Abstract
The 4.5S rRNA was isolated from the chloroplast ribosomes from Dryopteris acuminata. The complete nucleotide sequence was determined to be: OHUAAGGUCACGGCAAGACGAGCCGUUUAUCACCACGAUAGGUGCUAAGUGGAGGUGCAGUAAUGUAUGCAGCUGAGGC AUCCUAAUAGACCGAGAGGUUUGAACOH. The 4.5S rRNA is composed of 103 nucleotides and shows strong homology with those from flowering plants.
Full text
PDF
Images in this article
Selected References
These references are in PubMed. This may not be the complete list of references from this article.
- Bowman C. M., Dyer T. A. 4.5S ribonucleic acid, a novel ribosome component in the chloroplasts of flowering plants. Biochem J. 1979 Dec 1;183(3):605–613. doi: 10.1042/bj1830605. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Donis-Keller H., Maxam A. M., Gilbert W. Mapping adenines, guanines, and pyrimidines in RNA. Nucleic Acids Res. 1977 Aug;4(8):2527–2538. doi: 10.1093/nar/4.8.2527. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gray P. W., Hallick R. B. Isolation of Euglena gracilis chloroplast 5S ribosomal RNA and mapping the 5S rRNA gene on chloroplast DNA. Biochemistry. 1979 May 1;18(9):1820–1825. doi: 10.1021/bi00576a029. [DOI] [PubMed] [Google Scholar]
- Hartley M. R. The synthesis and origin of chloroplast low-molecular-weight ribosomal ribonucleic acid in spinach. Eur J Biochem. 1979 May 15;96(2):311–320. doi: 10.1111/j.1432-1033.1979.tb13042.x. [DOI] [PubMed] [Google Scholar]
- Machatt M. A., Ebel J. P., Branlant C. The 3'-terminal region of bacterial 23S ribosomal RNA: structure and homology with the 3'-terminal region of eukaryotic 28S rRNA and with chloroplast 4.5s rRNA. Nucleic Acids Res. 1981 Apr 10;9(7):1533–1549. doi: 10.1093/nar/9.7.1533. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peattie D. A. Direct chemical method for sequencing RNA. Proc Natl Acad Sci U S A. 1979 Apr;76(4):1760–1764. doi: 10.1073/pnas.76.4.1760. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Rochaix J. D., Malnoe P. Anatomy of the chloroplast ribosomal DNA of Chlamydomonas reinhardii. Cell. 1978 Oct;15(2):661–670. doi: 10.1016/0092-8674(78)90034-x. [DOI] [PubMed] [Google Scholar]
- Simoncsits A., Brownlee G. G., Brown R. S., Rubin J. R., Guilley H. New rapid gel sequencing method for RNA. Nature. 1977 Oct 27;269(5631):833–836. doi: 10.1038/269833a0. [DOI] [PubMed] [Google Scholar]
- Sugiura M., Suzuki M., Ohtsuka E., Nishikawa S., Uemura H., Ikehara M. Purification of T4 RNA ligase by 2', 5'-ADP sepharose chromatography. FEBS Lett. 1979 Jan 1;97(1):73–76. doi: 10.1016/0014-5793(79)80055-1. [DOI] [PubMed] [Google Scholar]
- Sugiura M., Takanami M. Analysis of the 5'-terminal nucleotide sequences of ribonucleic acids. II. Comparison of the 5'-terminal nucleotide sequences of ribosomal RNA's from different organisms. Proc Natl Acad Sci U S A. 1967 Oct;58(4):1595–1602. doi: 10.1073/pnas.58.4.1595. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Takaiwa F., Sugiura M. Cloning and characterization of 4.5S and 5S RNA genes in tobacco chloroplasts. Gene. 1980 Jul;10(2):95–103. doi: 10.1016/0378-1119(80)90127-4. [DOI] [PubMed] [Google Scholar]
- Takaiwa F., Sugiura M. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts. Nucleic Acids Res. 1980 Sep 25;8(18):4125–4129. doi: 10.1093/nar/8.18.4125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Whitfeld P. R., Leaver C. J., Bottomley W., Atchison B. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes. Biochem J. 1978 Dec 1;175(3):1103–1112. doi: 10.1042/bj1751103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wildeman A. G., Nazar R. N. Nucleotide sequence of wheat chloroplastid 4.5 S ribonucleic acid. Sequence homologies in 4.5 S RNA species. J Biol Chem. 1980 Dec 25;255(24):11896–11900. [PubMed] [Google Scholar]