactive proproteins, whose propeptides serve in part to maintain them in association with the bacterium. We have shown that PC-PLC maturation is regulated by Mpl and pH and that Mpl maturation occurs by autocatalysis. In this study, we tested the hypothesis that Mpl activity is pH regulated. To synchronize the effect of pH on bacteria, the cytosolic pH of infected cells was manipulated immediately after radiolabeling de novo-synthesized bacterial proteins. Immunoprecipitation of secreted Mpl from host cell lysates revealed the presence of the propeptide and catalytic domain in samples treated at pH 6.5 but not at pH 7.3. The zymogen was present in small amounts under all conditions. Since proteases often remain associated with their respective propeptide following autocatalysis, we aimed at determining whether pH regulates autocatalysis or secretion of the processed enzyme. For this purpose, we used an Mpl construct that contains a Flag tag at the N terminus of its catalytic domain and antibodies that can distinguish N-terminal and non-N-terminal Flag. By fluorescence microscopy, we observed the Mpl zymogen associated with the bacterium at physiological pH but not following acidification. Mature Mpl was not detected in association with the bacterium at either pH. Using purified proteins, we determined that processing of the PC-PLC propeptide by mature Mpl is also pH sensitive. These results indicate that pH regulates the activity of Mpl on itself and on PC-PLC.
INTRODUCTION
Listeria monocytogenes is a Gram-positive, facultative intracellular bacterial pathogen. It is the causative agent of the food-borne disease listeriosis, which has a high mortality rate (37). L. monocytogenes is able to invade host cells and spread from cell to cell using host actin (35). To escape the vacuoles formed upon initial entry into a cell or cell-to-cell spread, L. monocytogenes relies on multiple virulence factors. These factors include listeriolysin O (LLO) (7, 35), a phosphatidylinositol-specific phospholipase C (4), and a broad-range phospholipase C known as PC-PLC (phosphatidylcholine phospholipase C) (32). PC-PLC is synthesized as an inactive proenzyme and translocates across the cell membrane, where it accumulates at the membrane-cell wall interface (21, 34). A decrease in pH and the metalloprotease of L. monocytogenes (Mpl) are required for PC-PLC maturation, which coincides with the rapid secretion of mature PC-PLC across the bacterial cell wall (21, 31).
Mpl is a member of the thermolysin family of metalloproteases which contains a Zn2+ ion in the active site (11). Mpl is produced as a zymogen with an N-terminal propeptide (22). Similar to PC-PLC, Mpl translocates across the bacterial membrane and accumulates at the membrane-cell wall interface (24, 34). This compartmentalization of Mpl is dependent on the propeptide. Removal of the propeptide occurs exclusively by intramolecular autocatalysis (3).
Zymogen autocatalysis is a highly controlled step to prevent premature activation of a protease. There are several known mechanisms by which autocatalysis can be regulated. Autocatalysis can be triggered by the binding of specific molecules. This has been observed for the maturation of the Vibrio cholerae multifunctional autoprocessing RTX toxin, where the binding of inositol hexakisphosphate in the host cytosol induces autocatalysis (27). Maturation of matrix metalloproteases is regulated by a cysteine switch mechanism, where the thiol group of a propeptide's cysteine residue interacts with the coordinated Zn2+ ion, thereby inhibiting protease activity (28, 36). In order for maturation to occur, the Zn2+-thiol interaction must be disrupted either by thiol reduction or by perturbation of the zymogen conformation. Intramolecular autocatalysis has also been shown to be regulated by pH for several proteases, with examples including the serine protease furin (1, 5) and members of the cathepsin family of cysteine proteases (15). GPR, an aspartic acid protease responsible for degrading spore proteins into amino acids during germination in Bacillus spp., also matures in a pH-dependent manner (14).
In this study, we investigated how Mpl activity is regulated during intracellular infection. Given that the maturation and secretion of PC-PLC require both Mpl and a decrease in pH, we hypothesized that Mpl activity is pH regulated and that Mpl autocatalysis is the pH-limiting step observed for PC-PLC maturation. Our results indicated that Mpl maturation and compartmentalization are regulated by pH. At physiological pH, the Mpl zymogen remains primarily bacterium associated. Upon a decrease in pH, autocatalysis occurs, leading to secretion of the Mpl propeptide and catalytic domain across the bacterial cell wall. Moreover, proteolytic maturation of PC-PLC by mature Mpl occurs only at acidic pH. Taken together, these results suggest that pH regulates the enzymatic activity of Mpl both on itself and on a heterologous substrate.
MATERIALS AND METHODS
Bacterial strains and cell cultures.
All L. monocytogenes strains and their relevant genotypes used in this study are listed in Table 1. L. monocytogenes strains were grown in brain heart infusion (BHI) medium. For Western immunoblotting assays, L. monocytogenes was grown in Luria-Bertani (LB) broth supplemented with 50 mM morpholinepropanesulfonic acid (MOPS) adjusted to pH 7.3, 0.2% (wt/vol) activated charcoal, and 20 mM glucose (LB-MOPS-Glc). Escherichia coli DH5α and L. monocytogenes strains harboring pKSV7-derived plasmids were cultured in LB broth supplemented with ampicillin (100 μg/ml) or BHI supplemented with chloramphenicol (10 μg/ml), respectively. E. coli harboring a ppSUMO-derived plasmid was cultured in LB supplemented with kanamycin (30 μg/ml). J774 mouse macrophage-like cells were maintained in Dulbecco's modified Eagle medium (DMEM) (Mediatech) with 7.5% (vol/vol) fetal bovine serum and 2 mM l-glutamine. Human epithelial HeLa cells were maintained in RPMI 1640 (Mediatech) with 7.5% (vol/vol) fetal bovine serum and 2 mM l-glutamine. All tissue culture cells were incubated in a 37°C, 5% CO2 environment.
Table 1.
L. monocytogenes strains and plasmids used in this study
| Strain or plasmid | Genotype and relevant features | Reference or source |
|---|---|---|
| Strains | ||
| 10403S | Wild type (serotype 1/2a) | 2 |
| NF-L943 | prfA G155S in 10403S background (overexpresses PrfA-dependent genes) | 30 |
| DP-L1935 | Internal in-frame deletion of plcB in 10403S background | 32 |
| DP-L2343 | Deletion of mpl structural gene in 10403S background | 29 |
| HEL-469 | Internal in-frame deletion of mpl in NF-L943 background | 3 |
| HEL-583 | mpl E350Q in 10403S background | 3 |
| HEL-587 | mpl E350Q in NF-L943 background | 3 |
| HEL-798 | mpl-FlagC-cat in NF-L943 background | 3 |
| HEL-800 | mpl E350Q-FlagC-cat in NF-L943 background | 3 |
| HEL-971 | mpl-FlagC-cat, containing internal in-frame deletions of hly, plcB, and inlAB in NF-L943 background | This study |
| HEL-981 | mpl-FlagN-cat in NF-L943 background | This study |
| HEL-982 | mpl E350Q-FlagC-cat, containing internal in-frame deletions of hly, plcB, and inlAB in NF-L943 background | This study |
| HEL-1084 | mpl E350Q-FlagN-pro in NF-L943 background | This study |
| Plasmids | ||
| pBMF1081 | pKSV7 mpl-Flag at N terminus of propeptide (mpl-FlagN-pro) | This study |
| pHM802 | ppSUMO plcB | This study |
| pHM969 | pKSV7 mpl-Flag at N terminus of catalytic domain (mpl-FlagN-cat) | This study |
Construction of Flag-tagged Mpl.
Splicing by overlapping extension PCR (SOEing PCR) (13) was used to add a Flag tag between the propeptide and the N terminus of the Mpl catalytic domain (Mpl-FlagN-cat). PCR fragments amplifying the 3′ end of the Mpl propeptide and the 5′ end of the catalytic domain were generated with primer pairs Marq328/Marq487 and Marq488/Marq387 (Table 2), respectively, using 10403S genomic DNA as the template. The respective 560-bp and 384-bp PCR products were used in a SOEing PCR with primers Marq328/Marq387. The 920-bp product was then digested with PstI and EcoRI and ligated into the shuttle vector pKSV7 (33), thus generating pHM969 (Table 1). pHM969 was sequenced and then electroporated into L. monocytogenes strain NF-L943 for allelic exchange (4), generating HEL-981 (Table 1). Allelic exchange was verified by sequencing chloramphenicol-sensitive colonies.
Table 2.
DNA oligonucleotide primers used in this study
| Name | Sequence (5′ to 3′)a | Site |
|---|---|---|
| Marq288 | GGAGCTCTACGTCCACTTGAACAA | SacI |
| Marq289 | ATGCTGCAGAACGGTAATTGATGACC | PstI |
| Marq326 | GTGGATCCTGTTGTGATGAATACTTAC | BamHI |
| Marq327 | GTGCGGCCGCGAGTGGATAAGAATGTATTC | NotI |
| Marq328 | GTGAATTCGATTCTGTCGGGGAAGAAAA | EcoRI |
| Marq387 | GCACTGCAGCAATTCAAGCCATAATGGAC | PstI |
| Marq487 | CTTGTCATCGTCATCCTTGTAATCCTCGGAAAGCATATTTTG | Flag |
| Marq488 | GATTACAAGGATGACGATGACAAGGTAGAACGGGCTGATA | Flag |
| Marq494 | GTTTCTTTGGGAGTGACATGC | |
| Marg541 | GATTACAAGGATGACGATGACAAGGATAGTGTCGGGGAAGAAAAAC | Flag |
| Marq542 | CTTGTCATCGTCATCCTTGTAATCTGCTTTTACCGTCATAGTGAAATG | Flag |
Restriction sites and Flag tags are underlined.
Addition of a Flag tag to the N terminus of the Mpl propeptide (Mpl-FlagN-pro) was generated by SOEing PCR. Primer pairs Marq289/Marq542 and Marq541/Marq288 (Table 2) were used to amplify the upstream region and a portion of the Mpl prodomain, respectively, using 10403S genomic DNA as the template. In addition to introducing the Flag sequence, Marq541 and Marq542 introduce a silent serine mutation, resulting in an alteration of the HinfI restriction digest pattern. The 547-bp and 517-bp PCR products were used in a SOEing PCR using primers Marq288/Marq289. The 1,040-bp product was digested with PstI and SacI and ligated into pKSV7, thus generating pBMF1081 (Table 1). pBMF1081 was sequenced and then electroporated into HEL-587, an NF-L943 background L. monocytogenes strain expressing a catalytic mutant of Mpl (Mpl E350Q) (3), generating HEL-1084 (Table 1). Allelic exchange was verified by screening for chloramphenicol sensitivity and for an altered HinfI restriction pattern.
Mpl-FlagC-cat and Mpl E350Q-FlagC-cat were described in a previous publication (3). In this publication, these proteins were identified as Mpl-Flag and Mpl E350Q-Flag. Either protein is synthesized as a zymogen with a Flag tag at the C terminus of the catalytic domain. Mpl-FlagC-cat undergoes autocatalysis upon a decrease in pH, similarly to wild-type Mpl, whereas Mpl E350Q-FlagC-cat does not have autocatalytic activity.
Construction of internal in-frame deletion mutants.
Deletions of the genes encoding listeriolysin O (hly), PC-PLC (plcB), and internalins A and B (inlAB) were made sequentially by allelic exchange in NF-L943 strains expressing wild-type Mpl FlagC-cat (HEL-798) or Mpl E350Q-FlagC-cat (HEL-800) using plasmids pDP-2154 (16), pDP-1888 (32), and pHK2 (17), respectively, to generate HEL-971 and HEL-982 (Table 1). Chloramphenicol-sensitive colonies were selected. The hly deletion was verified by loss of hemolysis on blood agar plates (25). Deletion of plcB was verified by the loss of PC-PLC activity on egg yolk agar plates (39). Deletion of inlAB was confirmed by PCR using primers Marq41 (17) and Marq494 (Table 2). Deletion of inlA was further verified by Western immunoblotting assay (34).
Metabolic labeling and immunoprecipitation assays.
Metabolic labeling of proteins synthesized by intracellular bacteria and immunoprecipitation assays were performed as described previously (24, 31). Briefly, infected J774 cells were pulse-labeled with [35S]Met-Cys and then chased in a potassium-based buffer at pH 7.3 or pH 6.5 supplemented with nigericin (10 μM) to mimic the cytosolic or vacuolar pH, respectively. Nigericin is a potassium ionophore that allows for the rapid equilibration of pH across biological membranes. Secreted Mpl was immunoprecipitated from cleared host cell lysates with rabbit immune serum against Mpl (24). Samples were resolved by SDS-PAGE and detected by autoradiography. For each experiment, the amount of sample loaded on the gel was normalized to the number of intracellular bacteria recovered in parallel dishes.
Western immunoblotting assays.
Western immunoblotting assays for detecting Mpl constructs were performed as described previously (24). Briefly, L. monocytogenes strains were grown in LB-MOPS-Glc to a final optical density at 600 nm (OD600) of ∼1. Although the medium was buffered, its pH acidified over time due to bacterial metabolism. The equivalent of 1 ml of culture supernatant at an OD600 of 1 was precipitated with trichloroacetic acid, resolved by SDS-PAGE, and transferred to a polyvinylidene difluoride (PVDF) membrane by semidry electroblotting. Rabbit immune serum against Mpl was used at a 1/1,000 dilution, while mouse monoclonal anti-Flag M1 and M2 antibodies (Sigma-Aldrich) were used at concentrations of 9 ng/ml and 2 ng/ml, respectively. Alkaline phosphatase-conjugated goat anti-rabbit IgG (24 ng/ml) or goat anti-mouse IgG (600 ng/ml) (Jackson ImmunoResearch Laboratories, Inc.) was used as secondary antibody, and nitroblue tetrazolium (0.33 mg/ml) and 5-bromo-4-chloro-3-indolylphosphate (0.17 mg/ml) were used as substrates. All antibody incubations and washes for the anti-Flag M1 immunoblotting assay were done in the presence of 1 mM CaCl2.
Immunofluorescent staining of Mpl.
Bacterium-associated Mpl-Flag was detected by immunofluorescence, as described previously with modification (24). HeLa cells infected with L. monocytogenes were incubated in a potassium-based buffer equilibrated to either pH 7.3 or pH 6.5 supplemented with nigericin (10 μM). Cells were then fixed, and the bacterial cell wall was digested with purified phage endolysin Ply118 (19) at a final concentration of 150 μg/ml. To detect bacterium-associated Mpl-Flag, mouse monoclonal anti-Flag M1 (18 μg/ml) or M2 (1 μg/ml) was used followed by a donkey anti-mouse antibody conjugated to fluorescein isothiocyanate (FITC) (1.5 μg/ml). All antibody incubations and washes with anti-Flag M1 were done in the presence of 1 mM CaCl2. Bisbenzimide (Hoechst 33258) was used at a concentration of 1 μg/ml to detect bacteria and host nuclei.
PC-PLC purification.
The proform of PC-PLC (pro-PC-PLC) was purified from E. coli BL21(DE3) cells. Primers Marq326/Marq327 (Table 2) were used to amplify plcB (gene encoding PC-PLC) without its signal sequence by PCR, generating an 837-bp fragment. This fragment was digested with NotI and BamHI and ligated into ppSUMO (23), a pET28a-derived vector, thus generating pHM802 (Table 1). As a result, plcB was cloned in frame with an N-terminal His6-SUMO (small ubiquitin-like modifier) tag. Sequence integrity was verified by sequencing. BL21(DE3) cells transformed with pHM802 were grown in 4 liters of Terrific Broth at 37°C, 250 rpm, to an OD600 of ∼0.5. The temperature was decreased to 18°C, and isopropyl-β-d-1-thiogalactopyranoside was added to a final concentration of 0.5 mM to induce protein expression. Cultures were grown overnight at 18°C. Cells were harvested by centrifugation (7,500 × g, 10 min, 4°C) and resuspended in 50 ml ice-cold buffer A (25 mM HEPES, 500 mM NaCl, 10 mM imidazole, 25% [vol/vol] glycerol, pH 10) supplemented with a cocktail of protease inhibitors (Sigma-Aldrich P8849) and 5 mM tris(2-carboxyethyl)phosphine (TCEP). Cells were lysed by sonication and centrifuged (100,000 × g, 1.5 h, 4°C). Cleared supernatant was diluted 5-fold in buffer A to decrease the TCEP concentration to 1 mM. His6-SUMO-pro-PC-PLC was purified by affinity chromatography using a 15-ml Ni2+-nitrilotriacetic acid (NTA) column equilibrated in buffer A. The column was washed with 10 column volumes of buffer A. Affinity-bound proteins were eluted in eight 3-ml fractions with buffer B (25 mM HEPES, 500 mM NaCl, 500 mM imidazole, 25% glycerol, pH 10). Elutions were combined and passed through a buffer-exchange column equilibrated with buffer C (25 mM HEPES, 50 mM NaCl, 25% glycerol, 0.5 M urea, pH 9.5) using an Econo-Pac 10DG column (Bio-Rad). Purified His6-SUMO-pro-PC-PLC was treated with His6-ULP-1 protease at room temperature for 1 h to cleave the His6-SUMO tag (23). His6-ULP-1 and His6-SUMO were removed by adding 1 ml Ni2+-NTA resin per 10 mg of protein equilibrated in buffer C, incubating the mixture for 30 min at room temperature, and pelleting the resin by centrifugation at 1,000 × g for 1 min. Purified pro-PC-PLC was passed through a 0.22-μm filter and loaded onto a Sephacryl 100-HR size exclusion column, using an automated AKTApurifer fast protein liquid chromatograph (FPLC) and fraction collector Frac-950 (GE Health Care) column equilibrated in buffer D (25 mM HEPES, 50 mM NaCl, 50 mM arginine, 1 mM TCEP, 0.05% [wt/vol] sodium azide, final pH = 10.3). Pro-PC-PLC purification was verified by SDS-PAGE.
Mpl purification.
Initial purification attempts indicated that listeriolysin O (LLO), PC-PLC, and InlB copurify with Mpl-FlagC-cat. Therefore, we chose to purify Mpl-FlagC-cat and Mpl E350Q-FlagC-cat from L. monocytogenes strains that do not express these proteins: HEL-971 and HEL-982, respectively. L. monocytogenes was grown in 500 ml of LB-MOPS-Glc to a final OD600 of ∼0.9. Bacterial supernatant was rapidly cooled down on ice, and the following protease inhibitors were added: phenylmethylsulfonyl fluoride (PMSF) (to 100 μM), leupeptin (to 1 μM), and pepstatin A (to 1 μM). The culture was centrifuged (15,000 × g, 10 min, 4°C), and the supernatant was collected and filtered through a 0.22-μm PVDF membrane. Supernatant was reacted with 1 ml mouse anti-Flag M2 agarose resin (Sigma-Aldrich) equilibrated in 25 mM HEPES, 300 mM NaCl, 1 mM CaCl2, 0.1% (wt/vol) 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), 10 μM ZnSO4, pH 7.3. The resin was then washed five times with 10 column volumes of the same buffer. An additional wash of 5 column volumes of the same buffer without CHAPS was then performed. Bound proteins were eluted in five 1-ml fractions with elution buffer (25 mM HEPES, 300 mM NaCl, 1 mM CaCl2, 10 μM ZnSO4, 5-mg/ml 3× Flag peptide, pH 7.3). Elutions were analyzed for the presence of Mpl by SDS-PAGE and by Western immunoblotting.
PC-PLC activation in vitro assay.
Mpl was tested for its ability to mediate pro-PC-PLC maturation in vitro. Purified pro-PC-PLC (8.7 μg/ml) and/or Mpl (15.2 μg/ml) was mixed in reaction buffer equilibrated to either pH 6.0, 6.5, or 7.3 in a final volume of 250 μl. Each reaction buffer consisted of 35 mM 2-(N-morpholino)ethanesulfonic acid (MES), 7.5 mM HEPES, 65 mM NaCl, 3.7 mM CaCl2, 2 μM ZnSO4, 5 mM arginine, 0.1 mM TCEP, and 0.005% (wt/vol) sodium azide. The reaction mixtures were incubated at 37°C for 4 h. The proteins were then resolved by SDS-PAGE. Following electrophoresis, the gel was washed once in double-distilled water (ddH2O), twice in 25% isopropanol, and three times in phosphate-buffered saline (PBS) (pH 7.1); overlaid with egg yolk soft agar (20); and incubated at 37°C for 4 h. PC-PLC activity was detected by the formation of a zone of opacity in the overlay. Following the appearance of PC-PLC activity, the gel was removed and stained with Coomassie brilliant blue R-250 to detect PC-PLC.
RESULTS
Mature Mpl is secreted upon a decrease in pH during intracellular infection.
The regulation of PC-PLC has been well documented using J774 mouse macrophage-like cells and has also been observed in human HeLa cells (21, 31, 34). Since PC-PLC maturation is dependent on both a decrease in vacuolar pH and Mpl (21), we infected J774 cells to test the hypothesis that Mpl autocatalysis is the pH-limiting step observed for PC-PLC maturation. To determine whether Mpl maturation is pH dependent, we immunoprecipitated Mpl from the cleared lysates of radiolabeled infected cells incubated in a nigericin-containing potassium buffer equilibrated to either pH 7.3 or pH 6.5. These conditions mimic the pH that L. monocytogenes would experience when in the cytosol of an infected cell (physiological pH) or when entrapped in a vacuole (acidic pH). A small amount of the Mpl zymogen was secreted into the cytosol of infected cells at either pH (Fig. 1, lanes 1 and 2), whereas large amounts of the propeptide and mature Mpl were secreted exclusively upon a decrease in pH (Fig. 1, lane 2). Cells were also infected with an L. monocytogenes strain expressing Mpl E350Q, an Mpl catalytic mutant that is unable to undergo autocatalysis (3). Mpl E350Q behaved like wild-type Mpl at physiological pH, but not at acidic pH, as no increase in protein secretion was observed at pH 6.5 (Fig. 1, lanes 3 and 4). Lastly, the absence of protein bands in the immunoprecipitates from cells infected with an Mpl-minus strain confirmed that the antibody is specific to Mpl. Results from this experiment suggest that autocatalysis and an acidic pH are necessary for the efficient secretion of Mpl across the bacterial cell wall.
Fig. 1.
The propeptide and mature form of Mpl are secreted in the host cell cytosol upon a decrease in pH. J774 cells were infected with 10403S expressing wild-type (WT) Mpl or isogenic mutants expressing Mpl E350Q or no Mpl (Mpl−). Cells were pulse-labeled with [35S]Met-Cys and chased in a nigericin-containing potassium buffer equilibrated to pH 7.3 or pH 6.5 (indicated above each lane). Secreted Mpl was immunoprecipitated from cleared host cell lysates. Numbers on right indicate molecular mass markers in kDa. Lanes: 1 and 2, 10403S; 3 and 4, HEL-583; 5 and 6, DP-L2343.
pH controls Mpl autocatalysis and compartmentalization during intracellular infection.
Next, we aimed to determine what species of Mpl is bacterium associated during intracellular infection. If autocatalysis and secretion of Mpl across the bacterial cell wall are pH dependent, we would expect to detect only the Mpl zymogen and not the mature form in association with the bacterium. However, if only secretion but not autocatalysis of Mpl is pH dependent, we would expect to detect both the zymogen and mature forms of Mpl in association with the bacterium. Immunoprecipitation of Mpl from bacterial lysates was not successful. Perhaps Mpl was degraded by proteases released from lysed bacteria during processing of the bacterial pellet. Therefore, we devised a new approach to detect bacterium-associated Mpl. To differentiate the Mpl zymogen from mature Mpl, we made an Mpl construct that contains a Flag tag at the Mpl cleavage site (Mpl-FlagN-cat) (Fig. 2A), such that upon autocatalysis and removal of the propeptide, the Flag tag would be at the N terminus of the catalytic domain. Mpl autocatalysis can then be monitored using two commercially available monoclonal antibodies, anti-Flag M1 and anti-Flag M2. M1 recognizes only a Flag tag at the free N terminus of a tagged protein, while M2 recognizes an accessible Flag tag anywhere on the protein. Therefore, the M2 antibody should react with Mpl-FlagN-cat zymogen and mature form, whereas the M1 antibody should react exclusively with the mature form. The propeptide would not be detected by either antibody (Fig. 2A). To confirm that the M1 and M2 antibodies were able to differentiate between the zymogen and mature form of Mpl-FlagN-cat, supernatants from broth-grown L. monocytogenes strains expressing wild-type Mpl or Mpl-FlagN-cat were used for Western immunoblotting assays with anti-Mpl serum or M1 or M2 antibodies. Three Mpl species were detected with the anti-Mpl serum: the zymogen, the mature form, and the propeptide. Neither M1 nor M2 antibodies were able to detect wild-type Mpl (Fig. 2B, lanes 6 and 9), as it does not contain a Flag tag. However, M2 recognized the zymogen and the mature form of Mpl-FlagN-cat, whereas M1 recognized the mature form only (Fig. 2B, lanes 7 and 10).
Fig. 2.
Anti-Flag antibodies allow for the differentiation of Mpl species. (A) Schematics of Mpl-Flag constructs used in this study and predicted patterns of reactivity with two different antibodies. Anti-Flag M1 recognizes an N-terminal Flag, while anti-Flag M2 recognizes any surface-accessible Flag. (B) Detection of Mpl from culture supernatants. Strains were grown in LB-MOPS-Glc, and the equivalent of 1.0 ml of supernatant at an OD600 of 1 was resolved by SDS-PAGE. Mpl and Mpl-Flag constructs were detected with either anti-Mpl, anti-Flag M1, or anti-Flag M2 antibodies. Numbers on right indicate molecular mass markers in kDa. Positions of the Mpl zymogen, mature Mpl, and propeptide are indicated on left. Lanes: 1, 6, and 9, NF-L943; 2, HEL-587; 3, 7, and 10, HEL-981; 4, 8, and 11, HEL-1084; 5, HEL-469.
Fluorescence microscopy was performed to determine which Mpl species is bacterium associated during intracellular infection. Human HeLa cells were used for these experiments because mouse monoclonal antibodies bind to the immunoglobulin Fc receptor on mouse J774 cells, independent of the specificity of the antibody. Therefore, HeLa cells were infected with strains expressing wild-type Mpl or Mpl-FlagN-cat. Four hours postinfection, infected cells were perfused for 5 min with a potassium buffer containing nigericin equilibrated to either pH 7.3 or pH 6.5. The cells were fixed and stained for the detection of Mpl-Flag with M1 or M2. Bacteria and host cell nuclei were detected using bisbenzimide. Wild-type Mpl was not detected in association with the bacterium in infected cells (Fig. 3a to h). Mpl-FlagN-cat was detected by M2 (Fig. 3k and l) but not by M1 (Fig. 3i and j) at pH 7.3, suggesting that only the Mpl zymogen is bacterium associated at pH 7.3. Upon a decrease in pH, Mpl-FlagN-cat was not detected by immunofluorescence (Fig. 3m to p).
Fig. 3.
The Mpl zymogen is bacterium associated at physiological pH. Bacterium-associated Mpl was detected by fluorescence microscopy. Prior to fixing, infected HeLa cells were incubated in a nigericin-containing potassium buffer equilibrated to either pH 7.3 or pH 6.5. Host cell nuclei and bacteria were then stained with bisbenzimide (Hoechst 33258). Mpl-Flag was detected with anti-Flag M1 or anti-Flag M2 antibody followed by an FITC-conjugated secondary antibody. (a to h) NF-L943; (i to p) HEL-981; (q to x) HEL-1084.
To ensure that M1 was capable of detecting bacterium-associated Mpl-Flag by fluorescence microscopy, we added a Flag tag to the N terminus of the propeptide of Mpl E350Q (Mpl E350Q-FlagN-pro) (Fig. 2A). The program PrediSi (http://www.predisi.de/) (12) was used to ensure that addition of the Flag tag would not affect recognition and cleavage of the Mpl signal sequence. Supernatants from broth-grown L. monocytogenes expressing Mpl E350Q or Mpl E350Q-FlagN-pro were used to perform Western immunoblotting assays. As expected for these catalytic mutants, the zymogen was the only Mpl species detected with the anti-Mpl serum (Fig. 2B, lanes 2 and 4). Mpl E350Q-FlagN-pro was detected by the M1 antibody and weakly by the M2 antibody (Fig. 2B, lanes 8 and 11). Mpl E350Q-FlagN-pro was detected in association with the bacterium by the M1 and M2 antibodies in infected HeLa cells treated with buffer at pH 7.3 or pH 6.5 (Fig. 3q to x).
These results, taken together with the immunoprecipitation results (Fig. 1), suggest that during intracellular infection Mpl autocatalysis and compartmentalization are controlled by pH. At physiological pH, the Mpl zymogen is bacterium associated. As the intracellular pH acidifies, Mpl undergoes autocatalysis and is secreted across the bacterial cell wall.
Secretion of Mpl across the bacterial cell wall is PC-PLC independent.
Previously, it was shown that the secretion of PC-PLC across the bacterial cell wall is dependent on both a decrease in pH and Mpl (39). Similarly, results from this study suggest that a decrease in pH leads to secretion of Mpl across the bacterial cell wall. Next, we questioned whether PC-PLC influences the compartmentalization of Mpl. To address this point, cells were infected with either a wild-type or a PC-PLC-minus strain of L. monocytogenes and treated as described above with buffers at physiological or acidic pH before immunoprecipitating Mpl from host cell lysates. The mature form of Mpl and the Mpl propeptide were secreted in cells treated with an acidic pH buffer, but not in cells maintained at physiological pH, and this phenomenon was independent of the presence of PC-PLC (Fig. 4). This result indicated that the secretion of Mpl across the cell wall is not dependent on PC-PLC.
Fig. 4.
PC-PLC does not influence the secretion of mature Mpl. J774 cells were infected with 10403S expressing PC-PLC and Mpl (WT) or isogenic mutants with no PC-PLC (PC-PLC−) or no Mpl (Mpl−). Cells were pulse-labeled with [35S]Met-Cys and chased in a nigericin-containing potassium buffer at pH 7.3 or pH 6.5 (indicated above each lane). Secreted Mpl was immunoprecipitated from cleared host cell lysates. Numbers on right indicate molecular mass markers in kDa. Lanes: 1 and 2, 10403S; 3 and 4, DP-L1935; 5 and 6, DP-L2343.
Mpl activity on PC-PLC is controlled by pH.
The results reported above suggest that Mpl autocatalysis is regulated by pH. Next, we wished to determine whether Mpl activity on PC-PLC, a nonself substrate, is pH regulated as well. For this purpose, wild-type Mpl, Mpl E350Q, and PC-PLC were purified as described in Materials and Methods. Mpl proteins containing a Flag tag at the C terminus of the catalytic domain (FlagC-cat) (3) were purified from the supernatant of L. monocytogenes broth cultures. Since pH-dependent secretion of Mpl is not absolute, there is a gradual accumulation of the zymogen in the culture supernatant. The mature form is generated and secreted as the broth begins to acidify in late exponential phase as a consequence of bacterial metabolism. The proform of PC-PLC was produced in E. coli and purified from bacterial lysates. Examination of the protein samples on Coomassie blue-stained gels indicated that the PC-PLC sample was devoid of contaminants and degradation products, while the Mpl-FlagC-cat and Mpl E350Q-FlagC-cat samples contained some degradation products (Fig. 5A and B). There was a band greater than 66 kDa present in both Mpl purifications. In addition, the Mpl-FlagC-cat sample contained a band that was not present in the Mpl E350Q-FlagC-cat sample (Fig. 5B, asterisk). We identified this protein by matrix-assisted laser desorption ionization–time of flight mass spectrometry to be the heat shock protein GroEL.
Fig. 5.
Mpl directly mediates the maturation of PC-PLC in a pH-dependent manner. (A) Stained protein gel of purified pro-PC-PLC fractions following size exclusion chromatography. (B) Stained protein gel of purified Mpl-FlagC-cat and Mpl E350Q-FlagC-cat following immunochromatography. The asterisk indicates GroEL which copurified with Mpl-FlagC-cat. (C) PC-PLC activation in vitro assay. Purified pro-PC-PLC and Mpl were mixed in a reaction buffer equilibrated to either pH 6.0, 6.5, or 7.3 (indicated above the lanes) and incubated at 37°C for 4 h. Following incubation, the proteins were resolved by SDS-PAGE. PC-PLC activity was detected by the egg yolk soft agar overlay assay. A band of opacity in the agar indicates phospholipid hydrolysis (upper panel). Following the activity assay, the gel was stained with Coomassie blue (lower panel). Numbers on right indicate molecular mass markers in kDa.
To determine whether Mpl can directly mediate the proteolytic maturation of PC-PLC, the purified Mpl-FlagC-cat preparation and pro-PC-PLC were incubated together for 4 h at 37°C in a reaction buffer equilibrated to a final pH of 6.0, 6.5, or 7.3. The proteins were then resolved by SDS-PAGE, and PC-PLC activity was detected by an egg yolk overlay assay. In this assay, PC-PLC activity is identified by the presence of a zone of opacity in the egg yolk overlay. PC-PLC activity was detected in samples containing purified Mpl-FlagC-cat and pro-PC-PLC incubated in buffers at pH 6.0 and pH 6.5, but not at pH 7.3 (Fig. 5C, upper panel, lanes 2, 6, and 10). Controls included samples containing pro-PC-PLC (Fig. 5C, lanes 1, 5, and 9), Mpl-FlagC-cat (Fig. 5C, lanes 4, 8, and 12), or pro-PC-PLC and Mpl E350Q-FlagC-cat (Fig. 5C, lanes 3, 7, and 11). We did not use EDTA as a control to inhibit Mpl activity in this assay because PC-PLC is also a Zn2+-dependent enzyme (9). None of the controls showed a zone of opacity.
Once the enzymatic activity had developed in the overlay, the protein gel was recovered and stained with Coomassie brilliant blue R-250, which revealed the presence of pro-PC-PLC in the appropriate lanes (Fig. 5C, lower panel, lanes 1 to 3, 5 to 7, and 9 to 11) and of mature PC-PLC exclusively in lanes where PC-PLC activity had been detected (Fig. 5C, lower panel, lanes 2 and 6). These results show that Mpl directly mediates the proteolytic maturation of PC-PLC. Moreover, the activity of Mpl on a nonself substrate occurs at acidic pH but not at a physiological pH.
DISCUSSION
PC-PLC and Mpl are virulence factors of L. monocytogenes that accumulate as inactive proenzymes at the bacterial membrane-cell wall interface during growth in host cells (34). Upon cell-to-cell spread, bacteria in vacuoles experience a decrease in pH that triggers the rapid secretion of mature PC-PLC across the bacterial cell wall in an Mpl-dependent manner (21, 31). This mechanism of regulating PC-PLC activity is imperative to the virulence of L. monocytogenes, as a propeptide-deletion mutant of PC-PLC is highly attenuated in vivo (38). In the present study, we tested the hypothesis that Mpl maturation is the pH-limiting step for PC-PLC maturation. Previously, we determined that Mpl maturation occurs by intramolecular autocatalysis (3). Herein, we observed that Mpl autocatalysis occurs upon a decrease in pH and correlates with the rapid secretion of mature Mpl and propeptide across the bacterial cell wall. Moreover, our data indicate that Mpl directly mediates the proteolytic maturation of PC-PLC and that this activity is also pH regulated.
The Mpl zymogen remains mostly bacterium associated at physiological pH while mature Mpl is found in host cells within minutes of a decrease in pH. This observation is in accordance with our previous result showing that when Mpl is synthesized in the absence of its propeptide, it is secreted more efficiently across the bacterial cell wall (24). This phenomenon has also been observed for the serine protease subtilisin from Bacillus subtilis. Subtilisin precursor remains bacterium associated while mature subtilisin is found in the supernatant (26). Our study provides further evidence that propeptides serve as a means of controlling the compartmentalization of bacterial proproteins, similarly to what has been observed for several eukaryotic proproteins (6, 10, 18).
There is evidence that following autocatalysis, the pro and catalytic domains of metalloproteases remain associated as an autoprocessed complex that is void of enzymatic activity because the C terminus of the propeptide remains in the active site. Degradation of the propeptide by its cognate catalytic domain is essential for full activation of the protease (8). We would argue that this mechanism of regulation does not apply to Mpl for two reasons. First, the propeptide of Mpl appears to be stable as it is detected in amounts similar to those of the mature form under conditions that lead to Mpl-mediated maturation of PC-PLC. Measuring the levels of detected Mpl from our immunoprecipitation assays revealed a ratio of 1:1.6 ± 0.4 (n = 17) for mature Mpl to propeptide, supporting our conclusion that the propeptide of Mpl is not degraded by its cognate catalytic domain (B. M. Forster and H. Marquis, unpublished data). Second, mature Mpl-FlagN-cat was not detected in association with the bacterium when using an antibody that specifically recognizes a free N-terminal Flag. Together, the results support a mechanism by which pH-induced autocatalysis leads to full activation of Mpl.
Since Mpl autocatalysis is controlled by pH, we wished to determine if pH regulates Mpl activity on a nonself substrate. The obvious substrate would be PC-PLC. However, the evidence for the role of Mpl in mediating the maturation of PC-PLC is only circumstantial. To address whether Mpl directly activates PC-PLC, we performed an in vitro assay with purified proteins. The results indicated that Mpl directly mediates the proteolytic maturation of PC-PLC and that, moreover, this activity is pH regulated. Mature PC-PLC and PC-PLC activity were detected at pH 6.0, and to a lesser extent at pH 6.5, but not at pH 7.3 or when pro-PC-PLC was incubated alone or with the Mpl catalytic mutant. It is very unlikely that the heat shock protein GroEL, which contaminated the wild-type Mpl preparation, would have affected the results, as GroEL is a chaperone with no known proteolytic activity. Therefore, our data indicate that Mpl directly mediates the proteolytic maturation of PC-PLC and that Mpl activity on a nonself substrate is pH sensitive. Alternatively, pH may influence the conformation of mature Mpl and pro-PC-PLC, enabling an interaction between these two proteins.
There are precedents for the observation that pH regulates the activity of a protease. For example, the serine protease furin undergoes autocatalysis once it reaches the acidic trans-Golgi network (1). The autocatalysis of furin is controlled by a histidine residue in its propeptide that acts as a pH sensor to acidic environments. Upon acidification, this histidine becomes protonated and disrupts a hydrophobic pocket allowing for autocatalysis (5). Members of the cathepsin family of cysteine proteases undergo autocatalysis in acidified lysosomes. Under acidic conditions, the propeptide of cathepsin L loses its tertiary conformation, resulting in a loss of affinity for the catalytic domain (15). Future studies will be focused on determining how pH controls the enzymatic activity of Mpl. Mpl activity may be controlled by amino acids acting as pH sensors. pH may also induce protein conformational changes in Mpl and/or in PC-PLC to allow Mpl and PC-PLC to interact.
In conclusion, our results indicate that pH regulates the enzymatic activity and compartmentalization of Mpl and support a model (Fig. 6) in which the proforms of PC-PLC and Mpl accumulate at the membrane-cell wall interface when the bacteria are in an environment at physiological pH, such as in the host cell cytosol. Upon cell-to-cell spread, bacteria become confined to double membrane vacuoles that acidify, which is sensed by Mpl, leading to Mpl autocatalysis and proteolytic maturation of PC-PLC by mature Mpl. The mature proteins are rapidly secreted across the bacterial cell wall into the vacuolar environment where PC-PLC can begin hydrolyzing vacuolar membrane phospholipids, contributing to lysis of the vacuole. As for Mpl, perhaps it targets additional substrates after accessing the vacuolar environment.
Fig. 6.
Schematic representation of the behavior of PC-PLC and Mpl when L. monocytogenes is located within a double membrane vacuole formed upon cell-to-cell spread. Pro-PC-PLC and the Mpl zymogen remain at the membrane-cell wall interface until a decrease in pH triggers Mpl autocatalysis and Mpl-mediated maturation of PC-PLC. The mature proteins are then secreted across the cell wall where PC-PLC can hydrolyze membrane phospholipids.
ACKNOWLEDGMENTS
We thank Colin Parrish and Christopher Nelson for help with size exclusion purification of PC-PLC. We also thank Bryant Blank and Gabriela Wagner for critically reviewing the manuscript.
This work was supported by Public Health Service grant A152154 from NIAID to H.M.
Footnotes
Published ahead of print on 29 July 2011.
REFERENCES
- 1. Anderson E. D., et al. 2002. The ordered and compartment-specific autoproteolytic removal of the furin intramolecular chaperone is required for enzyme activation. J. Biol. Chem. 277:12879–12890 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Bishop D. K., Hinrichs D. J. 1987. Adoptive transfer of immunity to Listeria monocytogenes. The influence of in vitro stimulation on lymphocyte subset requirements. J. Immunol. 139:2005–2009 [PubMed] [Google Scholar]
- 3. Bitar A. P., Cao M., Marquis H. 2008. The metalloprotease of Listeria monocytogenes is activated by intramolecular autocatalysis. J. Bacteriol. 190:107–111 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Camilli A., Tilney L. G., Portnoy D. A. 1993. Dual roles of plcA in Listeria monocytogenes pathogenesis. Mol. Microbiol. 8:143–157 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Feliciangeli S. F., et al. 2006. Identification of a pH sensor in the furin propeptide that regulates enzyme activation. J. Biol. Chem. 281:16108–16116 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Fortenberry S. C., Chirgwin J. M. 1995. The propeptide is nonessential for the expression of human cathepsin D. J. Biol. Chem. 270:9778–9782 [DOI] [PubMed] [Google Scholar]
- 7. Gaillard J. L., Berche P., Mounier J., Richard S., Sansonetti P. 1987. In vitro model of penetration and intracellular growth of Listeria monocytogenes in the human enterocyte-like cell line Caco-2. Infect. Immun. 55:2822–2829 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Gao X., et al. 2010. Structural basis for the autoprocessing of zinc metalloproteases in the thermolysin family. Proc. Natl. Acad. Sci. U. S. A. 107:17569–17574 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Geoffroy C., et al. 1991. Purification and characterization of an extracellular 29-kilodalton phospholipase C from Listeria monocytogenes. Infect. Immun. 59:2382–2388 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Hansson M., Olsson I., Nauseef W. M. 2006. Biosynthesis, processing, and sorting of human myeloperoxidase. Arch. Biochem. Biophys. 445:214–224 [DOI] [PubMed] [Google Scholar]
- 11. Hase C. C., Finkelstein R. A. 1993. Bacterial extracellular zinc-containing metalloproteases. Microbiol. Rev. 57:823–837 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Hiller K., Grote A., Scheer M., Munch R., Jahn D. 2004. PrediSi: prediction of signal peptides and their cleavage positions. Nucleic Acids Res. 32:W375–W379 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Ho S. N., Hunt H. D., Horton R. M., Pullen J. K., Pease L. R. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51–59 [DOI] [PubMed] [Google Scholar]
- 14. Illades-Aguiar B., Setlow P. 1994. Autoprocessing of the protease that degrades small, acid-soluble proteins of spores of Bacillus species is triggered by low pH, dehydration, and dipicolinic acid. J. Bacteriol. 176:7032–7037 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Jerala R., Zerovnik E., Kidric J., Turk V. 1998. pH-induced conformational transitions of the propeptide of human cathepsin L. A role for a molten globule state in zymogen activation. J. Biol. Chem. 273:11498–11504 [DOI] [PubMed] [Google Scholar]
- 16. Jones S., Portnoy D. A. 1994. Characterization of Listeria monocytogenes pathogenesis in a strain expressing perfringolysin O in place of listeriolysin O. Infect. Immun. 62:5608–5613 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Kim H., Marquis H., Boor K. J. 2005. SigmaB contributes to Listeria monocytogenes invasion by controlling expression of inlA and inlB. Microbiology 151:3215–3222 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Koo B. H., et al. 2007. Regulation of ADAMTS9 secretion and enzymatic activity by its propeptide. J. Biol. Chem. 282:16146–16154 [DOI] [PubMed] [Google Scholar]
- 19. Loessner M. J., Schneider A., Scherer S. 1996. Modified Listeria bacteriophage lysin genes (ply) allow efficient overexpression and one-step purification of biochemically active fusion proteins. Appl. Environ. Microbiol. 62:3057–3060 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Marquis H., Goldfine H., Portnoy D. A. 1997. Proteolytic pathways of activation and degradation of a bacterial phospholipase C during intracellular infection by Listeria monocytogenes. J. Cell Biol. 137:1381–1392 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Marquis H., Hager E. J. 2000. pH-regulated activation and release of a bacteria-associated phospholipase C during intracellular infection by Listeria monocytogenes. Mol. Microbiol. 35:289–298 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Mengaud J., Geoffroy C., Cossart P. 1991. Identification of a new operon involved in Listeria monocytogenes virulence: its first gene encodes a protein homologous to bacterial metalloproteases. Infect. Immun. 59:1043–1049 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Navarro M. V., De N., Bae N., Wang Q., Sondermann H. 2009. Structural analysis of the GGDEF-EAL domain-containing c-di-GMP receptor FimX. Structure 17:1104–1116 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. O'Neil H. S., et al. 2009. The propeptide of the metalloprotease of Listeria monocytogenes controls compartmentalization of the zymogen during intracellular infection. J. Bacteriol. 191:3594–3603 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Portnoy D. A., Jacks P. S., Hinrichs D. J. 1988. Role of hemolysin for the intracellular growth of Listeria monocytogenes. J. Exp. Med. 167:1459–1471 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Power S. D., Adams R. M., Wells J. A. 1986. Secretion and autoproteolytic maturation of subtilisin. Proc. Natl. Acad. Sci. U. S. A. 83:3096–3100 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Prochazkova K., Satchell K. J. 2008. Structure-function analysis of inositol hexakisphosphate-induced autoprocessing of the Vibrio cholerae multifunctional autoprocessing RTX toxin. J. Biol. Chem. 283:23656–23664 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Ra H. J., Parks W. C. 2007. Control of matrix metalloproteinase catalytic activity. Matrix Biol. 26:587–596 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Shetron-Rama L. M., Marquis H., Bouwer H. G., Freitag N. E. 2002. Intracellular induction of Listeria monocytogenes actA expression. Infect. Immun. 70:1087–1096 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Shetron-Rama L. M., et al. 2003. Isolation of Listeria monocytogenes mutants with high-level in vitro expression of host cytosol-induced gene products. Mol. Microbiol. 48:1537–1551 [DOI] [PubMed] [Google Scholar]
- 31. Slepkov E. R., Pavinski Bitar A., Marquis H. 2010. Differentiation of propeptide residues regulating the compartmentalization, maturation and activity of the broad-range phospholipase C of Listeria monocytogenes. Biochem. J. 432:557–563 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Smith G. A., et al. 1995. The two distinct phospholipases C of Listeria monocytogenes have overlapping roles in escape from a vacuole and cell-to-cell spread. Infect. Immun. 63:4231–4237 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Smith K., Youngman P. 1992. Use of a new integrational vector to investigate compartment-specific expression of the Bacillus subtilis spoIIM gene. Biochimie 74:705–711 [DOI] [PubMed] [Google Scholar]
- 34. Snyder A., Marquis H. 2003. Restricted translocation across the cell wall regulates secretion of the broad-range phospholipase C of Listeria monocytogenes. J. Bacteriol. 185:5953–5958 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Tilney L. G., Portnoy D. A. 1989. Actin filaments and the growth, movement, and spread of the intracellular bacterial parasite, Listeria monocytogenes. J. Cell Biol. 109:1597–1608 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Van Wart H. E., Birkedal-Hansen H. 1990. The cysteine switch: a principle of regulation of metalloproteinase activity with potential applicability to the entire matrix metalloproteinase gene family. Proc. Natl. Acad. Sci. U. S. A. 87:5578–5582 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Vazquez-Boland J. A., et al. 2001. Listeria pathogenesis and molecular virulence determinants. Clin. Microbiol. Rev. 14:584–640 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Yeung P. S., Na Y., Kreuder A. J., Marquis H. 2007. Compartmentalization of the broad-range phospholipase C activity to the spreading vacuole is critical for Listeria monocytogenes virulence. Infect. Immun. 75:44–51 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Yeung P. S., Zagorski N., Marquis H. 2005. The metalloprotease of Listeria monocytogenes controls cell wall translocation of the broad-range phospholipase C. J. Bacteriol. 187:2601–2608 [DOI] [PMC free article] [PubMed] [Google Scholar]






