Transmission of Dapsone-Resistant Leprosy Detected by Molecular Epidemiological Approaches

Abstract

Drug resistance surveillance identified six untreated leprosy patients in the Philippines with Mycobacterium leprae folP1 mutations which confer dapsone resistance. Five patients share a village of residence; four who carried the mutation, Thr53Val, were also linked by M. leprae variable-number tandem repeat (VNTR) strain types. In India, folP1 mutations were detected in two relapse patients with a history of dapsone treatment. Mutations were not found in the rifampin target gene rpoB. These findings indicate that dapsone resistance is being transmitted.

TEXT

Leprosy is an infection of the skin and nerves which can result in disabilities and social stigma; it remains endemic in many parts of the world and is listed as a neglected tropical disease (19). Molecular surveillance of resistance to antimicrobial therapies and Mycobacterium leprae strain typing by mapping variable-number tandem repeats (VNTRs) (7, 11) and single-nucleotide polymorphisms (SNPs) (20, 21) have applications in tracing transmission of the disease and in monitoring the efficacy of control programs (23, 24, 32). With the emergence of dapsone resistance, multidrug therapy (MDT), which consists of dapsone and rifampin for paucibacillary leprosy and the additional drug clofazimine for multibacillary (MB) leprosy, was introduced by the World Health Organization in the 1980s (34). As reports of rifampin and dapsone resistance in several countries began appearing (1, 5, 8, 9, 16, 17, 18), the WHO initiated a surveillance program, particularly for relapse patients (35). Until recently, clinical drug resistance was detected by mouse footpad (MFP) assays, which require specialized facilities and 6 to 12 months to acquire results (4, 26, 27, 28, 29). On the other hand, PCR amplification followed by sequencing of the drug resistance-determining regions (DRDRs) in folP1 and rpoB genes can detect resistance to dapsone and rifampin; fluoroquinolones, which are alternative drugs for leprosy, target the gyrase, encoded by gyrA and gyrB (3, 6, 10, 13, 33).

This report presents dapsone and rifampin resistance surveillance findings for two Asian countries where leprosy is endemic. Patients presenting at the Cebu Skin Clinic of the Leonard Wood Memorial Leprosy Research Centre (LWM-CSC), Philippines (287 untreated new cases detected during 2006 to 2009), and the Blue Peter Research Centre (BPRC), Hyderabad, India (78 untreated new cases and 26 cases with previous treatment, 9 of which were relapses [5 had dapsone monotherapy]; all detected during 2007 to 2008) were studied following human research approval and informed consent procedures (23, 24, 30). Total DNA extraction from biopsy specimens (LWM-CSC) and smears (BPRC), multiplex PCR using the Qiagen DNeasy and multiplex PCR kits, and amplicon sequencing methods have been described previously (11). The PCR primers for folP1, rpoB, gyrA, and gyrB DRDRs are shown in Table 1. M. leprae strain NHDP63 was used as a positive control (11). Only the rpoB and folP1 amplicons were sequenced in this study, as fluoroquinolones were not prescribed to the patients. Genotypes for 202 rpoB and 212 folP1 DRDRs in Philippine samples and for 52 rpoB and 57 folP1 DRDRs in Indian samples were obtained. PCR or sequence failure occurred in samples with a low bacteriological index (24, 30). Mutations in rpoB were not detected in the studied populations. Six patients had folP1 mutations with known dapsone resistance phenotypes (13, 16, 33), four in codon 53 [ACC(Thr)-GCC(Ala) in an Indian relapse case and ACC(Thr)-GTC(Val) in three new Cebu cases] and two in codon 55 [CCC(Pro)-CTC(Leu) in a relapse case in India and a new case in Cebu]. The folP1 Thr53Val genotype identified in the current study was seen in a prior study in a Cebu patient (coded as 01Mat02) (16). This mutation was shown to confer a high degree of resistance by MFP assays (16). The case history revealed that 01Mat02 was a relapsed patient who had also sought treatment at LWM-CSC. The identification of four Cebu cases with the same folP1 mutation prompted us to explore their clinical histories and epidemiological background. It was found that all three new patients reside in a leprosy sanitarium in the village of Jagobiao in Mandaue City (Eversley Childs Sanitarium [ECS]); 01Mat02 was a previous resident of ECS. The three new cases reported knowledge of contact with leprosy patients in the family and/or community. Querying the database of LWM-CSC patients included in ongoing molecular epidemiology studies (since 2006) identified a total of 15 patients residing in Jagobiao (23, 24). From the M. leprae VNTR strain types (Table 2), it can be noted that there are at least three transmission clusters. I49 clustered with the folP1 mutant L121, L257, and L259 samples (cluster A) and was also found to have the same Thr53Val mutation. These four strains have two copies at 21-3, 10 copies at (TA)10 and (AC)9, and 12 copies at (AT)17, and 14 copies at (AT)15, as well as an unusually high copy number at the (TTC)21 locus; this combination of alleles is rare in the Cebu VNTR database. L121 and I49 are neighbors, and their houses are located near those of L257 and L259. All of these patients attended the same high school, and all but L259 attended the same primary school. They and their presumed index cases are residents of ECS (Table 3).

Table 1.

Primers used for multiplex PCR amplification of M. leprae drug resistance-determining regions^a

Target	Amplicon size (bp)	Primer	Primer location	Primer sequence (5′ to 3′)
rpoB	386	rpoB-U	2275587–2275568	CAGGACGTCGAGGCGATCAC
		rpoB-L	2275202–2275218	TCGTCAGCGGTCAAGTA
folP1	281	folP1-U	296746–296765	TTCGTTCTCAGATGGCGGAC
		folP1-L	297026–297007	GCCCACCAGACACATCGTTG
gyrA	160	gyrA-U	7521–7539	CCGTAGCCACGCTAAGTCA
		gyrA-L	7678–7660	CCGGCGAACCGAAATTGCC
gyrB	186	gyrB-U	6579–6602	ACTGATCCTCGAAGTTCTGAACTG
		gyrB-L	6764–6749	CAATGCCGTAATAATTTGCTTGAA

^aThe amplicon size and primer nucleotide positions are from the M. leprae TN strain as found in the Leproma website (http://genolist.pasteur.fr/Leproma/).

Table 2.

M. leprae VNTR strain types identify transmission clusters in Jagobiao, Mandaue City, Cebu, Philippines

Patient IDa	Cluster	VNTR pattern at indicated locuse
		(AC)8b	(GTA)9	(GGT)5	(AT)17	21-3	(AC)9	(AT)15	(AC)8a	27-5	6-7	(TA)18	(TTC)21	18-8	12-5	23-3	(TA)10
01Mat02	NA	N	N	5	12	N	10	11	8	4/5	7	15	21	8	N	2	15
I49b	A	8	9	5	12	2	10	14	9	5	7	15	48/63	7/8	4	2	10
L121d	A	8	9	5	12	2	10	14	9	5	7	15	68	8	4	2	10
L257d	A	8	8	5	12	2	10	14	9	5	7	15	50	9	4	2	10
L259d	A	8	9	5	12	2	10	14	9	5	8	15	52	8	4	2	10
I2-20d	A	8	9	5	12	2	11	14	9	5	7	17	51	8	4	2	10
I09b	B	6	9	5	10	2	8	17	9	5	7	15	16	7	5	2	7
L003c	B	6	9	5	10	2	8	17	9	5	7	16	17	7	5	2	7
L057c	B	6	9	5	10	2	8	18	9	5	7	17	17	7	5	2	7
I65b	C	7	9/10	6	N	3	9	16	10	5	7	15	23	8	4	2	12
L146d	C	7	9	6	16	3	8	22	10	5	7	14	24	8	4	2	12
L063c	NAf	8	9	6	17	N	9	N	12	5	7	19	23	8	4	2	N
I2-01d	NA	8	9	5	13	3	9	14	8	5	7/8	16	17/18	8	4	2	10
L046c	NA	8	11	5	13	3	10	15	9	5	7	22	21	8	4	2	10
L198d	NA	10	10	5	15	3	9	14	8	N	7	N	23	7	5	2	13
L141d	NA	7	N	4	13/15	2	8	20	9	5	6	18	12	8	4	2	8

^aSamples from patients whose data are shown in boldface have folP1 mutations.

^bFrom reference 23.

^cFrom reference 24.

^dFrom unpublished data.

^eVNTR pattern indicates the number of copies found at the specified locus. N, PCR negative.

^fNA, not applicable.

Table 3.

Clinical information for Jagobiao patients with folP1 Thr53Val mutation and VNTR cluster A

Patient IDa	Patient information			Leprosy contact informationb
	Mo and yr of diagnosis	R-J classc	Treatment regimend	Relationship	Yr of diagnosis	Treatment status	Treatment center	Treatment regimend
I49	June 2007	LL	MDT-MB	Father	1980	Treated	ECS	NA
				Mother	1975	Treated	ECS	NA
				Relative	NA	Treated	NA	NA
				Neighbor	NA	Treated	NA	NA
L121	October 2007	BL	MDT-MB	Grandfather	1975	Treated	ECS	NA
				Neighbor	NA	Treated	ECS	Dapsone
L257	March 2009	BL	MDT-MB	Mother	1973	Treated	ECS	Dapsone for 6 yrs or more
				Father	1969	Treated	ECS	Dapsone for 6 yrs or more
				Brother	1990	Treated	ECS	With brown tablets for 4 yrs
				Neighbor	NA	Treated	ECS	NA
				Schoolmate	NA	Untreated	NA	NA
L259	April 2009	LL	MDT-MB	Neighbor	NA	NA	NA	NA
I2-20	October 2009	BL	MDT-MB	Father	2005	Treated	LWM Clinical Branch	MDT-MB for 1 yr
				Neighbor	NA	Treated
01Mat02e	1978	BL	DDS (1978-1984)	NA	NA	NA	NA	NA
			B663 (1984)	NA	NA	NA	NA	NA
	2011	BL	MDT-MB (1 yr)	NA	NA	NA	NA	NA

^aSamples from patients shown in boldface have folP1 mutations.

^bNA, not available.

^cPer Ridley-Jopling classification (22). LL, lepromatous leprosy; BL, borderline lepromatous leprosy.

^dMDT-MB, multidrug therapy for multibacillary patients; DDS, dapsone monotherapy; B663, clofazimine; With brown tablets, as recalled by the patient—this may refer to clofazimine.

^ePatient carries the folP1 Thr53Val mutation but not the cluster A VNTR type.

Patient I2-20, a close neighbor of I49 and L121, has a closely related VNTR strain type but did not have the folP1 mutation. I2-20, who was diagnosed later than the other four, may have acquired the infection at an earlier stage or by a divergent transmission pathway within this community where several generations of leprosy patients reside (Table 3). Strain typing for 01Mat02 from an archived biopsy specimen homogenate yielded partial VNTR results; however, the available data indicate that it does not closely match the strains of the new cases of cluster A. Hence, 01Mat02 may not be a direct infectious source for this cluster. The folP1 mutation may have been acquired from an individual (diagnosed or undetected) not in the cohort studied. Cluster B is comprised of I09 linked to patients L003 and L057 reported previously (24), and cluster C includes I65 and L146. I2-01, an unclustered strain, was found to have a Pro55Arg mutation.

Although MDT has been a simple and effective regimen for treating large numbers of leprosy cases, these investigations highlight at least five new patients in Jagobiao, four with the same strain, for whom dapsone would have been ineffective. Prior surveillance involving LWM-CSC patients showed various numbers with primary resistance to dapsone: 2 of 55 in 1975 to 1978, 3 of 37 in 1979 to 1982, 20 of 38 in 1988 to 1992 (5), and 3 of 77 in 2001 to 2006 (16). Moreover, 7.9% of the isolates in 1988 to 1992 were highly resistant to dapsone by MFP assays (5). The duration of MB-MDT has been reduced to 1 year from 2 years since 1988. In the present study, of the 287 patients, 110 self-reported knowledge of contact with other leprosy patients. In the Indian study, the folP1 mutations were detected in 2 of the 9 relapse patients, both reporting residence in leprosy colonies; one was treated with dapsone from 1965 to 1966 and irregular MB-MDT at a later undisclosed time. The patient's mother also had leprosy. The second patient received dapsone in 1970 and MB-MDT in 1995 and was released from treatment on smear negativity. This patient could be a relapse or reinfection case. The emergence and persistence of such strains raises concerns about the current passive case detection and treatment methods for interruption of leprosy and transmission of drug resistance. Such communities with previously treated cases and their families are candidates for surveillance and follow-up with corresponding treatment, perhaps devoid of dapsone (2). While genetics and the physical environment (15) are perhaps factors for clustering within communities, the carriage, spread, and evolution of leprosy in humans within families, between communities, and across continents have been demonstrated by strain typing of M. leprae (20, 21, 23, 24, 32).

Drug resistance detected by molecular tests is being reported from several countries through the current WHO drug surveillance campaign; however, this is largely a voluntary, limited exercise for relapse cases (35). Combining reports from 2009 and 2010, the number of instances of dapsone resistance per number of relapse cases in various countries was as follows: 0/8 (Pakistan), 0/3 (Yemen), 2/135 (Brazil), 1/18 (China), 4/44 (Myanmar), 5/58 (India), 6/18 (Vietnam), and 3/8 (Colombia) (36, 37); from laboratories that include primary cases, the estimates are 0 to 18% (9, 16, 25, 31). The latest studies in Cebu, Philippines, indicate that after 1 year of MDT for MB patients, the relapse rate was 0.52 per 1,000 patient years at risk (12). Operational factors preclude generalization of this statistic across clinics in varied settings. Therefore, to objectively and quantitatively measure the true global level of resistance and its impact on MDT efficacy at the patient and community level, as well as the retransmission potential, widespread and routine molecular surveys combined with classic epidemiology should be implemented. The availability of standardized methods and centralization of efforts, which decrease the costs of DNA sequencing, in parallel with the development of alternative rapid-screening molecular methods (14, 31) make this feasible.