Skip to main content
BMC Microbiology logoLink to BMC Microbiology
. 2011 Oct 7;11:223. doi: 10.1186/1471-2180-11-223

The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

Romain Henry 1,2, Emmanuelle Bruneau 1,2, Rozenn Gardan 3, Stéphane Bertin 1,2, Betty Fleuchot 3, Bernard Decaris 1,2, Nathalie Leblond-Bourget 1,2,
PMCID: PMC3199253  PMID: 21981946

Abstract

Background

Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation.

Results

In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311.

Conclusions

These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

Background

The species Streptococcus thermophilus is a Lactic Acid Bacterium (LAB) used as a starter of fermentation in yogurt and cheese production. In nature and during dairy fermentation processes, S. thermophilus is subjected to sudden changes in its environment and its industrial performance is conditioned by its ability to successfully adapt to harsh conditions. To survive, like many other bacteria, this species must develop appropriate physiological responses by modifying gene expression appropriately.

One of the stresses, that S. thermophilus commonly encounters, is the modification of the temperature. For instance, during the production of dairy products, temperature shifts are applied to regulate the bacterial growth and, thus, control the lactic acid production [1]. S. thermophilus survival against thermal stress is conditioned by its ability to sense and quickly adapt its physiology mainly by the synthesis of adequate proteins at the right moment. For example, adaptation of S. thermophilus to a lowering of temperature required the synthesis of a set of chaperones called cold shock proteins (Csp) that is strongly induced in response to a rapid decrease in growth temperature [2,3]. As in other Gram positive bacteria, S. thermophilus also responds to thermal stress by synthesizing a conserved set of heat-shock proteins (Hsp), including both chaperones and proteases [4]. Their role during heat stress is to rescue, or to scavenge, heat-denatured proteins. In LAB, the adaptation to heat shock required the two negative transcriptional factors HrcA [5] and CtsR [6] which negatively control the expression of major molecular chaperones (DnaK, DnaJ, GroEL and GroES) [7] and proteases (Clp family) [6], respectively. Furthermore, Zotta et al. (2009) have shown the involvement of the HrcA and CtsR proteins in the heat stress response of S. thermophilus Sfi39 [8]. Apart from these data, little is known about the network of regulation controlling S. thermophilus adaptation to temperature changes.

Among bacterial transcriptional regulators is the wide conserved family of Rgg regulators encoded by genes, exclusively found in the order of Lactobacillales and the family Listeriaceae [9]. Rgg regulators act by binding to the promoter region of their target genes [10-13]. At their N-terminal end, they carry a Helix-Turn-Helix (HTH) XRE DNA-binding domain demonstrated to be important for their activity as transcriptional regulators [14]. They are positive regulator [15,16] or act both as activator and repressor [17,18]. Most of the Rgg regulators control the transcription of their neighboring genes [9,16,19,20]. However, Rgg from S. pyogenes NZ131, S. agalactiae NEM316 or S. suis SS2 are considered as global regulators since controlling highly diverse genes scattered on the genome [12,13,21,22]. In these cases, Rgg proteins are involved in a network of regulation and modulate the expression of other transcriptional regulators, including several two-component regulatory systems, which are important in the transcriptional response to changing environments [12,13,21]. Several Rgg proteins contribute to bacterial stress response. For instance, the Rgg protein of Lactocccus lactis, also known as GadR, is associated with glutamate-dependent acid tolerance [15]. Within Streptococcus, several Rgg proteins have been involved in oxidative- and/or to thermal-stress responses [23-25].

The high number of rgg genes observed in the genomes of S. thermophilus strains (7 in strains LMG18311 and CNRZ1066, 6 in LMD-9 and 5 in ND03) [26-28] suggests that their acquisition and their preservation are advantageous for S. thermophilus. However, the involvement of these genes in S. thermophilus LMG18311 stress response is still hypothetic and none of the 7 rgg genes of LMG18311 has been studied at the molecular level. To determine whether any of the rgg genes of S. thermophilus LMG18311 are involved in adaptation to changes in environmental conditions, Δrgg deletion mutant was constructed and its tolerance to different stresses was tested. In this study, we demonstrate that (i) the transcription of rgg0182 gene from S. thermophilus LMG18311 is influenced by culture medium and growth temperature, (ii) Rgg0182 is a transcriptional regulator that modulate not only the transcription of its proximal target genes but is also involved in the network of regulation of the transcription of genes coding chaperones and proteases, (iii) this gene is involved in heat shock response.

Results

Analysis of the rgg0182 locus

The rgg0182 gene corresponds to the stu0182 gene of the complete genome sequence of S. thermophilus LMG18311 [26]. However, the sequencing of the rgg0182 gene (GenBank Accession JF699754) followed by its sequence comparison with the stu0182 gene revealed that this latter contained sequencing discrepancies (substitutions in positions 44, 46, 50, 579 and 681 compared to the rgg0182 sequence). The rgg0182 gene (864 bp) potentially encodes a protein of 288 amino acids with a predicted molecular mass of 35.6 kDa. This protein exhibited an identity of about 30% with other streptococcal proteins belonging to the Rgg family of transcriptional regulators and 35% identity (e-value = 8e-48) with Rgg1358 from S. thermophilus LMD-9 which was recently shown to be involved in a quorum sensing (QS) mechanism [9]. Rgg0182 contained a HTH-XRE motif from amino acid 11 to 67 typical of Rgg regulators and a Rgg-C-terminal motif from amino acid 70 to 288 (Figure 1). Therefore, the rgg0182 gene was predicted to encode a transcriptional regulator.

Figure 1.

Figure 1

Schematic representation of the rgg0182 and rgg1358 loci (A) and of the corresponding proteins (B). Although the rgg0182 and rgg1358 loci present analogies (A), they encoded distinct proteins (B). Numbers in panel A indicate the position of nucleotides, with the +1 position being that of the first nucleotide of the rgg0182 gene. The "deletion fragment" corresponds to the deleted portion of the rgg0182 gene in the Δrgg0182 mutant. The broken arrows indicate the promoters. Pshp0182 and Ppep0182materialized the position of the 126 bp and 165 bp PCR fragment respectively used in EMSA. In panel B, amino acids sequence identities are indicated in percent. HTH indicated the Helix-Turn-Helix-XRE motif.

The gene rgg0182 was surrounded by two ORFs (Figure 1), not annotated in the genome of the strain LMG18311, but revealed using the software bactgeneSHOW designed for small-gene detection [29]. Indeed, upstream of the rgg0182 gene was the shp0182 gene (63 nucleotides long), potentially encoding a small hydrophobic peptide belonging to the group I of the SHP family [9]. Downstream of rgg0182 was the pep0182 gene (42 nucleotides long), encoding a small peptide with no similarity with peptides found in databases. Although, the genetic organization of the rgg0182 locus was similar to that of the rgg1358 of the LMD-9 strain from S. thermophilus, these two loci were distinct as illustrated by the low sequence identity between the proteins encoded by them (Figure 1). The two shp genes were classified in two distinct groups from the SHP family [9]. Finally, the rgg0182 locus and its flanking genes were also found in the genome of CNRZ1066 strain but missing in the genome of ND03 and LMD-9 strains.

Transcription analysis of the rgg0182 gene

In the literature, studies of rgg genes transcription are scarce. Indeed, only the ropB transcription from Streptococcus pyogenes has been studied [10]. Thus, it was of interest to determine whether transcription of rgg was constitutive or not. To do so, the rgg0182 transcription was studied by qPCR from cells cultivated in LM17 or CDM medium at 30 or 42°C. In all qPCR experiments, the values were normalized to the expression of the ldh gene encoding the lactate dehydrogenase. This gene was considered as a relevant reference since it was demonstrated to be constitutively expressed in all tested conditions (data not shown). The qPCR experiments were realized from three independent RNA extracts and done in duplicate.

Figure 2A showed the relative transcription levels of the rgg0182 gene in the LMG18311 strain. When cultivated at 42°C in LM17 medium, the wild-type strain showed a significant decrease in its rgg0182 mRNA levels during growth. Indeed, the rgg0182 mRNA level was highest in the exponential phase (0.16 +/- 0.08) and was down-regulated 4-fold in stationary phase (p = 0.01). Similar results were obtained in CDM medium at 42°C where the transcription of rgg0182 was found to be more than 3-fold higher in the exponential phase than in stationary phase (p < 0.001). Whatever the medium tested, the transcription of rgg0182 was found to be growth-phases dependent.

Figure 2.

Figure 2

Relative rgg0182 gene transcript level from S. thermophilus LMG18311 cells, grown at 42°C (A) and at 30°C (B). Total RNAs from the wild type strain were extracted from exponential (E, white bars), transition (T, light gray bars) and stationary (S, dark gray bars) phase cells. Data are presented as the mean +/- standard deviation from three independent experiments performed in duplicate. Student's t test: *, p < 0.001.

We then investigated whether rgg0182 was transcribed at other temperatures and chose to work at 30°C, temperature at which S. thermophilus can be exposed during industrial processes (Figure 2B). When cells were cultivated at 30°C in LM17, the profile of rgg0182 transcripts was similar with that observed at 42°C. In contrast when cells were grown at 30°C in CDM medium, an increase of rgg0182 transcription was observed during the growth, i.e. the rgg0182 mRNA level was more than 3-fold higher (p < 0.001) in stationary phase than in exponential phase. The rgg0182 transcripts level of stationary phase cells grown in CDM medium was 14-fold higher (p < 0.001) at 30 than at 42°C indicating it was on the influence of the growth temperature. Taken together, these results revealed that the kinetics of rgg0182 transcription was medium and temperature dependent and that the transcript level of rgg0182 was the highest in stationary phase cells cultivated in CDM at 30°C.

Effects of the Rgg0182 protein on the transcription of its flanking genes

Data from the literature indicate that several products of rgg genes regulate adjacent genes [9,16,19,20]. To determine whether the product of the rgg0182 gene was involved in the transcriptional regulation of its flanking genes, we designed primers and used them in qPCR to measure the level of transcription of the shp0182 and pep0182 genes. However, the qPCR failed probably because of the small size of the pep0182 and shp0182 genes that did not allow the design of effective primers. As an alternative strategy, the activity of the pep0182 and shp0182 promoters was studied with transcriptional fusion in a wild-type and a Δrgg0182 background. To do so, plasmids carrying transcriptional fusions coupling the intergenic region of each flanking gene to a luxAB-reporter fusion were constructed and named pGICB004::Ppep0182 and pGICB004::Pshp0182, as well as the Δrgg0182 strain carrying a chromosomal deletion of the rgg0182 gene. Both plasmids were integrated in the wild-type or Δrgg0182 mutant chromosome. Relative levels of activity of the pep0182 and shp0182 promoters were determined in both strains either grown in LM17 or CDM (Figure 3), at 30 or 42°C. Whatever the conditions, no significant difference in the growth rate or yield was observed between the wild type and the mutant. In LM17 at 30 and 42°C, almost no luciferase activity was detected with both promoters in the wild type or the Δrgg0182 background (data not shown). This suggests that the promoters Ppep0182 and Pshp0182 are not active in these experimental conditions. In contrast in CDM medium, for both promoters in a wild type background, a luciferase activity was detected at 30°C and 42°C (Figure 3). Nevertheless, the maximum of Ppep0182-luxAB and Pshp0182-luxAB activity were 28- and 6-fold higher (p < 0.001) at 30°C than at 42°C, respectively. In addition, the level of activity of the Ppep0182-luxAB and Pshp0182-luxAB fusions differed between the wild-type and the mutant strains. Indeed, in cells cultivated in CDM at 30°C, in the Δrgg0182 mutant the Ppep0182-luxAB and the Pshp0182-luxAB showed both a maximum activity that was 3-fold lower (p < 0.001) than in the LMG18311 strain (Figure 3). These results demonstrated that rgg0182 played a role in the regulation of the transcription of both Ppep0182-luxAB and Pshp0182-luxAB fusions and supported the hypothesis that Rgg0182 may, directly or not, regulate the transcription of pep0182 and shp0182 genes. Moreover, the growth medium, as described above and by Ibrahim et al. (2007b), and, in an original way, the temperature were parameters that influenced the levels of activity of the promoters Ppep0182 and Pshp0182.

Figure 3.

Figure 3

Luciferase activity and growth of the LMG18311 and the Δrgg0182 strains containing the Pshp0182-luxAB and Ppep0182-luxAB transcriptional fusions, in CDM medium. The expression of the fusions was followed in strains cultivated in CDM medium, at 30°C (A) or at 42°C (B). Data are presented as the mean +/- standard deviation of three independent experiments. AU: luminescence arbitrary units normalized against the OD600nm of the cultures.

Study of the binding of Rgg0182 protein of S. thermophilus upstream of shp0182 and pep0182 genes

The results above and the presence of the HTH motif on the N-terminal part of Rgg0182 protein suggested that Rgg0182 may regulate the transcriptional activities of the Pshp0182 and the Ppep0182 promoters by binding to their DNA sequences. To test this hypothesis, DNA electrophoretic mobility shift assay were carried out. To do so, the His6-Rgg0182 protein was overproduced in E. coli C41(DE3), verified by SDS-PAGE and Western blot (data not shown). Immobilized Metal ion Affinity Chromatography (IMAC) purification of the His6-Rgg0182 protein was performed. The purity of the Rgg0182 protein was assessed by SDS-PAGE using Coomassie blue protein staining, i.e. only one band of the expected molecular mass (35.7 kDa) was revealed (data not shown).

A 126 bp PCR amplified DNA fragment (Figure 1), including the entire 72 bp intergenic rgg0182-shp0182 region and part of the 5' end of the shp0182 and rgg0182 genes, was incubated with the purified His6-Rgg0182 protein. As can be seen in Figure 4, the Rgg0182 protein retarded the shp0182 promoter DNA fragment. The same experiment was realized with a 165 bp PCR amplified fragment, covering the entire 150 bp intergenic rgg0182-pep0182 region including the pep0182 promoter, and analogous results were obtained (Figure 4). The Pldh probe corresponding to the promoter region of the ldh gene was chosen as a negative control in EMSA experiments since its expression was not under the control of Rgg0182. Using Pldh as a probe, no DNA retardation was observed, demonstrating that Rgg0182 binds specifically to the promoter of its target genes. Thus, these results demonstrated conclusively that Rgg0182 activated the shp0182 and pep0182 genes transcription by binding to their promoter regions.

Figure 4.

Figure 4

Analysis of the Rgg0182 binding to DNA. Electrophoretic mobility shift assay (EMSA) of the promoter regions of the two target genes (shp0182 and pep0182) of Rgg0182 in the absence or in the presence of the purified His6-Rgg0182 protein. DNA probes labelled with biotin (0.1 pmol each) were incubated with 2 pmol of Rgg0182. The Pldh probe is an ldh promoter fragment used as a negative control.

Effects of the Rgg0182 protein on the transcription of genes encoding protease and chaperone proteins

The impact of temperature on the rgg0182 gene transcription suggested a role for the Rgg0182 protein on S. thermophilus LMG18311 adaptation to thermal changes. Thus, we hypothesized that Rgg0182 might control the transcription of genes encoding a set of heat- and cold-shock proteins including chaperones and proteases. Chaperones and ATP-dependent proteases play a major role for bacterial survival under conditions of heat stress where proteins tend to unfold and aggregate. Based upon the S. thermophilus LMG18311 genome sequence [26], genes predicted to encode the major chaperones and proteases involved in heat shock responses were selected for analysis: clpC, dnaK, dnaJ, hsp33, groES, groEL, clpP, clpX, clpE, clpL (Genbank Accession NC_006448, locus tags stu0077, stu0120-0121, stu0180, stu0203-0204, stu0356, stu0581, stu0602, stu1614, respectively). The two cspA and cspB genes (locus tags, stu0837-0838 respectively), involved in S. thermophilus cold stress response, were also included in this study. The transcript levels of these genes were measured by qPCR on stationary phase cells of the wild-type and the Δrgg0182 mutant grown in CDM medium at 30°C (i.e. when rgg0182 was the most transcribed) from 3 independent experiments done in duplicate (Figure 5). In these conditions, the transcript level of almost all genes encoding protease and chaperone proteins (except that of dnaJ, groEL, cspA and cspB) was under-expressed in the Δrgg0182 mutant compared to the wild type strain suggesting a role for Rgg0182 in the control of their transcription. The difference in the transcript abundance between the wild type and Δrgg0182 mutant strains ranged from 1.5- to 20-fold and were statistically significant (P < 0.001). As described in other Streptococcus transcriptional analysis, a 1.5-fold difference in transcript level was interpreted as a significant difference in expression between the strains [21,23].

Figure 5.

Figure 5

Relative genes transcript level of S. thermophilus stationary phase cells grown in CDM medium at 30°C. Total RNAs were extracted from stationary phase cells of S. thermophilus LMG18311 (dark gray bars) and its isogenic Δrgg0182 mutant (light gray bars) grown in CDM at 30°C. Data are presented as the mean +/- standard deviation of the gene transcript levels measured from 3 independent experiments done in duplicate. Student's t test: *, p < 0.001.

In low-GC Gram positive bacteria, the control of the transcription of the clp family genes and of dnaK and groES genes is primarily mediated by binding of the CtsR and HrcA repressors, respectively, to promoter region of target genes. In S. thermophilus LMG18311, we found CtsR operators (AGGTCAAANANAGGTCAAA) [6] upstream of clpP, clpE, clpL, ctsR, clpC and groEL genes and HrcA binding sites (GCACTC(N)9GAGTGCTAA) [30] only upstream of hrcA, groEL (with 2 mismatches) and dnaJ (6 mismatches). These results prompted us to evaluate the level of ctsR and hrcA transcripts (locus tags, stu0076 and stu0118 respectively) in the wild-type and the Δrgg0182 mutant. These data revealed no significant difference for ctsR gene whereas the hrcA transcript level was nearly 4-fold reduced in the absence of rgg0182 suggesting that Rgg0182 positively controls hrcA transcription.

These results indicate that Rgg0182 is a positive transcriptional regulator of heat shock proteins encoding genes in particular of hrcA, clpC, clpE, clpL, clpP, clpX, dnaK, groES and hsp33 genes.

Role of the rgg0182 gene in the heat shock response of S. thermophilus

Knowing that several rgg genes from pathogenic streptococci are involved in stress response and taking into account the above data, we checked whether rgg0182 could be involved in the S. thermophilus adaptation to heat shock. The heat tolerance was evaluated on stationary phase cells grown for 10 h in CDM medium (OD600nm = 1.5) or in LM17 medium (OD600nm = 2.5) at 30°C (where rgg0182 was found to be higher or lower transcribed, respectively) before (control condition) and after a 15, 30, 45 and 60 minutes incubation at 52°C (temperature limit for growth of S. thermophilus LMG18311 in our laboratory conditions). The experiments were realized 3 times independently in triplicate. Using the LM17 medium (data not shown), no significant difference was observed between the strains. An exposure at 52°C, whatever its duration, resulted in a 20% decrease of the survival of both strains.

On the contrary, when stationary phase cells grown in CDM were exposed to a 52°C heat stress for up to 30 min, the mutant showed a significant increase of the sensibility compared to the wild type (p < 0.001) (Figure 6). The heat tolerance of the Δrgg0182 mutant decreased gradually with the heat exposure time (72%, 53%, 46% and 38% of survival at 15, 30, 45 and 60 minutes, respectively). Between both strains, a difference of survival was observed at 30, 45 and 60 minutes where the mutant was up to 1.75 fold less resistant than the wild type strain. Thus, the decreased of survival of the mutant show that rgg0182 plays a role in S. thermophilus adaptation to heat stress.

Figure 6.

Figure 6

Survival of the S. thermophilus strain LMG18311 and the Δrgg0182 mutant after heat shock (0, 15, 30, 45 and 60 min at 52°C). S. thermophilus was cultivated in CDM medium at 30°C and then exposed to heat stress. The percentage of survival was calculated as N/N0 ×100 where N0 is the CFU number of the control condition and N the CFU number in heat stress condition. Dark gray bars correspond to wild type strain and light gray bars correspond to Δrgg0182 strain. Data are presented as the mean +/- standard deviation of 3 independent experiments done in triplicate. Student's t test: *, p < 0.001.

The Rgg0182 protein of S. thermophilus LMG18311 is involved in the transcription regulation of clpE and cspB genes in heat stress condition

The impairment of the survival of the Δrgg0182 mutant cells following a sudden increase in temperature suggested that the rgg0182 gene may act to regulate the transcription of S. thermophilus genes involved in the heat shock response. To investigate a possible role for Rgg0182 in changes of the transcription of heat shock genes, the transcript level of genes encoding chaperones and proteases were measured by qPCR. The transcript levels of the 14 selected stress-responsive genes were studied, in three independent experiments done in duplicate, on stationary cells of the wild-type and the Δrgg0182 mutant grown in CDM and exposed 30 minutes at 52°C. Our results showed that clpE and cspB genes were about 2-fold less and 3-fold more transcribed, respectively, in the mutant strain compared to wild-type (p < 0.001) (Figure 7). No significant difference was observed for the other genes studied (data not shown). This observation suggests that at high temperature, Rgg0182 is a positive regulator of clpE transcription and a negative regulator of cspB transcription.

Figure 7.

Figure 7

Relative genes transcript level of S. thermophilus cells exposed to a heat stress. Total RNAs were extracted from stationary phase cells of S. thermophilus LMG18311 (dark gray bars) and its isogenic Δrgg0182 mutant (light gray bars) grown in CDM at 30°C until stationary phase and then exposed 30 min at 52°C (heat stress condition). Data are presented as the mean +/- standard deviation of the gene transcript levels measured from 3 independent experiments done in duplicate. Student's t test: *, p < 0.001.

Discussion

The aim of the present study was to determine if Rgg0182 functioned as a transcriptional regulator. First, we showed that it was transcribed in a growth phase dependent manner i.e., in LM17 (at 30°C and 42°C) or CDM (at 42°C), a higher expression level was observed in exponential phase than in stationary phase. Interestingly, using CDM medium, it was found that the rgg0182 transcripts were more abundant at 30°C than at 42°C suggesting that rgg0182 transcription was also influenced by temperature. Because of their immediate vicinity with the rgg0182 gene, the transcription of shp0182 and pep0182 genes was hypothesized to be under the control of Rgg0182. This was confirmed by the use of transcriptional fusions showing that the activation of the Pshp0182 and Ppep0182 promoters required the presence of Rgg0182 and that their activity was optimal under the conditions were transcription of the rgg0182 gene was mostly expressed (i.e. in CDM medium at 30°C in stationary phase growth). Finally, to confirm the probable interaction of Rgg0182 with DNA, EMSA experiments were carried out and demonstrated conclusively that Rgg0182 binds to the promoter region of the shp0182 and pep0182 target genes. Together these results were in coherence with Rgg0182 being a transcriptional regulator, positively and directly, controlling the expression of shp0182 and pep0182 genes.

The rgg0182 locus combined a gene encoding a transcriptional regulator of the Rgg family with another gene encoding a small hydrophobic peptide of the SHP family. Recently, one of these shp/rgg loci, named shp/rgg1358 in LMD-9 has been demonstrated to encode two components of a novel QS mechanism [9]. This system involves a Rgg transcriptional regulator and a SHP pheromone that is detected and reimported into the cell by the Ami oligopeptide transporter. The target gene of the shp1358/rgg1358 pair, called pep1357C, is located just downstream of the rgg1358 gene, and encodes a secreted cyclic peptide [31]. By analogy with the Shp1358/Rgg1358 locus, we hypothesize that the SHP0182/Rgg0182 pair would also been involved in a QS mechanism with Shp0182 being a pheromone possibly controlling the activation of the Rgg0182. Thus, one hypothesis to explain the high rgg0182 transcript level in CDM is to consider that the rgg0182 transcription would be under the control of the Rgg0182/SHP0182 pair and to consider that in a medium free of peptide, the internalization of shp0182 by Ami transporter would be facilitated. Moreover, the mechanism of rgg0182 expression seemed to be more complex than that of rgg1358 since not only influenced by the culture medium but also by the temperature. Further experiments will be done (i) to determine whether the QS mechanism involving the SHP1358 and the Rgg1358 can be generalized to other SHP/Rgg pairs, including SHP0182/Rgg0182 pair and (ii) to understand the mechanism by which temperature could influence the rgg0182 expression.

On the other hands, induction of the rgg0182 expression at 30°C suggests that this gene might participate in the physiological adaptation of S. thermophilus to this temperature. When cells were cultivated in CDM at 30°C, the inactivation of rgg0182 was associated with a reduce expression of genes encoding chaperone and protease proteins. In Bacillus subtilis, the DnaKJ complex facilitates substrates folding to the native state and the GroESL complex provides an isolated environment for the proper folding of small protein substrates [32]. The degradation of unfolded proteins and small peptides is ensured by a protease complex composed of the protease subunit ClpP and several ATPases of the Clp family [32]. Thus, the Rgg0182 is a transcriptional regulator whose biological roles would be to control the homeostasis of chaperone and protease proteins in cells grown at 30°C in CDM. This is in concordance with data obtained in S. pyogenes where Rgg is found (at the protein level) to control the expression of ClpL, ClpP, GroEL and DnaK in stationary phase (4). Furthermore, it was shown that ClpL protein of S. thermophilus Sfi39 is necessary for correct response to both heat and cold stresses [4].

Results of qPCR experiments also showed an effect of Rgg0182 on hrcA expression. However, preliminary EMSA results (data not shown) indicated that the Rgg0182 protein did not bind to the hrcA promoter region. This suggests that the transcription of hrcA obviously is stimulated by Rgg0182 indirectly, perhaps by influencing the expression of another regulatory protein. Such indirect regulation has already been reported for other Rgg proteins [12,13,21] and, in the present study, might be extended to, at least, some of the rgg0182 distal target genes.

Finally, to assess the significance of Rgg-associated changes in the expression of genes involved in the heat shock response, we checked whether the deletion of rgg0182 had an impact on the survival of the strains under heat stress conditions (shift from 30°C to 52°C for 15 min to 60 min). Interestingly, an impaired survival of the mutant was observed but only when the cells were cultivated in the CDM medium, i.e. in conditions where the difference in the level of rgg0182 transcripts was maximal between both strains. In the mutant cultivated in CDM, the percent of survival decreased with the duration of the heat exposure. These results demonstrated a role for Rgg0182 in S. thermophilus fitness in response to sudden increased of the temperature. As observed in other streptococcal strains [24,25], the deletion of the rgg0182 gene is not associated with a drastic modification of the survival to stress suggesting that this regulator is not essential but important for heat stress adaptation. Furthermore, our results showed that cspB and clpE genes were 2-fold lower and 3-fold higher, respectively, in the mutant compared to the wild-type strain after the heat stress. Data from literature indicate that most Csp proteins are required when cells are grown at low growth temperature [2,3]. Thus, the Rgg0182 would negatively control the production of CspB when the latter is not required. Moreover, in S. pneumoniae, the clpE gene has been demonstrated to be required for thermo-tolerance [33], therefore we hypothesize that the heat sensitivity of the S. thermophilus Δrgg0182 mutant would result, at least partially, from a reduced level of ClpE expression. Alternatively, it is also conceivable that Rgg0182 regulates the transcription of other genes encoding proteins involved in the S. thermophilus heat stress response. A transcriptomic analysis would identify all targets of this regulator within S. thermophilus LMG18311.

Conclusions

In conclusion, our study gave a better understanding of the thermal adaptation of the important dairy starter, S. thermophilus. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during industrial processes and more specifically during changes in temperature.

Methods

Bacterial strains, media and reagents

Streptococcus thermophilus LMG18311 and its derivatives are presented in Table 1. S. thermophilus strains were grown at 30 or 42°C in M17 medium with lactose (10 g/l) (LM17, a classical medium for S. thermophilus growth) [34] or in a chemically defined medium (CDM, a peptide free-medium) [35]. Pre-cultures were incubated at 42°C in milk medium except for the luciferase assays as mentioned below. For numeration, agar was added to the medium (15 g/l) and cells were incubated under anaerobic conditions using GENbox anaer in Generbox jars (bioMérieux SA, Marcy-l'Etoile, France). S. thermophilus strains containing the pG+host9 vector [36] were cultivated in the presence of erythromycin (final concentration 2 μg/ml) at 30°C when plasmid self-maintenance was required and at 42°C for selection of clones with the chromosome's integrated plasmid.

Table 1.

Bacterial strains and plasmids used in this study

Strains and plasmids Genotype/phenotype/source Origin or reference
Streptococcus thermophilus

LMG18311 Wild-type; isolated from yogurt. BCCM LMG
Δrgg0182 Derivative of LMG18311 carrying a 699 bp deletion in the rgg0182 gene This study
LMG18311 blp::Ppep0182-luxAB LMG18311 containing a Ppep0182-luxAB fusion at the blp locus This study
LMG18311 blp::Pshp0182-luxAB LMG18311 containing a Pshp0182-luxAB fusion at the blp locus This study
Δrgg0182 blp::Ppep0182-luxAB Δrgg0182 containing a Ppep0182-luxAB fusion at the blp locus This study
Δrgg0182 blp::Pshp0182-luxAB Δrgg0182 containing a Pshp0182-luxAB fusion at the blp locus This study
Escherichia coli

EC101 supE hsd-5 thi Δ(lac-proAB) F'(traD6 proAB+ lacIq lacZΔM15) repA+, derivative of TG1 strain [37,38]
EC101 pG9Δrgg0182 Derivative of EC101 containing pG9Δrgg0182 This study
C41(DE3) Derived from BL21(DE3) (F- ompT hsdSB(rB- mB-) gal dcm met (DE3); Novagen); at least one uncharacterized mutation [39]
C41(DE3) pET15b::rgg0182 Derivative of C41(DE3) containing pET15b::rgg0182 This study
Plasmid

pG+host9 Thermosensitive plasmid replication origin from pVE6002, used for gene replacement; EryR [36]
pG9Δrgg0182 Derivative of pG+host9 carrying a 699 bp (from nucleotide 82 to 783) deletion for rgg0182 This study
pGICB004 Thermosensitive plasmid, Emr; used for the construct of transcriptional fusions. Allow the integration of the luxAB genes of Photorabdus luminescens at the blp locus of the S. thermophilus chromosome [9]
pGICB004::Ppep0182 Derivative of pGICB004 used to introduce a Ppep0182-luxAB transcriptional fusion at the blp locus This study
pGICB004::Pshp0182 Derivative of pGICB004 used to introduce a Pshp0182-luxAB transcriptional fusion at the blp locus This study
pET15b Expression vector for N-terminal His6-tagged fusion; AmpR Novagen
pET15b::rgg0182 Derivative of pET15b carrying a 864 bp insert coding a Rgg0182 His6-tagged protein This study

BCCM Belgian Coordinated Collections of Microorganisms, LMG Laboratory of Microbiology and Genetics, University of Gent

E. coli strains were grown in Luria-Bertani (LB) medium [37] at 30 or 37°C with shaking (250 rpm). E. coli EC101 [38] was used as a host for recombinant plasmids derived from pG+host9 [36] and E. coli C41(DE3) [39] for recombinant plasmids derived from pET15b (Novagen). When required, erythromycin (150 μg/ml) or ampicillin (150 μg/ml) was added.

DNA and RNA manipulations

Conventional techniques for DNA manipulation, such as preparation of chromosomal and plasmidic DNA, restriction enzymes digests, PCR experiments, transformation by electroporation and Southern blotting were performed as described [37]. Plasmids and primers used in this study are listed in Table 1 and Table 2, respectively. Oligonucleotides were purchased from Eurogentec (Liège, Belgique). Sequencing reactions were done from PCR products by the Beckman Coulter Genomics Society (Grenoble, France) using an ABI 3730XL Sanger sequencing platform.

Table 2.

Primers used for PCR and qPCR

Name Primer sequence (5'-3')
Primers for vectors construction

Rgg0182I1 CTGGAACTGCAGGAGCAGC
Rgg0182I2 ATAATTTGAGAATTCTGTACCTT
Rgg0182II1 TCTCTGGAATTCTTTAAATTG C
Rgg0182II2 CTTGTCCTGCAG TCTCACTCCC
Rgg0182SE1 CCCCCCCCATATGGGAAAACAAAATGAACTG
Rgg0182SE2 CCCCGGATCCTTAACCTACAATCGACTTAAA
Pep0182up GAAGAATTCGTAAAAAGCATCAGATTTTAC
Pep0182down AACTACTAGTGCATTTTAAGTCGATTGTAGG
SHP0182up GAAGAATTCAACAATTTCATATGATTTCCTCC
SHP0182down AACTACTAGTTCAGTCTCTCCTCTTTC
Primers for DNA EMSA

Pldh-5' ACGCTTTCACTTAATAATTC
Pldh-3' TGGTCTAAACATCTCCTTA
Pshp-5' GTAAATACATGTCAATAGGAC
Pshp-3' TTTGTTTTCCCATATATGCAACC
Ppep-5' AGCATCAGATTTTACTCCAGATG
Ppep-3' TTGTAGGTTAATCCCGTTTATGC
Primers for gene expression analysis

Gene Locus Forward Reverse
ldh stu1280 AAGCTATCCTTGACGATGAA AATAGCAGGTTGACCGATAA
rgg0182 stu0182 GAAGTGGAGGAGTTGCCTAA CCCAGCTCTCAATCCCAAA
hrcA stu0118 ACACCTCTTCAAGGAACTGAT GTCACTTCATCATCGGAGATA
dnaK stu0120 GACATTGACGAAGTCATCCT GCACCCATAGCAACTACTTC
dnaJ stu0121 CGTGAAGTGACATGTAAGACA ACCAAGTGGTGTTTGTGTATC
groES stu0203 GAAGGTACCCGTACTCTTACTG AACGTAATCTTCTCCGTCTTTA
groEL stu0204 ATTGCTTATAATGCCGGTTA AGCGTTAAATCCTGTACCAA
hsp33 stu0180 TTTAGTAGGTCCTTTCATG CGATTTCACCAGAAATAAGC
cspA stu0837 ATTGGTTTAACGCTGACAAAG TAACCTTTTGACCTTCATCGT
cspB stu0838 TATGGCAAATGGAACAGTAAA CAAGTGATTTGAATCCATCAG
ctsR stu0076 AGATCAGCTCAGCGAACA AGAATACGCGAACGAATG
clpC stu0077 ACTGGCAGATTATACCAAAGAC CACCTACCAAGACAGGATTATT
clpP stu0356 CTTGCTCAAGACTCGTAATAACT AAGCCATATTCAAGTGTTTCTT
clpX stu0581 TGGACTTATCCCTGAATTTATC AAGACAAGAGGGTTTGATACTG
clpE stu0602 CCGTACCAAGAACAATCCT ACGGATAACTTGCTTGCTT
clpL stu1614 CGTTTCGACGCAGTTATT TTCGCTAACTGCCAAGTC

Restriction sites are indicated with bold letters: PstI: CTGCAG; EcoRI: GAATTC; SpeI: ACTAGT; NdeI: CATATG; BamHI: GGATCC

Plasmids and strains construction

The Δrgg0182 mutant was constructed following the experimental procedure described by Layec et al. (2009) [40] using the following primers pairs: rgg0182I1/rgg0182I2 and rgg0182II1/rgg0182II2 to amplify fragments I and II, respectively. The resulting Δrgg0182 mutant was checked by sequencing.

The construction of pGICB004::Ppep0182 and pGICB004::Pshp0182 vectors was done as described in [9]. Briefly, the pep0182 and shp0182 promoters were amplified by PCR using the couple of oligonucleotides Pep0182up/Pep0182down and SHP0182up/SHP0182down, respectively. Following a digestion with restriction enzymes SpeI/EcoRI, both fragments were independently inserted downstream from luxAB in the pGICB004 plasmid previously digested with the same restriction enzymes. The pGICB004 plasmid was used since it allows the integration of transcriptional fusions to the luxAB reporter genes at the blp locus in S. thermophilus [9]. The final pGICB004::Ppep0182 and pGICB004::Pshp0182 plasmids were used to transform the LMG18311 and in its derivative Δrgg0182 strain. The strains LMG18311 blp::Ppep0182-luxAB, LMG18311 blp::Pshp0182-luxAB, Δrgg182 blp::Ppep0182-luxAB and Δrgg182 blp::Pshp0182-luxAB were obtained by gene replacement at the blp locus as described in [9].

For the construction of the pET15b::rgg0182 plasmid necessary for the Rgg0182-His6-tagged protein overexpression, the rgg0182 (864 bp) gene was amplified by PCR using the primers Rgg0182SE1 and Rgg0182SE2 which contained NdeI and BamHI restriction sites, respectively, with S. thermophilus LMG18311 chromosomal DNA as template. The amplified DNA fragment was double digested with restriction enzymes NdeI/BamHI and fused in-frame to the 3'end His6-tagged of pET15b vector (Novagen), generating the pET15b::rgg0182 plasmid. The in-frame fusion was confirmed by DNA sequencing.

Luciferase assays

To perform luciferase assays, pre-cultures were grown overnight at 30 or 42°C in CDM or LM17 medium. Pre-cultures were then diluted to an OD600nm of 0.05, in 50 ml of respective appropriate medium and temperature. A volume of 1 ml of the culture was sampled at regular intervals during the growth until the stationary phase and analyzed as follows: OD600nm was measured, 10 μL of a 0.1% nonyl-aldehyde solution was added to the sample and the luminescence was measured with a Luminoskan TL (Labsystems). Results are reported in relative luminescence divided by the OD600nm (AU). Three independent experiments were realized.

Overexpression, purification of Rgg0182-His6-tagged protein and Western blotting

Expression of the His6-tagged protein was induced in E. coli C41(DE3) containing pET15b::rgg0182 for 4h at 30°C by adding Isopropyl β, D-thiogalactopyranoside (IPTG, 1mM final concentration) to the OD600nm = 0.5 culture. Cells were harvested by centrifugation at 14,000 rpm, at 4°C for 30 min. The supernatant was discarded and cells were suspended in lysis buffer (50 mM phosphate sodium pH 8.0, 300 mM NaCl, and 10 mM imidazol) and stored at -20°C. The cells were disrupted on ice with a microtip of Sonifier 250 (Branson Ultrasonics). The soluble fraction including the recombinant His6-tagged protein was collected by centrifugation at 20,000 rpm for 45 min at 4°C and loaded on an affinity chromatography column equilibrated with lysis buffer. When the UV absorbance at 280 nm had fallen to the zero baseline, the recombinant Rgg0182 protein was eluted by elution buffer (50 mM phosphate sodium pH 8.0, 300 mM NaCl, 250 mM imidazol). The eluted fraction was collected and finally concentrated in Tris EDTA buffer pH 8.0. The purity of the His6-tagged proteins was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) using 15% acrylamide resolving.

For Western blot experiments, proteins were size separated by SDS-PAGE 12% acrylamide resolving gel and electroblotted onto polyvinylidene difloride (PVDF) membrane (Roche Applied Science) using a semi-dry blotting system (Bio-Rad). After transfer, the PVDF membrane was blocked with 5% skim milk in Tris-buffered saline containing 0.1% tween 20 (TBS-T) for 1 h. The membrane was subsequently incubated for 1 h with penta-His antibodies (1:10,000) (Qiagen), washed three times with TBS-T and incubated for 1 h with conjugated goat anti-mouse immunoglobulin G (H + L)-horseradish peroxidase (1:10,000) (Bio-Rad). The membrane was washed three times with TBS-T. Finally, the antibodies-antigen complexes were visualized by using the Bio-Rad Immun-Star Western system as described by the manufacturer and were detected by chemiluminescence, using the Chemi-Doc from Bio-Rad.

DNA electrophoretic mobility shift assay (EMSA)

The DNA binding of the His6-tagged Rgg0182 protein to the shp0182 and pep0182 promoter regions was tested by EMSA using the LightShift Chemiluminescent EMSA Kit (Thermo Scientific). The promoter regions of ldh (Pldh, 110pb), shp0182 (Pshp0182, 126 bp) and pep0182 (Ppep0182, 165 bp) were amplified by PCR using the Pldh-5'/Pldh-3', Pshp-3'/Pshp-5' and Ppep-3'/Ppep-5' primers, respectively. These were 3'-end biotin labelled with Biotin 3' End DNA Labeling Kit (Thermo Scientific) and used in EMSA according to the manufacturer's instructions. Chemiluminescent detection of biotin DNA on membranes was realised with the Chemi-Doc apparatus (Bio-Rad).

RNA extraction and quantitative RT-PCR (qPCR) experiments

RNA extractions were adapted from Kieser et al. (1999) [41]. RNAs were extracted from cultures grown in CDM or LM17 medium in exponential, transition, or stationary phase at 30 or 42°C. RNAs were also extracted from stationary phase cells exposed to a 30 min temperature shift from 30 to 52°C. The RNAs were treated with amplification grade DNase I (Euromedex). The quantity and quality of the RNA samples were verified by agarose gel electrophoresis and by measuring their absorbance at 260 and 280 nm (NanoDrop-1000). Reverse transcription was performed according to the manufacturer's instructions (MMLV-reverse transcriptase, Invitrogen). cDNA was generated from 1.25 μg of DNA-free RNA and used for qPCR analysis of transcription of rgg0182 gene and its potential target genes transcript levels. Gene transcripts quantification was done using the CFX96 manager software (Bio-Rad) with the following program: 1 cycle at 98°C for 3 min and 40 cycles at 95°C for 10 s and at 58°C for 45 s. The amplification reactions were carried out with SYBR Green Supermix (Bio-Rad). Melting curve analysis was performed with 0.5°C increments every 10 s from 55 to 95°C to check that the cDNA amplification did not lead to secondary products. The primers used for qPCR are listed in Table 2. The efficiency of all primers pairs was checked in qPCR using serial dilutions of cDNA, and ranged from 90 to 100%. The level of gene transcript was calculated with ldh gene as the internal control gene for normalization [23].

Physiological characterization of the Δrgg0182 mutant

Stationary phase cells were harvested from cultures grown in CDM at 30°C by centrifugation at 4,500 rpm for 10 min. Cells were washed twice and resuspended in 10 mM sterile phosphate buffer, pH 7.0 with a final OD600nm of 1.0. Then, for heat stress, cells were treated by incubation at 52°C during 15, 30, 45 and 60 min (heat stress condition) or not (control condition). Cultures were then diluted to appropriate concentrations, spread on LM17 agar plates and incubated overnight at 42°C under anaerobic conditions. A percentage of survival was calculated as N/N0 ×100 where N0 is the CFU number of the control condition and N the CFU number after heat stress condition. Three independent experiments done in triplicate were realized.

Statistical analysis

Data are expressed as mean +/- standard deviation (SD). Statistical analysis was performed with Student's t test. A p value < 0.05 was considered statistically different.

Nucleotide sequence accession number

The DNA sequence reported in this paper has been deposited in GenBank under accession number JF699754.

Authors' contributions

Conceived and designed the experiments: RH EB BD NL. Performed the experiments: RH EB RG SB BF. Analyzed the data: RH EB RG BF NL. Wrote the paper: RH EB NL. All authors read and approved the final manuscript.

Contributor Information

Romain Henry, Email: Romain.Henry@scbiol.uhp-nancy.fr.

Emmanuelle Bruneau, Email: Emmanuelle.Bruneau@scbiol.uhp-nancy.fr.

Rozenn Gardan, Email: rozenn.gardan@jouy.inra.fr.

Stéphane Bertin, Email: stephane.bertin@scbiol.uhp-nancy.fr.

Betty Fleuchot, Email: Betty.Fleuchot@jouy.inra.fr.

Bernard Decaris, Email: decaris@nancy.inra.fr.

Nathalie Leblond-Bourget, Email: bourget@nancy.inra.fr.

Acknowledgements

This study was supported by the Institut National de la Recherche Agronomique (INRA) and the Ministère de l'Education Nationale de la Recherche et de la Technologie (MENRT). We thank N. Rouhier for his technical advices and his technical supports. We thank S. Payot-Lacroix and M. Genay-Bernard for critical reading of the manuscript.

References

  1. Kosikoski FV, Mistry VV. Volume 1: Origins and Principles. 1997. in Cheese and Fermented Milk Foods, r.e. Westport, Editor.
  2. Wouters JA, Rombouts FM, de Vos WM, Kuipers OP, Abee T. Cold shock proteins and low-temperature response of Streptococcus thermophilus CNRZ302. Appl Environ Microbiol. 1999;65(10):4436–42. doi: 10.1128/aem.65.10.4436-4442.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Perrin C, Guimont C, Bracquart P, Gaillard JL. Expression of a new cold shock protein of 21.5 kDa and of the major cold shock protein by Streptococcus thermophilus after cold shock. Curr Microbiol. 1999;39(6):342–0347. doi: 10.1007/s002849900469. [DOI] [PubMed] [Google Scholar]
  4. Varcamonti M, Arsenijevic S, Martirani L, Fusco D, Naclerio G, De Felice M. Expression of the heat shock gene clpL of Streptococcus thermophilus is induced by both heat and cold shock. Microb Cell Fact. 2006;5:6. doi: 10.1186/1475-2859-5-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Martirani L, Raniello R, Naclerio G, Ricca E, De Felice M. Identification of the DNA-binding protein, HrcA, of Streptococcus thermophilus. FEMS Microbiol Lett. 2001;198(2):177–82. doi: 10.1111/j.1574-6968.2001.tb10639.x. [DOI] [PubMed] [Google Scholar]
  6. Derre I, Rapoport G, Msadek T. CtsR, a novel regulator of stress and heat shock response, controls clp and molecular chaperone gene expression in gram-positive bacteria. Mol Microbiol. 1999;31(1):117–31. doi: 10.1046/j.1365-2958.1999.01152.x. [DOI] [PubMed] [Google Scholar]
  7. Kilstrup M, Jacobsen S, Hammer K, Vogensen FK. Induction of heat shock proteins DnaK, GroEL, and GroES by salt stress in Lactococcus lactis. Appl Environ Microbiol. 1997;63(5):1826–37. doi: 10.1128/aem.63.5.1826-1837.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Zotta T, Asterinou K, Rossano R, Ricciardi A, Varcamonti M, Parente E. Effect of inactivation of stress response regulators on the growth and survival of Streptococcus thermophilus Sfi39. Int J Food Microbiol. 2009;129(3):211–20. doi: 10.1016/j.ijfoodmicro.2008.11.024. [DOI] [PubMed] [Google Scholar]
  9. Fleuchot B, Gitton C, Guillot A, Vidic J, Nicolas P, Besset C, Fontaine L, Hols P, Leblond-Bourget N, Monnet V, Gardan R. Rgg proteins associated with internalized small hydrophobic peptides: a new quorum-sensing mechanism in streptococci. Mol Microbiol. 2011;80(4):1102–19. doi: 10.1111/j.1365-2958.2011.07633.x. [DOI] [PubMed] [Google Scholar]
  10. Neely MN, Lyon WR, Runft DL, Caparon M. Role of RopB in growth phase expression of the SpeB cysteine protease of Streptococcus pyogenes. J Bacteriol. 2003;185(17):5166–74. doi: 10.1128/JB.185.17.5166-5174.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Vickerman MM, Minick PE. Genetic analysis of the rgg-gtfG junctional region and its role in Streptococcus gordonii glucosyltransferase activity. Infect Immun. 2002;70(4):1703–14. doi: 10.1128/IAI.70.4.1703-1714.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Samen UM, Eikmanns BJ, Reinscheid DJ. The transcriptional regulator RovS controls the attachment of Streptococcus agalactiae to human epithelial cells and the expression of virulence genes. Infect Immun. 2006;74(10):5625–35. doi: 10.1128/IAI.00667-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Chaussee MS, Sylva GL, Sturdevant DE, Smoot LM, Graham MR, Watson RO, Musser JM. Rgg influences the expression of multiple regulatory loci to coregulate virulence factor expression in Streptococcus pyogenes. Infect Immun. 2002;70(2):762–70. doi: 10.1128/IAI.70.2.762-770.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Loughman JA, Caparon MG. Contribution of invariant residues to the function of Rgg family transcription regulators. J Bacteriol. 2007;189(2):650–5. doi: 10.1128/JB.01437-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Sanders JW, Leenhouts K, Burghoorn J, Brands JR, Venema G, Kok J. A chloride-inducible acid resistance mechanism in Lactococcus lactis and its regulation. Mol Microbiol. 1998;27(2):299–310. doi: 10.1046/j.1365-2958.1998.00676.x. [DOI] [PubMed] [Google Scholar]
  16. Sulavik MC, Tardif G, Clewell DB. Identification of a gene, rgg, which regulates expression of glucosyltransferase and influences the Spp phenotype of Streptococcus gordonii Challis. J Bacteriol. 1992;174(11):3577–86. doi: 10.1128/jb.174.11.3577-3586.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Chaussee MS, Watson RO, Smoot JC, Musser JM. Identification of Rgg-regulated exoproteins of Streptococcus pyogenes. Infect Immun. 2001;69(2):822–31. doi: 10.1128/IAI.69.2.822-831.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Rawlinson EL, Nes IF, Skaugen M. LasX, a transcriptional regulator of the lactocin S biosynthetic genes in Lactobacillus sakei L45, acts both as an activator and a repressor. Biochimie. 2002;84(5-6):559–67. doi: 10.1016/S0300-9084(02)01420-7. [DOI] [PubMed] [Google Scholar]
  19. Chaussee MS, Ajdic D, Ferretti JJ. The rgg gene of Streptococcus pyogenes NZ131 positively influences extracellular SPE B production. Infect Immun. 1999;67(4):1715–22. doi: 10.1128/iai.67.4.1715-1722.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lyon WR, Gibson CM, Caparon MG. A role for trigger factor and an rgg-like regulator in the transcription, secretion and processing of the cysteine proteinase of Streptococcus pyogenes. Embo J. 1998;17(21):6263–75. doi: 10.1093/emboj/17.21.6263. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Zheng F, Ji H, Cao M, Wang C, Feng Y, Li M, Pan X, Wang J, Qin Y, Hu F, Tang J. Contribution of the Rgg transcription regulator to metabolism and virulence of Streptococcus suis serotype 2. Infect Immun. 2010;79(13):1319–28. doi: 10.1128/IAI.00193-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Chaussee MS, Somerville GA, Reitzer L, Musser JM. Rgg coordinates virulence factor synthesis and metabolism in Streptococcus pyogenes. J Bacteriol. 2003;185(20):6016–24. doi: 10.1128/JB.185.20.6016-6024.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Fernandez A, Thibessard A, Borges F, Gintz B, Decaris B, Leblond-Bourget N. Characterization of oxidative stress-resistant mutants of Streptococcus thermophilus CNRZ368. Arch Microbiol. 2004;182(5):364–72. doi: 10.1007/s00203-004-0712-2. [DOI] [PubMed] [Google Scholar]
  24. Bortoni ME, Terra VS, Hinds J, Andrew PW, Yesilkaya H. The pneumococcal response to oxidative stress includes a role for Rgg. Microbiology. 2009;155(Pt 12):4123–34. doi: 10.1099/mic.0.028282-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Chaussee MA, Callegari EA, Chaussee MS. Rgg regulates growth phase-dependent expression of proteins associated with secondary metabolism and stress in Streptococcus pyogenes. J Bacteriol. 2004;186(21):7091–9. doi: 10.1128/JB.186.21.7091-7099.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Bolotin A, Quinquis B, Renault P, Sorokin A, Ehrlich SD, Kulakauskas S, Lapidus A, Goltsman E, Mazur M, Pusch GD, Fonstein M, Overbeek R, Kyprides N, Purnelle B, Prozzi D, Ngui K, Masuy D, Hancy F, Burteau S, Boutry M, Delcour J, Goffeau A, Hols P. Complete sequence and comparative genome analysis of the dairy bacterium Streptococcus thermophilus. Nat Biotechnol. 2004;22(12):1554–8. doi: 10.1038/nbt1034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Makarova K, Slesarev A, Wolf Y, Sorokin A, Mirkin B, Koonin E, Pavlov A, Pavlova N, Karamychev V, Polouchine N, Shakhova V, Grigoriev I, Lou Y, Rohksar D, Lucas S, Huang K, Goodstein DM, Hawkins T, Plengvidhya V, Welker D, Hughes J, Goh Y, Benson A, Baldwin K, Lee JH, Diaz-Muniz I, Dosti B, Smeianov V, Wechter W, Barabote R, Lorca G, Altermann E, Barrangou R, Ganesan B, Xie Y, Rawsthorne H, Tamir D, Parker C, Breidt F, Broadbent J, Hutkins R, O'Sullivan D, Steele J, Unlu G, Saier M, Klaenhammer T, Richardson P, Kozyavkin S, Weimer B, Mills D. Comparative genomics of the lactic acid bacteria. Proc Natl Acad Sci USA. 2006;103(42):15611–6. doi: 10.1073/pnas.0607117103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Sun Z, Chen X, Wang J, Zhao W, Shao Y, Wu L, Zhou Z, Sun T, Wang L, Meng H, Zhang H, Chen W. Complete Genome Sequence of Streptococcus thermophilus Strain ND03. J Bacteriol. 2011;193(3):793–4. doi: 10.1128/JB.01374-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Ibrahim M, Nicolas P, Bessieres P, Bolotin A, Monnet V, Gardan R. A genome-wide survey of short coding sequences in streptococci. Microbiology. 2007;153(Pt 11):3631–44. doi: 10.1099/mic.0.2007/006205-0. [DOI] [PubMed] [Google Scholar]
  30. Zuber U, Schumann W. CIRCE, a novel heat shock element involved in regulation of heat shock operon dnaK of Bacillus subtilis. J Bacteriol. 1994;176(5):1359–63. doi: 10.1128/jb.176.5.1359-1363.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ibrahim M, Guillot A, Wessner F, Algaron F, Besset C, Courtin P, Gardan R, Monnet V. Control of the transcription of a short gene encoding a cyclic peptide in Streptococcus thermophilus: a new quorum-sensing system? J Bacteriol. 2007;189(24):8844–54. doi: 10.1128/JB.01057-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Moliere N, Turgay K. Chaperone-protease systems in regulation and protein quality control in Bacillus subtilis. Res Microbiol. 2009;160(9):637–44. doi: 10.1016/j.resmic.2009.08.020. [DOI] [PubMed] [Google Scholar]
  33. Chastanet A, Prudhomme M, Claverys JP, Msadek T. Regulation of Streptococcus pneumoniae clp genes and their role in competence development and stress survival. J Bacteriol. 2001;183(24):7295–307. doi: 10.1128/JB.183.24.7295-7307.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Terzaghi BE, Sandine WE. Improved medium for lactic streptococci and their bacteriophages. Appl Microbiol. 1975;29(6):807–13. doi: 10.1128/am.29.6.807-813.1975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Letort C, Juillard V. Development of a minimal chemically-defined medium for the exponential growth of Streptococcus thermophilus. J Appl Microbiol. 2001;91(6):1023–9. doi: 10.1046/j.1365-2672.2001.01469.x. [DOI] [PubMed] [Google Scholar]
  36. Maguin E, Duwat P, Hege T, Ehrlich D, Gruss A. New thermosensitive plasmid for gram-positive bacteria. J Bacteriol. 1992;174(17):5633–8. doi: 10.1128/jb.174.17.5633-5638.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 1989.
  38. Leenhouts K. Integration strategies and vectors. Dev Biol Stand. 1995;85:523–30. [PubMed] [Google Scholar]
  39. Miroux B, Walker JE. Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels. J Mol Biol. 1996;260(3):289–98. doi: 10.1006/jmbi.1996.0399. [DOI] [PubMed] [Google Scholar]
  40. Layec S, Gerard J, Legue V, Chapot-Chartier MP, Courtin P, Borges F, Decaris B, Leblond-Bourget N. The CHAP domain of Cse functions as an endopeptidase that acts at mature septa to promote Streptococcus thermophilus cell separation. Mol Microbiol. 2009;71(5):1205–17. doi: 10.1111/j.1365-2958.2009.06595.x. [DOI] [PubMed] [Google Scholar]
  41. Kieser T, Bibb M, Buttner M, Chater K, Hopwood D. In: Practical Streptomyces Genetics. John Innes Foundation, editor. 1999. [Google Scholar]

Articles from BMC Microbiology are provided here courtesy of BMC

RESOURCES