Skip to main content
NCBI home page
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1982 Mar 11;10(5):1625–1633. doi: 10.1093/nar/10.5.1625

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.

F Sor, H Fukuhara
PMCID: PMC320554  PMID: 6280154

Abstract

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.

Full text

PDF
1625

Images in this article

1628Image
on p.1628
1629Image
on p.1629

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Baldacci G., de Zamaroczy M., Bernardi G. Excision sites in the GC clusters of the mitochondrial genome of yeast. FEBS Lett. 1980 Jun 2;114(2):234–236. doi: 10.1016/0014-5793(80)81122-7. [DOI] [PubMed] [Google Scholar]
  2. Berk A. J., Sharp P. A. Sizing and mapping of early adenovirus mRNAs by gel electrophoresis of S1 endonuclease-digested hybrids. Cell. 1977 Nov;12(3):721–732. doi: 10.1016/0092-8674(77)90272-0. [DOI] [PubMed] [Google Scholar]
  3. Berlani R. E., Bonitz S. G., Coruzzi G., Nobrega M., Tzagoloff A. Transfer RNA genes in the cap-oxil region of yeast mitochondrial DNA. Nucleic Acids Res. 1980 Nov 11;8(21):5017–5030. doi: 10.1093/nar/8.21.5017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bolotin-Fukuhara M. Mitochondrial and nuclear mutations that affect the biogenesis of the mitochondrial ribosomes of yeast. I. Genetics. Mol Gen Genet. 1979;177(1):39–46. doi: 10.1007/BF00267251. [DOI] [PubMed] [Google Scholar]
  5. Boltin-Fukuhara M., Fukuhara H. Modified recombination and transmission of mitochondrial genetic markers in rho minus mutants of Saccharomyces cerevisiae. Proc Natl Acad Sci U S A. 1976 Dec;73(12):4608–4612. doi: 10.1073/pnas.73.12.4608. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Borst P., Grivell L. A. One gene's intron is another gene's exon. Nature. 1981 Feb 5;289(5797):439–440. doi: 10.1038/289439a0. [DOI] [PubMed] [Google Scholar]
  7. Bos J. L., Heyting C., Borst P., Arnberg A. C., Van Bruggen E. F. An insert in the single gene for the large ribosomal RNA in yeast mitochondrial DNA. Nature. 1978 Sep 28;275(5678):336–338. doi: 10.1038/275336a0. [DOI] [PubMed] [Google Scholar]
  8. Brosius J., Dull T. J., Noller H. F. Complete nucleotide sequence of a 23S ribosomal RNA gene from Escherichia coli. Proc Natl Acad Sci U S A. 1980 Jan;77(1):201–204. doi: 10.1073/pnas.77.1.201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Carbon P., Ehresmann C., Ehresmann B., Ebel J. P. The complete nucleotide sequence of the ribosomal 16-S RNA from Excherichia coli. Experimental details and cistron heterogeneities. Eur J Biochem. 1979 Oct 15;100(2):399–410. doi: 10.1111/j.1432-1033.1979.tb04183.x. [DOI] [PubMed] [Google Scholar]
  10. Cosson J., Tzagoloff A. Sequence homologies of (guanosine + cytidine)-rich regions of mitochondrial DNA of Saccharomyces cerevisiae. J Biol Chem. 1979 Jan 10;254(1):42–43. [PubMed] [Google Scholar]
  11. Dujon B. Sequence of the intron and flanking exons of the mitochondrial 21S rRNA gene of yeast strains having different alleles at the omega and rib-1 loci. Cell. 1980 May;20(1):185–197. doi: 10.1016/0092-8674(80)90246-9. [DOI] [PubMed] [Google Scholar]
  12. Faye G., Dennebouy N., Kujawa C., Jacq C. Inserted sequence in the mitochondrial 23S ribosomal RNA gene of the yeast Saccharomyces cerevisiae. Mol Gen Genet. 1979 Jan 5;168(1):101–109. doi: 10.1007/BF00267939. [DOI] [PubMed] [Google Scholar]
  13. Faye G., Kujawa C., Fukuhara H. Physical and genetic organization of petite and grande yeast mitochondrial DNA. IV. In vivo transcription products of mitochondrial DNA and localization of 23 S ribosomal RNA in petite mutants of saccharomyces cerevisiae. J Mol Biol. 1974 Sep 5;88(1):185–203. doi: 10.1016/0022-2836(74)90304-0. [DOI] [PubMed] [Google Scholar]
  14. Macino G., Tzagoloff A. Assembly of the mitochondrial membrane system. The DNA sequence of a mitochondrial ATPase gene in Saccharomyces cerevisiae. J Biol Chem. 1979 Jun 10;254(11):4617–4623. [PubMed] [Google Scholar]
  15. Maxam A. M., Gilbert W. Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol. 1980;65(1):499–560. doi: 10.1016/s0076-6879(80)65059-9. [DOI] [PubMed] [Google Scholar]
  16. Morimoto R., Lewin A., Hsu H. J., Rabinowitz M., Fukuhara H. Restriction endonuclease analysis of mitochondrial DNA from grande and genetically characterized cytoplasmic petite clones of Saccharomyces cerevisiae. Proc Natl Acad Sci U S A. 1975 Oct;72(10):3868–3872. doi: 10.1073/pnas.72.10.3868. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Morimoto R., Lewin A., Rabinowitz M. Restriction cleavage map of mitochonrial DNA from the yeast Saccharomyces cerevisiae. Nucleic Acids Res. 1977 Jul;4(7):2331–2351. doi: 10.1093/nar/4.7.2331. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Nobrega F. G., Tzagoloff A. Assembly of the mitochondrial membrane system. DNA sequence and organization of the cytochrome b gene in Saccharomyces cerevisiae D273-10B. J Biol Chem. 1980 Oct 25;255(20):9828–9837. [PubMed] [Google Scholar]
  19. Osinga K. A., Evers R. F., Van der Laan J. C., Tabak H. F. A putative precursor for the small ribosomal RNA from mitochondria of Saccharomyces cerevisiae. Nucleic Acids Res. 1981 Mar 25;9(6):1351–1364. doi: 10.1093/nar/9.6.1351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Prunell A., Bernardi G. The mitochondrial genome of wild-type yeast cells. VI. Genome organization. J Mol Biol. 1977 Feb 15;110(1):53–74. doi: 10.1016/s0022-2836(77)80098-3. [DOI] [PubMed] [Google Scholar]
  21. Sor F., Faye G. Mitochondrial and nuclear mutations that affect the biogenesis of the mitochondrial ribosomes of yeast. II. Biochemistry. Mol Gen Genet. 1979;177(1):47–56. doi: 10.1007/BF00267252. [DOI] [PubMed] [Google Scholar]
  22. Sor F., Fukuhara H. Séquence nucléotidique du gène de l'ARN ribosomique 15S mitochondrial de la levure. C R Seances Acad Sci D. 1980 Dec 8;291(12):933–936. [PubMed] [Google Scholar]
  23. Southern E. M. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol. 1975 Nov 5;98(3):503–517. doi: 10.1016/s0022-2836(75)80083-0. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES