Skip to main content
NCBI home page
Nucleic Acids Research logoLink to Nucleic Acids Research
. 1982 Sep 11;10(17):5369–5373. doi: 10.1093/nar/10.17.5369

The nucleotide sequence of chloroplast 5S ribosomal RNA from a fern, Dryopteris acuminata.

F Takaiwa, M Sugiura
PMCID: PMC320878  PMID: 6815619

Abstract

Dryopteris acuminata chloroplasts were found to contain three species of 5S rRNAs with different electrophoretic mobility. The large 5S rRNA species is composed of 122 nucleotides and its sequence is: pUAUUCUGGUGUCCCAGGCGUAGAGGAACCACAC-CGAUCCAUCUCGAACUUGGUGGUGAAACUCUGCCGCGGUAACCA AUACUCGGGGGGGGCCCU-GCGGAAAAAUAGCUCGAUGCCAGGAUAOH. This 5S rRNA shows high sequence homology with those from chloroplasts of flowering plants and from a blue-green alga, Anacystis nidulans.

Full text

PDF
5369

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Corry M. J., Payne P. I., Dyer T. A. The nucleotide sequence of 5 S rRNA from the blue-green alga Anacystis nidulans. FEBS Lett. 1974 Sep 15;46(1):63–66. doi: 10.1016/0014-5793(74)80335-2. [DOI] [PubMed] [Google Scholar]
  2. Delihas N., Andersen J., Sprouse H. M., Dudock B. The nucleotide sequence of the chloroplast 5S ribosomal RNA from spinach. Nucleic Acids Res. 1981 Jun 25;9(12):2801–2805. doi: 10.1093/nar/9.12.2801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Donis-Keller H., Maxam A. M., Gilbert W. Mapping adenines, guanines, and pyrimidines in RNA. Nucleic Acids Res. 1977 Aug;4(8):2527–2538. doi: 10.1093/nar/4.8.2527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Dyer T. A., Bowman C. M. Nucleotide sequences of chloroplast 5S ribosomal ribonucleic acid in flowering plants. Biochem J. 1979 Dec 1;183(3):595–604. doi: 10.1042/bj1830595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Hori H., Osawa S. Evolutionary change in 5S RNA secondary structure and a phylogenic tree of 54 5S RNA species. Proc Natl Acad Sci U S A. 1979 Jan;76(1):381–385. doi: 10.1073/pnas.76.1.381. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Kimura M., Ohta T. Eukaryotes-prokaryotes divergence estimated by 5S ribosomal RNA sequences. Nat New Biol. 1973 Jun 13;243(128):199–200. doi: 10.1038/newbio243199a0. [DOI] [PubMed] [Google Scholar]
  7. Peattie D. A. Direct chemical method for sequencing RNA. Proc Natl Acad Sci U S A. 1979 Apr;76(4):1760–1764. doi: 10.1073/pnas.76.4.1760. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Simoncsits A., Brownlee G. G., Brown R. S., Rubin J. R., Guilley H. New rapid gel sequencing method for RNA. Nature. 1977 Oct 27;269(5631):833–836. doi: 10.1038/269833a0. [DOI] [PubMed] [Google Scholar]
  9. Sugiura M., Suzuki M., Ohtsuka E., Nishikawa S., Uemura H., Ikehara M. Purification of T4 RNA ligase by 2', 5'-ADP sepharose chromatography. FEBS Lett. 1979 Jan 1;97(1):73–76. doi: 10.1016/0014-5793(79)80055-1. [DOI] [PubMed] [Google Scholar]
  10. Sugiura M., Takanami M. Analysis of the 5'-terminal nucleotide sequences of ribonucleic acids. II. Comparison of the 5'-terminal nucleotide sequences of ribosomal RNA's from different organisms. Proc Natl Acad Sci U S A. 1967 Oct;58(4):1595–1602. doi: 10.1073/pnas.58.4.1595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Takaiwa F., Kusuda M., Sugiura M. The nucleotide sequence of chloroplast 4.5S rRNA from a fern, Dryopteris acuminata. Nucleic Acids Res. 1982 Apr 10;10(7):2257–2260. doi: 10.1093/nar/10.7.2257. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Takaiwa F., Sugiura M. Cloning and characterization of 4.5S and 5S RNA genes in tobacco chloroplasts. Gene. 1980 Jul;10(2):95–103. doi: 10.1016/0378-1119(80)90127-4. [DOI] [PubMed] [Google Scholar]

Articles from Nucleic Acids Research are provided here courtesy of Oxford University Press

RESOURCES