A novel bisphosphonate inhibitor of squalene synthase combined with a statin or a nitrogenous bisphosphonate in vitro

Abstract

Statins and nitrogenous bisphosphonates (NBP) inhibit 3-hydroxy-3-methylglutaryl-coenzyme-A reductase (HMGCR) and farnesyl diphosphate synthase (FDPS), respectively, leading to depletion of farnesyl diphosphate (FPP) and disruption of protein prenylation. Squalene synthase (SQS) utilizes FPP in the first committed step from the mevalonate pathway toward cholesterol biosynthesis. Herein, we have identified novel bisphosphonates as potent and specific inhibitors of SQS, including the tetrasodium salt of 9-biphenyl-4,8-dimethyl-nona-3,7-dienyl-1,1-bisphosphonic acid (compound 5). Compound 5 reduced cholesterol biosynthesis and lead to a substantial intracellular accumulation of FPP without reducing cell viability in HepG2 cells. At high concentrations, lovastatin and zoledronate impaired protein prenylation and decreased cell viability, which limits their potential use for cholesterol depletion. When combined with lovastatin, compound 5 prevented lovastatin-induced FPP depletion and impairment of protein farnesylation. Compound 5 in combination with the NBP zoledronate completely prevented zoledronate-induced impairment of both protein farnesylation and geranylgeranylation. Cotreatment of cells with compound 5 and either lovastatin or zoledronate was able to significantly prevent the reduction of cell viability caused by lovastatin or zoledronate alone. The combination of an SQS inhibitor with an HMGCR or FDPS inhibitor provides a rational approach for reducing cholesterol synthesis while preventing nonsterol isoprenoid depletion.

The mevalonate pathway (Fig. 1) is responsible for production of the core 5-carbon isoprenoid isopentenyl diphosphate (IPP) from 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) (1). HMG-CoA is first reduced to mevalonate by HMG-CoA reductase (HMGCR). Through a short series of enzymatic reactions, mevalonate is then converted into IPP. Both IPP and its isomer dimethylallyl diphosphate (DMAPP) are utilized by farnesyl diphosphate synthase (FDPS) to generate the 15-carbon farnesyl diphosphate (FPP), which resides at the major branch point of the mevalonate pathway. Addition of an isoprene unit from IPP to FPP yields geranylgeranyl diphosphate (GGPP), a process mediated by the enzyme geranylgeranyl diphosphate synthase (GGDPS). The isoprene moiety of FPP or GGPP can be posttranslationally adducted onto proteins by protein farnesyltransferase or geranylgeranyltransferases, respectively, in a process collectively referred to as protein prenylation. In the first committed step of de novo cholesterol synthesis, two molecules of FPP are condensed in a head-to-head orientation to first form presqualene diphosphate and subsequently squalene. This reaction is catalyzed by the enzyme squalene synthase (SQS), which is encoded for by the gene farnesyl diphosphate farnesyl transferase 1 (FDFT1).

Fig.1.

The mevalonate pathway showing relevant mevalonate pathway enzymes [HMGCR, isopentenyl diphosphate isomerase (IDI), farnesyl transferase, (FTase), geranylgeranyl transferase (GGTase)], intermediates [IPP; dimethylallyl diphosphate (DMAPP), FPP, GGPP), and inhibitors (lovastatin and zoledronate).

Inhibition of mevalonate pathway targets has yielded multiple drugs with clinical success. Statins (e.g., lovastatin and atorvastatin) are a class of drugs commonly prescribed to reduce cholesterol levels. Statins inhibit HMGCR (2), which is the rate-limiting step of cholesterol biosynthesis (3). This leads to upregulation of the low-density lipoprotein (LDL) receptor (LDLR) in the liver and clearance of cholesterol-containing LDL particles from the bloodstream. The use of statin drugs is prevalent because elevated total cholesterol and LDL levels are major risk factors for coronary heart disease (4). Although the statins are used abundantly and effectively, there are various reasons for developing novel inhibitors of cholesterol biosynthesis. There can be side effects associated with statin use, such as myopathy and hepatotoxicity (5), which are commonly speculated to be due to the depletion of nonsterol components of the mevalonate pathway (6). Furthermore, statin use does not always reduce LDL to desired levels (7), which is particularly important as lower LDL target levels are suggested for some patients (8–10).

Inhibition of SQS has attracted much interest as a pharmacological target, and various compounds have been identified as inhibitors (11, 12). Lapaquistat (TAK-475, Takeda) progressed to phase III clinical trials, but studies were discontinued after the US Food and Drug Administration recommended suspension of studies with high-dose (100 mg/kg) monotherapy due to hepatotoxicity manifested as elevated levels of liver transaminases (12). It is currently unknown whether this was due to an enzyme inhibitory class effect or whether it was specific to the drug. Inhibition of SQS can result in the accumulation of both FPP and FPP metabolites, such as farnesol-derived dicarboxylic acids (13), which could be responsible for the possible hepatotoxicity with the high-dose monotherapy of lapaquistat. Farnesol itself can be proapoptotic at high concentrations (14). Other reported results appeared promising with lapaquistat, with cholesterol levels decreasing in monotherapy treatment. Moreover, the combination therapy of lapaquistat with statins showed additional LDL reduction compared with statins alone (12). Also of interest, lapaquistat's active metabolite T-91485 was capable of preventing statin-induced myotoxicity in a human skeletal muscle cell model (15). Similarly, lapaquistat was able to prevent statin-induced myotoxicity in a guinea pig model (16). In addition to the expected cholesterol depletion, other SQS inhibitors have shown the potential for added benefits due to decreased triglyceride biosynthesis (17), likely resulting from a farnesol-induced mechanism (18).

Nitrogenous bisphosphonates (NBP; e.g., zoledronate and alendronate) are a second class of clinical drugs targeting the mevalonate pathway, and they are used for treatment of bone-related disorders such as osteoporosis. NBPs function by inhibition of FDPS, thus depleting cellular levels of FPP and other downstream isoprenoids (19). Bisphosphonates may be regarded as analogs of diphosphates, in which the central bridging oxygen atom (P-O-P) has been replaced with a carbon (P-C-P). This results in increased metabolic stability and allows chemical functionalization of the bisphosphonate core. Furthermore, the P-C-P linkage combined with an α-hydroxy group facilitates bone targeting (20). Although these compounds have a high affinity for bone, there are also reports of decreased cholesterol levels with patients treated with nitrogenous bisphosphonates (21). To our knowledge, the combination of an FDPS inhibitor with an SQS inhibitor has not been evaluated.

While various SQS inhibitors exist, relatively few are based on a bisphosphonate structure (22), and their specificity for SQS relative to the prenylation arm of the mevalonate pathway has not been reported. Herein, we describe the synthesis and identification of novel bisphosphonates as potent inhibitors of SQS. A structure-activity relationship is evaluated in the context of potency and specificity for these novel compounds. Emphasis is placed on the evaluation of a lead compound 5 (Fig. 2) in combination with lovastatin or zoledronate in HepG2 cells. We hypothesized that these combinations of inhibitors would decrease cholesterol biosynthesis while preventing the depletion of nonsterol isoprenoid levels, resulting in reduced adverse cellular effects compared with inhibition of HMGCR or FDPS alone.

Fig.2.

Structures of compounds used in this study.

EXPERIMENTAL PROCEDURES

Chemical synthesis

Preparation of compounds 1 (23) and 2 (24, 25) has been described, while compounds 3-5 were prepared as follows. In short, geranyl acetate was oxidized with SeO₂ under reported literature procedures (26) (Fig. 3). The newly formed hydroxyl group was protected by reaction with 3,4-dihydro-2H-pyran, and the acetate group was removed (27). The resulting product then was split and carried forward in three divergent directions. The 2-tetrahydropyranyl (THP) protecting group of alcohol 10 was subjected to copper-mediated Grignard displacement (24, 25, 28) with the corresponding biphenyl Grignard reagents to provide independently the ortho, meta, and para analogs 11, 12, and 13, respectively. Standard conversion of the free hydroxyl group to the allylic bromide was performed using PBr₃. After workup, the bromides were used without further purification in the subsequent alkylation of tetraethyl methylenebisphosphonate (29). The resulting phosphonate esters 17, 18, and 19 were hydrolyzed to their corresponding salts (3, 4, and 5, respectively) under standard McKenna procedures (30). All bisphosphonate salts were dissolved in water prior to use for biological studies. Detailed experimental and characterization data is provided in the supplementary data.

Fig.3.

Chemical synthesis scheme.

Protein purification

A plasmid containing glutathione-S-transferase tagged human squalene synthase (EX-C0605-B03) was obtained from Genecopoeia (Rockville, MD). The plasmid was transformed into BL21 (DE3) Escherichia coli and expressed using 0.1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) overnight at room temperature. Following lysis using lysozyme, 1.5% sarkosyl was added to increase protein solubility. Tagged protein was purified using glutathione agarose beads (Sigma; St. Louis, MO) according to the manufacturer's protocol.

SQS enzyme assays

Enzyme assays were performed in 20 µl reactions containing 50 mM phosphate buffer (pH 7.4, 5 mM MgCl₂, 4 mM CHAPS, 10 mM DTT), 400 ng recombinant enzyme, 0.25 µM [1-³H]FPP (20 Ci/mmol; American Radiolabeled Chemicals, St. Louis, MO) and 2 mM NADPH. Inhibitors were added with enzyme and incubated for 10 min at 37°C. Substrate was then added and reactions were incubated for 10 min at 37°C. Reactions were stopped by addition of 300 µl 1 mM EDTA, and then 1 ml ice-cold petroleum ether was added. After freezing the lower aqueous phase, the upper phase containing the products was transferred to a scintillation vial containing liquid scintillation fluid, and radioactivity was quantitated using a Beckman liquid scintillation counter. Data was analyzed using Prism Graphpad software.

Cell culture

HepG2 cells were obtained from American Type Culture Collection (ATCC, Manassas, VA) and grown at 37°C with 5% CO₂ in DMEM (Sigma) containing pen-strep (Gibco), amphotericin B (Thermo Scientific; Walthman, MA), 2 mM Glutamax (Invitrogen; Carlsbad, CA), 1 mM sodium pyruvate (Sigma), and 10% fetal bovine serum.

Western blot analysis

Protein concentrations were determined by the bicinchoninic acid (BCA) method. Proteins were resolved on 12 or 15% gels and transferred to polyvinylidene difluoride membranes via electrophoresis. Blocking was performed in 5% nonfat dry milk for 45 min, after which primary and secondary antibodies were added sequentially for 1 h each at 37°C. Proteins were visualized using enhanced chemiluminescence detection. Rap1a and α-tubulin antibodies were acquired from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA), and anti-pan-Ras was acquired from InterBiotechnology (Tokyo, Japan).

Cholesterol biosynthesis assay

Cells were plated in 12-well plates and grown to near confluency. Compounds were added for 1 h followed by the addition of 1 µCi of 1-¹⁴C-acetate (Sigma) for 4 h. Cells were harvested using trypsin, and lipids were extracted using the Bligh and Dyer method (31). Chloroform extracts were dried, resuspended in a 30 µl of chloroform, and loaded on S-60 silica TLC plates. TLC was performed using an eluting solvent system of toluene and isopropyl ether (1:1) as the mobile phase. Plates were stained with iodide to determine the location of a cholesterol standard. Regions corresponding to cholesterol were excised from the plate, and radioactivity was quantified using a liquid scintillation counter.

Measurement of FPP and GGPP levels

Both FPP and GGPP levels were determined as reported (32). Briefly, FPP and GGPP were extracted from cells and incorporated into fluorescently-labeled CAAX peptides by FTase and GGTase, which were then quantified by fluorescent detection on an HPLC. Levels were normalized to total protein as measured by BCA assay.

MTT assay

The MTT assay measures the activity of enzymes that reduce the MTT substrate within metabolically active cells. It is commonly used as a measure of cell viability. Cells were allowed to adhere in 24-well plates and grown until approximately 50% confluent. Cells were treated with indicated compounds and incubated for 45 h, followed by addition of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; EMD Chemicals; La Jolla, CA) and incubation for an additional 3 h. MTT stop solution (HCl, triton X-100, and isopropyl alcohol) was then added, and plates were gently agitated at 37°C overnight. Absorbance was measured at 540 nm with a reference wavelength at 650 nm.

Real-time quantitative PCR

HepG2 cells were allowed to adhere in 6-well plates and grown until approximately 50% confluent. Cells were then washed with PBS, and the cells were equilibrated in media containing 10% lipoprotein deficient serum (LPDS) for 24 h. Cells were then treated for 24 h in media containing 10% LPDS with indicated compounds. Total RNA was isolated using Qiashredders and RNase easy mini kit (Qiagen), with inclusion of a DNase step as recommended. cDNA was made from 1 µg of RNA by reverse-transcription using the iScript DNA Synthesis Kit (Bio-Rad). Primers were from Integrated DNA Technologies (Coralville, IA). The primers used were: LDLR forward, TCAACACACAACAGCAGATGGCAC; LDLR reverse, AAGGCTAACCTGGCTGTCTAGCAA; GAPDH forward, TCGACAGTCAGCCGCATCTTCTTT; GAPDH reverse, ACCAAATCCGTTGACTCCGACCTT. Real-time PCR was performed using Sybr Green Master Mix (Applied Biosystems) using an Applied Biosystems Model 7000 real-time thermalcycler. The protocol for real-time was: 2 min at 50°C, 10 min at 95°C, followed by 40 cycles of 95°C for 15s and 60°C for 1 min.

RESULTS

In vitro inhibition of recombinant SQS

A screen of in-house compounds was performed to identify in vitro inhibitors of SQS. A small panel of compounds (1, 2, 3, 4, and 5) was selected for further study of their inhibitory activity (Fig. 2). These compounds were synthesized as described in “Experimental Procedures.” Dose-response curves were used to determine the concentration of compound required to inhibit 50% of SQS activity (IC₅₀ value, Table 1). Geranyl bisphosphonate (compound 1) had an IC₅₀ value of 1,361 nM in this assay. Addition of a phenyl ring at the C-9 position of the geranyl chain (compound 2) enhanced potency to an IC₅₀ of 26.5 nM. The addition of a biphenyl group in an ortho- (compound 3), meta- (compound 4), or para- (compound 5) substituted pattern resulted in IC₅₀ values of 5.7, 13.4, and 7.1 nM, respectively. One-way ANOVA was used to test for statistical differences in IC₅₀ values, and the means were significantly different across the samples (P < 0.05). Tukey post hoc analysis indicated that compounds 2-5 were each statistically different from compound 1, but they were not statistically different from each other.

TABLE 1.

IC₅₀ values of compounds 1–5 for inhibition of SQS

Compound	IC50 (nM)
1	1361 ± 460
2	26.5 ± 8.9
3	5.7 ± 1.7
4	13.4 ± 1.8
5	7.1 ± 1.3

Three independent dose-response curves of compounds 1–5 were used to generate IC₅₀ values. Values are expressed as the mean ± SE, n = 3.

Effects of compounds 1-5 on protein prenylation in HepG2 cells

Substrate-like inhibitors targeted against SQS have potential for off-target effects due to inhibition of other FPP utilizing enzymes. Our laboratories previously identified geranyl bisphosphonate (33) as an inhibitor of GGDPS (34). With this in mind, we set out to determine whether the compounds active against SQS impaired protein farnesylation or geranylgeranylation, outputs that can identify inhibitors of FDPS, GGDPS, or prenyltransferases (35, 36). The prenylation of select individual proteins was assessed by Western blot for use as markers of the cellular status of protein farnesylation and geranylgeranylation. The Ras antibody utilized in these experiments recognizes both the modified (farnesylated) and unmodified (nonfarnesylated) forms of the protein. Impairment of farnesylation on the Ras Western blot panel was noted by the presence of a more slowly migrating upper unmodified band. The impairment of Rap1a geranylgeranylation was noted by the appearance of a band on the Western blot (the antibody used only detects the unmodified form of Rap1a). HepG2 cells were treated with 25 µM lovastatin for 24 h as a positive control, as this concentration was required to impair both farnesylation and geranylgeranylation (Fig. 4A). Lovastatin depletes mevalonate and the downstream products (e.g., FPP and GGPP) and thus impairs both protein farnesylation and geranylgeranylation. HepG2 cells were treated with 50 µM of compounds 1-5 for 24 h. Monogeranyl bisphosphonate (compound 1) impaired protein geranylgeranylation (Fig. 4A). Compound 2 also impaired geranylgeranylation, whereas compound 3 displayed a slight impairment. No detectable impairment was noted with compounds 4 or 5. Compound 5 was utilized in subsequent studies as the lead inhibitor due to its potency and specificity for SQS.

Fig.4.

Protein prenylation. A: HepG2 cells were treated with 25 µM lovastatin or 50 µM of compounds 1-5 for 24 h. B: Cotreatment of 25 µM lovastatin and 25 µM FPP, 25 µM GGPP, or 25 µM compound 5 for 24 h in HepG2 cells. C: Cotreatment of 10 µM zoledronate with 25 µM FPP, 25 µM GGPP, 2.5 or 25 µM compound 5 for 24 h in HepG2 cells. Impairment of farnesylation is detected by the appearance of an upper unmodified band (arrow) when Western blotting for Ras, whereas the impairment of geranylgeranylation is indicated by the appearance of a band when Western blotting for Rap1a. α-Tubulin is used as a loading control.

Effect of compound 5 on lovastatin- or zoledronate-induced impairment of protein prenylation

Treatment of HepG2 cells with 25 µM lovastatin for 24 h resulted in impairment of both farnesylation of Ras and geranylgeranylation of Rap1a. Lovastatin-induced impairment of Ras farnesylation was prevented by cotreatment with 25 µM exogenous FPP, whereas lovastatin-induced impairment of Rap1a geranylgeranylation was prevented by cotreatment with 25 µM GGPP (Fig. 4B). Cotreatment of 25 µM lovastatin with 25 µM compound 5 prevented lovastatin-induced impairment of Ras farnesylation, but it did not completely restore Rap1a geranylgeranylation.

Treatment of HepG2 cells for 24 h with 10 µM zoledronate caused impairment of Ras farnesylation and Rap1a geranylgeranylation (Fig. 4C), and cotreatment with exogenous FPP or GGPP prevented the impairment of farnesylation or geranylgeranylation, respectively. Cotreatment of HepG2 cells with 10 µM zoledronate with 25 µM compound 5 completely prevented both zoledronate-induced impairment of farnesylation and geranylgeranylation.

Effect of compound 5 and lovastatin on FPP and GGPP levels

We next measured the FPP and GGPP levels from HepG2 cells in response to treatment with either compound 5 or lovastatin alone and in combination for 24 h. In HepG2 cells treated with 25 µM compound 5, FPP levels were increased approximately 16-fold and GGPP levels were approximately 1.6-fold compared with control (Fig. 5). As expected, lovastatin (25 µM) reduced both FPP and GGPP levels compared with control. The combination of 25 µM lovastatin with 25 µM compound 5 resulted in increased FPP levels compared with lovastatin-treated cells; however, GGPP levels remained diminished. This data correlates with the results showing prevention of lovastatin-induced impairment of farnesylation, but not geranylgeranylation, by cotreatment with compound 5.

Fig.5.

FPP and GGPP levels. FPP and GGPP levels were measured from HepG2 cells after 24 h incubation with indicated compounds. Control FPP and GGPP levels are 0.86 and 1.1 pmol/mg protein, respectively. Error bars represent SE, n = 4.

Effect of compound 5 with lovastatin or zoledronate on cholesterol biosynthesis

Lovastatin at 50 nM or compound 5 at 50 µM significantly inhibited de novo cholesterol biosynthesis in HepG2 cells compared with untreated HepG2 cells (Fig. 6). The combination of these concentrations of lovastatin and compound 5 showed a trend toward enhanced inhibition of cholesterol synthesis compared with single treatments, but it was not statistically significant. Zoledronate at 10 µM also reduced cholesterol biosynthesis compared with control, and the combination of 25 µM compound 5 with 10 µM zoledronate did not significantly enhance cholesterol depletion compared with the respective single treatments.

Fig.6.

De novo cholesterol biosynthesis. HepG2 cells were treated with indicated compounds for 1 h followed by addition of ¹⁴C-acetate for 4 h, and then radiolabeled cholesterol was measured. Error bars represent SE, *P < 0.05 compared with control group (one-way ANOVA, Tukey post hoc test), n = 3.

Effect of compound 5 with lovastatin or zoledronate on LDLR mRNA levels

Lovastatin at 10 µM significantly increased LDLR mRNA levels 2.3-fold compared with control HepG2 cells after 24 h (Fig. 7). Compound 5 increased LDLR mRNA levels to 1.4-fold of control, but this was not statistically significant (P > 0.05). The combination of lovastatin and compound 5 resulted in increased LDLR mRNA levels compared with control, but levels were not elevated further than only lovastatin-treated cells. Zoledronate at 10 µM also significantly increased LDLR mRNA compared with control. The combination of zoledronate with compound 5 did not further increase LDLR mRNA levels compared with only zoledronate-treated cells, but the levels remained significantly enhanced compared with control.

Fig.7.

LDLR mRNA levels. HepG2 cells were treated with indicated compounds for 24 h and LDLR mRNA levels were measured as described in Experimental Procedures. Error bars represent SE, *P < 0.05 compared with control group (one-way ANOVA, Tukey post hoc test), n = 3.

Effect of compound 5 on lovastatin- or zoledronate-induced reduction of MTT activity

Treatment of HepG2 cells for 48 h with 25 µM lovastatin significantly reduced MTT activity compared with control (Fig. 8A). Cotreatment with 25 µM FPP, GGPP, or compound 5 significantly diminished lovastatin-mediated reduction of MTT activity. Compound 5 (25 µM) had no significant effect on MTT levels as a single treatment. Zoledronate (10 µM) decreased MTT activity to ∼50% of control cells, and it was not reduced by FPP cotreatment (Fig. 8B). Cotreatment of HepG2 cells with 10 µM zoledronate and 25 µM GGPP or 25 µM compound 5 significantly diminished zoledronate-mediated reduction of MTT activity.

Fig.8.

MTT assay. A: MTT assay of HepG2 cells treated for 48 h with 25 µM lovastatin combined with 25 µM FPP, 25 µM GPPP, or 25 µM compound 5. B: MTT assay of HepG2 cells treated for 48 h with 10 µM zoledronate combined with 25 µM FPP, 25 µM GPPP, or 25 µM compound 5. Error bars represent SE, ^aP < 0.05 compared with control, ^b P < 0.05 compared with lovastatin alone treatment, ^cP < 0.05 compared with zoledronate alone treatment (one-way ANOVA, Tukey post hoc test), n = 3.

DISCUSSION

In the present work, we synthesized and identified novel inhibitors of SQS. A lead inhibitor (compound 5) was identified through in vitro enzyme assays and did not impair protein prenylation in HepG2 cells, suggesting specificity for SQS over the prenylation branch of the mevalonate pathway. Other bisphosphonates have been shown to inhibit SQS (22); however, their effects on protein prenylation were not reported. Enzyme assays established that the addition of a phenyl group at the C-9 position (compound 2) of geranyl bisphosphonate greatly increased potency for SQS in vitro relative to monogeranyl bisphosphonate (compound 1). The addition of a second phenyl ring in an ortho- (compound 3), meta- (compound 4), or para- (compound 5) substitution pattern enhanced potency against SQS as measured by IC₅₀ values. This suggests that the hydrophobic portion of the molecule is important for potency. It would be expected that the bisphosphonate portion of compound 5 likely interacts with magnesium atoms bound within a DDXXD motif. Other bisphosphonates have been shown to interact in this manner with other DDXXD-containing proteins (37). The hydrophobic portion of the molecule may extend into a hydrophobic flap of the protein, consisting of residues 50-54, that has been found to display conformational changes with different inhibitors, including an inhibitor containing a biphenyl group (38). Compounds 1, 2, and the ortho-substituted compound 3 display impairment of protein geranylgeranylation, whereas no impairment was detectable with the meta- (compound 4) or para- (compound 5) compounds. Due in part to the lack of success in clinical trials by SQS inhibitors as monotreatments, emphasis was placed on characterization of compound 5 in combination with HMGCR inhibition (lovastatin) or FDPS inhibition (zoledronate) in HepG2 cells. Simultaneous inhibition of SQS and HMGCR or FDPS provides possible mechanisms for decreasing cholesterol synthesis with less disruption of nonsterol isoprenoid levels compared with single enzyme inhibition, potentially alleviating toxicity due to excessive isoprenoid accumulation or depletion.

Treatment of HepG2 cells with compound 5 results in an inhibition of cholesterol biosynthesis and a substantial accumulation of FPP, which could result in the formation of potentially toxic levels of farnesol (14) or farnesol-derived dicarboxylic acids (13). Bisphosphonates are notorious for poor cellular entry due to their high charge-to-mass ratio, likely partially explaining the relatively high concentrations required in cell culture assays. Future studies could evaluate prodrug approaches that might confer liver targeting and mask the bisphosphonate negative charge, thus significantly enhancing cellular entry (39–41).

With statin treatment, there is depletion of mevalonate and all downstream components of the mevalonate pathway (2). The combination of lovastatin with compound 5 is able to inhibit cholesterol biosynthesis and upregulate LDLR mRNA. Furthermore, compound 5 prevents lovastatin-mediated reduction in FPP levels and impairment of protein farnesylation, although GGPP levels and protein geranylgeranylation are not restored. Many of the pleiotropic effects of statins are thought to be mediated by GGPP depletion and impairment of protein geranylgeranylation (42). For example, statins can upregulate eNOS and have antioxidant effects (43), which are prevented by addition of GGPP but not FPP (44). Due to the diminished GGPP levels and impairment of protein geranylgeranylation with the combination of compound 5 and lovastatin, some statin-mediated pleiotropic effects may be retained. In addition, the combination of compound 5 with lovastatin can partially prevent statin-mediated reduction in cell viability. These results may explain why other SQS inhibitors can reverse models of statin-induced myopathy (15, 16). While adverse effects of the SQS inhibitor lapaquistat as a monotherapy were discouraging, our results suggest a mechanism by which the dual administration of SQS inhibitors with statins may alleviate potential problems due to treatment with either agent alone. The FPP accumulation due to SQS inhibition and FPP depletion due to HMGCR inhibition may offset each other, resulting in FPP available for other necessary cellular processes but not in such extreme excess to produce adverse effects. It remains to be determined if a reduction in GGPP levels resulting from this combination of drugs would be desirable or undesirable.

With FDPS inhibition by nitrogenous bisphosphonates, there is decreased product formation and accumulation of the upstream intermediates DMAPP and IPP (45). Notably, nitrogenous bisphosphonate-induced IPP accumulation can facilitate the formation of the possible proapoptotic isoprene ATP analog known as ApppI (46). With the combination of FDPS and SQS inhibition, the carbon flux will be first inhibited at FDPS, resulting in accumulation of IPP. Albeit limited, the remaining carbon flux through the FDPS inhibition will yield FPP and encounter a second inhibition at SQS, preventing the formation of squalene and resulting in some relative accumulation of FPP. This SQS-induced FPP accumulation when combined with FDPS-induced IPP accumulation yields the necessary substrates for GGPP synthesis. The FPP and GPPP available could then be utilized in other nonsterol branches of the mevalonate pathway, such as protein farnesylation and geranylgeranylation. Indeed, in HepG2 cells, the combination of compound 5 and zoledronate prevents zoledronate-induced impairment of farnesylation and geranylgeranylation and diminishes zoledronate-mediated reduction in MTT activity.

In conclusion, our results suggest that dual inhibition of HMGCR and SQS or FDPS and SQS could yield a means of cholesterol reduction with the potential for minimal off-target effects due to decreased depletion of nonsterol isoprenoids compared with HMGCR or FDPS inhibition alone. Treatment using multiple drugs (SQS inhibitors combined with statins being a possible approach in the near term) or the development of novel compounds capable of dual inhibition could be feasible. In particular, design and synthesis of a single agent capable of potent dual FDPS and SQS inhibition is likely to be an achievable goal, and future studies could evaluate this approach. The results presented herein are from cell culture (in vitro), and future studies would be necessary to validate these hypotheses in vivo because it is difficult to predict the effects of multienzyme targeting in vivo.