Abstract
The etiology, clinical manifestations, and treatment of 19 sporadic cases of Buruli ulcer (BU) in Japan are described. The cases originated in different regions of Honshu Island, with no evidence of patient contact with an aquatic environment. The majority (73.7%) of cases occurred in females, with an average age of 39.1 years for females and 56.8 years for males. All patients developed ulcers on exposed areas of the skin (e.g., face, extremities). Most ulcers were <5 cm in diameter (category I), except in one severe progressive case (category II). Pain was absent in 10 of the 19 cases. Fourteen ulcers were surgically excised, and nine patients needed skin grafting. All cases were treated with various antibiotic regimens, with no reported recurrences as of March 2011. Mycobacterium ulcerans-specific IS2404 was detected in all cases. Ten isolates had identical 16S rRNA gene sequences, which were similar to those of M. ulcerans. However, the rpoB gene showed a closer resemblance to Mycobacterium marinum or Mycobacterium pseudoshottsii. PCR identified pMUM001 in all isolates but failed to detect one marker. DNA-DNA hybridization misidentified all isolates as M. marinum. The drug susceptibility profile of the isolates also differed from that of M. ulcerans. Sequence analysis revealed “Mycobacterium ulcerans subsp. shinshuense” as the etiologic agent of BU in Japan. Clinical manifestations were comparable to those of M. ulcerans but differed as follows: (i) cases were not concentrated in a particular area; (ii) there was no suspected connection to an aquatic environment; (iii) drug susceptibility was different; and (iv) bacteriological features were different.
INTRODUCTION
Buruli ulcer (BU) was first reported in 1935 as a series of unusual painless ulcers in a patient from southeast Australia (2). Thirteen years after the first report, the etiological agent of the ulcer was determined to be Mycobacterium ulcerans, a previously unknown mycobacterium (5, 14). During the 1960s, many M. ulcerans infections were reported in Uganda, especially in Buruli County, for which this disease was eventually named (3, 32). It is a necrotizing disease of the skin that mostly affects children, producing massive ulcers and permanent, disabling scars. At present, the disease is found primarily in West and Central Africa and in humid tropical areas: BU has been reported in 32 countries, and M. ulcerans infection is the third most common mycobacterial infection, after tuberculosis and leprosy. Treatment of progressive cases is difficult and generally requires surgery, usually accompanied by skin grafting and prolonged courses of antibiotics (21, 34).
The first reported case of BU in Japan occurred in 1980 in a 19-year-old woman who had never been abroad (15). The causative agent was isolated and classified as “Mycobacterium ulcerans subsp. shinshuense” because it was closely related to M. ulcerans (31). The disease was not seen again until a 37-year-old woman was affected in 2003 (10). The number of cases increased gradually, until 19 cases had been detected by December 2010 (K. Nakanaga, Y. Hoshino, and N. Ishii, presented at the WHO Annual Meeting on Buruli Ulcer, Geneva, Switzerland, 22 to 24 March 2010). We conducted a comprehensive study using these 19 clinical samples and/or isolated bacteria. Etiology, differential diagnosis, clinical manifestations, and treatments are discussed in this report.
(The preliminary results of this study were presented by K.N. and R. R. Y. in the WHO Annual Meeting on Buruli Ulcer, Geneva, Switzerland, 28 to 30 March 2011.)
MATERIALS AND METHODS
Patients.
The research protocol was approved by the institutional review board of the National Institute of Infectious Diseases, Japan. The BU diagnostic criteria were established prior to this study. The primary characteristic was the presence of a clinical lesion, which usually started as a painless subcutaneous nodule, and which secondarily ulcerated with characteristic undermined edges. Other preulcerative forms consisted of papules affecting only the skin, plaques (large, firm, painless, and raised lesions), and edema (a severe form of the disease). Apart from the clinical lesions, at least one of the following criteria must be included for a diagnosis of BU: (i) detection of acid-fast bacilli in a smear from a swab or a biopsy specimen after Ziehl-Neelsen staining, (ii) growth on 7H11 or Ogawa medium, (iii) histopathological confirmation, or (iv) PCR amplification of IS2404, an M. ulcerans-specific repetitive element. This article is a summary of all BU cases diagnosed to date in Japan. Some have already been published elsewhere as case reports in Japanese and/or English (6, 7, 10, 12, 16, 28, 35).
PCR, sequencing, and phylogenetic analyses.
All PCRs targeting IS2404 (18) were performed on extracted DNA from one or more of the following: fresh skin biopsy specimens, a thin section of formalin-fixed, paraffin-embedded skin, and bacteria isolated from a skin lesion. Briefly, the PCR product, amplified using forward primer PU4F and reverse primer PU7Rbio (Table 1), was electrophoresed on a 2% agarose gel and was stained with ethidium bromide.
Table 1.
Primer sequences
| Primer | Sequence (5′–3′) | PCR target (fragment size [bp]) | Reference |
|---|---|---|---|
| PU4F | GCGCAGATCAACTTCGCGGT | IS2404 (154) | 18 |
| PU7Rbio | GCCCGATTGGTGCTCGGTCA | ||
| 8F16S | AGAGTTTGATCCTGGCTCAG | 16S rRNA gene (1,515 or 1,518) | 24 |
| 1047R16S | TGCACACAGGCCACAAGGGA | ||
| 830F16S | GTGTGGGTTTCCTTCCTTGG | ||
| 1542R16S | AAGGAGGTGATCCAGCCGCA | ||
| ITSF | TTGTACACACCGCCCGTC | 16S–23S ITS region (ca. 340) | 23 |
| ITSR | TCTCGATGCCAAGGCATCCACC | ||
| MF | CGACCACTTCGGCAACCG | rpoB (341) | 11 |
| MR | TCGATCGGGCACATCCGG | ||
| TB11 | ACCAACGATGGTGTGTCCAT | hsp65 (441) | 30 |
| TB12 | CTTGTCGAACCGCATACCCT | ||
| RepAF | CTACGAGCTGGTCAGCAATG | repA in pMUM001 (413) | 26 |
| RepAR | ATCGACGCTCGCTACTTCTG | ||
| ParAF | GCAAGCTGGGCAATGTTTAT | parA in pMUM001 (501) | 26 |
| ParAR | GTCCGGTCCTTGATAGGTCA | ||
| MUP11F | ACCACCCAAGAGTGGAACTG | Serine/threonine protein kinase in pMUM001 (479) | 26 |
| MUP11R | TGTCGTGTCGAGGTATGTGG | ||
| MLSloadF | GGGCAATCGTCCTCACTG | mls load in pMUM001 (560) | 26 |
| MLSloadR | CAAGGGCAGTCTTGATTAGG | ||
| MLSAT(II)F | AACGTTGAATCCCGTTTTTG | mlsAT(II) in pMUM001 (504) | 26 |
| MLSAT(II)R | GCACCACAAAGGAACGTCTAA | ||
| TEIIF | ATTCAAACGGATGCGAACTG | Type II thioesterase in pMUM001 (500) | 26 |
| TEIIR | ACATTGCTGGACAAACGACA | ||
| MUP045F | CAGCAAGTAACGGTGGAACA | Type III ketosynthase in pMUM001 (496) | 26 |
| MUP045R | ACGTGGCCCATTTGTCTTAG | ||
| P450F | CCCACCTCGTCGTTAGTCAT | P450 in pMUM001 (500) | 26 |
| P450R | GTGCTCGGTGATCCAGAAGT |
The sequences of the internal transcribed spacer between the 16S and 23S rRNA genes (ITS region) and of the 16S rRNA, rpoB, and hsp65 genes were analyzed with the primers listed in Table 1. Amplified PCR products (sizes shown in Table 1) were directly sequenced using the ABI Prism 310 PCR genetic analyzer (Applied Biosystems, Foster City, CA) (16). Sequences were obtained for 1,475- or 1,478-bp (16S rRNA gene), 272-bp (ITS region), 315-bp (rpoB), and 401-bp (hsp65) fragments. Ten clinical isolates were compared to six reference strains: M. ulcerans ITM 98-912, M. ulcerans ATCC 19423T, M. ulcerans Agy99 (25), Mycobacterium marinum ATCC 927T, M. marinum clinical isolate LRC 112509, and Mycobacterium pseudoshottsii JCM 15466T. A similarity search was also performed with other mycobacterial reference strains and the 10 clinical strains using the DNA Data Bank of Japan (DDBJ) (8). Phylogenetic analyses were performed using the MEGA software package, version 4.0.2 (build 4028) (29). A tree was constructed using the neighbor-joining method with Kimura's two-parameter distance correction model with 1,000 bootstrap replications.
Finally, primers for eight pMUM001 sequences that encode toxic lipid mycolactone-producing enzymes (26) were used to compare the PCR products of the 10 clinical isolates, M. ulcerans ITM 98-912, M. ulcerans ATCC 19423T, M. ulcerans Agy99, and M. pseudoshottsii JCM 15466T.
DNA-DNA hybridization assay.
A commercially available DNA-DNA hybridization method (DDH Mycobacteria kit; Kyokuto Pharmaceutical Industrial, Tokyo, Japan) was used to identify mycobacterial species isolated from patients (13). The 18 strains in the Mycobacterium reference panel included M. marinum but not M. ulcerans, M. ulcerans subsp. shinshuense, or M. pseudoshottsii.
Growth characteristics and biochemical assay.
Culture growth characteristics were determined, and identification was performed, as described previously (16) for 10 of the 11 mycobacterial isolates recovered from patients.
Assay for susceptibility to antimycobacterial drugs.
The susceptibilities of the clinical isolates to antibiotics in vitro were determined by microdilution (33) using the BrothMIC NTM kit (Kyokuto Pharmaceutical Industrial Co. Ltd., Tokyo, Japan), with modification of the incubation temperature (32°C) and period (2 to 3 weeks). MIC testing was performed in triplicate on different days, with two of three matching MICs used as the criterion for MIC determination.
Nucleotide sequence accession numbers.
The DNA sequences of the 16S rRNA (1,475-bp), hsp65 (401-bp), rpoB (315-bp), and ITS (272-bp) fragments from the reference strains (M. ulcerans ITM 98-912, M. ulcerans ATCC 19423T, M. ulcerans Agy99, M. marinum ATCC 927T, M. marinum clinical isolate LRC 112509, and M. pseudoshottsii JCM 15466T) and 10 clinical isolates have been deposited in the International Nucleotide Sequence Database (INSD) through the DDBJ under accession numbers AB548711 to AB548734 and AB624260 to AB624295.
RESULTS
Epidemiology.
Nineteen BU cases from Japan have been reported to the WHO BU committee as of December 2010. Many of the M. ulcerans-related reports of BU have originated in tropical wetlands. However, Japan is located in eastern Asia, and the majority of the country is covered by mountainous terrain. The 19 cases were distributed between latitudes 34°N and 38°N, in a typical temperate region of Japan.
There was no geographic focal point in the distribution of the BU cases. However, all of the patients lived on Honshu, the largest island of Japan. Seven cases were found in the Chugoku region (western Honshu), 6 in the Chubu region (central Honshu), 4 in the Kinki region (between Chugoku and Chubu), 1 in the Tohoku region (northern Honshu), and 1 in the Kanto region (eastern Honshu) (Fig. 1).
Fig. 1.
Distribution of BU patients in Japan. Most of the patients lived in a typical temperate region, and all lived on the island of Honshu. The two plus signs on the map indicate 38°N, 140°E, and 31°N, 130°60′E, placing most of the island in the temperate zone.
Fourteen (73.7%) subjects were female, and 5 (26.3%) were male. The average age was 39.1 years (range, 8 to 70 years) for the females and 56.8 years (range, 11 to 81 years) for the males (Fig. 2). Despite careful and precise patient interviews, none of the cases could be linked to an aquatic environment.
Fig. 2.
Ages and genders of BU patients in Japan.
The affected areas were on exposed sites, such as arms (8 cases), legs (8 cases), the right auricle of the ear (1 case), the right cheek (1 case), and both arms and legs (1 case). While skin ulcer lesions were present in all cases, most were smaller than 5 cm in diameter and were classified as category I (Fig. 3A) (36). In one severe case, the patient presented with a progressive ulcer larger than 10 cm in diameter on the extensor surface of the right elbow, which fell into category II (Fig. 3B). Nine patients (47%) experienced pain, although in many reported cases, BU is painless or only slightly painful (Fig. 4).
Fig. 3.
(A) Buruli ulcer case 8: a category I ulcer on the right forearm. (B) Buruli ulcer case 3: a category II ulcer on the right elbow extensor surface.
Fig. 4.
Localization, pain, and surgical treatment of ulcer lesions by age and gender.
Genotypic analysis.
PCR screening to detect IS2404 gave a positive result for at least one of three sample types in all 19 cases. We should note that fresh tissue samples were the source of the template for 13 cases, while formalin-fixed, paraffin-embedded specimens were also used for 9 cases, and all were positive (Table 2). Mycobacteria were successfully isolated in 11 of the 19 cases; however, further bacteriological tests, including genotypic analysis, were performed on 10 available isolates.
Table 2.
IS2404 detection in 19 cases of BU in Japan
| Case no. | Yr of diagnosis | Origin (region) | Sample type |
Isolation periodc | ||
|---|---|---|---|---|---|---|
| Tissue samplea | Paraffin sectionb | Isolate | ||||
| 1 | 1980 | Chubu | NT | NT | P | 4 wk |
| 2 | 2004 | Chubu | NT | NT | P | S |
| 3 | 2006 | Chugoku | P | P | P | 11 wk |
| 4 | 2005 | Kinki | NT | NT | P | 6 wk |
| 5 | 2007 | Chubu | P | P | P | 8 wk |
| 6 | 2007 | Chubu | NT | NT | P | S |
| 7 | 2007 | Kinki | NT | NT | P | S |
| 8 | 2008 | Chubu | P | NT | P | 11 mo |
| 9 | 2008 | Chugoku | P | NT | NT | NT |
| 10 | 2009 | Chugoku | P | NT | NT | NT |
| 11 | 2009 | Chugoku | P | P | NT | NT |
| 12 | 2009 | Chugoku | P | P | NT | NT |
| 13 | 2009 | Chugoku | NT | P | P | 12 wk |
| 14 | 2009 | Tohoku | P | NT | NT | NT |
| 15 | 2010 | Kinki | P | NT | NT | 6 wk |
| 16 | 2010 | Kanto | P | P | NT | NT |
| 17 | 2010 | Chubu | P | P | P | 5 wk |
| 18 | 2010 | Kinki | P | P | NT | NT |
| 19 | 2010 | Chugoku | P | P | NT | NT |
Frozen or fresh skin biopsy sample. NT, not tested; P, positive.
Sliced from a formalin-fixed, paraffin-embedded skin biopsy sample.
S, isolation was successful, but the incubation period was uncertain.
The 16S rRNA gene sequences (1,475 bp) of these isolates were identical to each other but partially different from those of M. ulcerans, M. marinum, and M. pseudoshottsii (Table 3). The hsp65 (401-bp), rpoB (315-bp), and internal transcribed spacer (ITS) (272-bp) sequences were also identical among isolates. Sequence analysis identified M. ulcerans subsp. shinshuense as the bacterium in the clinical samples. Phylogenetic trees based on 16S rRNA and hsp65 gene sequences showed a close relationship between M. ulcerans subsp. shinshuense and M. ulcerans (Fig. 5A and B). A phylogenetic analysis of the 16S–23S intergenic spacer region showed no differences between M. ulcerans subsp. shinshuense, M. marinum, and M. ulcerans and found that M. pseudoshottsii is a close relative (Fig. 5C). In contrast, the tree based on the rpoB gene showed a closer relationship of M. ulcerans subsp. shinshuense to M. marinum and M. pseudoshottsii than to M. ulcerans, supporting the premise that M. ulcerans subsp. shinshuense is distinct from M. ulcerans (Fig. 5D).
Table 3.
Comparison of 16S rRNA gene sequences of 10 M. ulcerans subsp. shinshuense isolates and related mycobacterial strains
| Strain | Country | Nucleotide(s) at the following Escherichia coli 16S rRNA gene sequence position(s): |
||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 95 | 487–488 | 492 | 969 | 1007 | 1215 | 1247 | 1288 | 1449–1451a | ||
| M. ulcerans subsp. shinshuense | ||||||||||
| ATCC 33728 | Japan | T | GG | G | A | G | T | G | G | ACCC---TTTG |
| JATA753 | Japan | T | GG | G | A | G | T | G | G | ACCC---TTTG |
| 0401 | Japan | T | GG | G | A | G | T | G | G | ACCC---TTTG |
| 0501 | Japan | T | GG | G | A | G | T | G | G | ACCC---TTTG |
| 0701 | Japan | T | GG | G | A | G | T | G | G | ACCC---TTTG |
| 0702 | Japan | T | GG | G | A | G | T | G | G | ACCC---TTTG |
| 0703 | Japan | T | GG | G | A | G | T | G | G | ACCC---TTTG |
| 0801 | Japan | T | GG | G | A | G | T | G | G | ACCC---TTTG |
| 0901 | Japan | T | GG | G | A | G | T | G | G | ACCC---TTTG |
| 1001 | Japan | T | GG | G | A | G | T | G | G | ACCC---TTTG |
| M. ulcerans | ||||||||||
| ITM 98-912 | China | T | GG | G | A | G | T | G | G | ACCC---TTTG |
| ATCC 19423T | Australia | T | GG | A | A | G | T | G | C | ACCC---TTTG |
| Agy99 | Ghana | T | GG | A | A | G | T | G | C | ACCCTTTTTTG |
| M. marinum | ||||||||||
| ATCC 927T | United States | T | GG | A | A | G | T | A | A | ACCC---TTTG |
| 112509 | Japan | T | GG | A | A | G | T | A | A | ACCC---TTTG |
| M. pseudoshottsii JCM 15466T | United States | C | GA | A | G | T | C | A | A | ACCC---TTTG |
Hyphens indicate gaps.
Fig. 5.
Phylogenetic analyses of M. ulcerans subsp. shinshuense based on the 16S rRNA gene (A), the hsp65 gene (B), the 16S–23S intergenic spacer region (C), and the rpoB gene (D).
Next, amplification of eight pMUM001-associated genes was used to determine whether these isolates had genes that encode toxic lipid mycolactone-producing enzymes. All isolates showed positive results, but as previously reported, the band representing the serine/threonine protein kinase (STPK) gene was absent in M. ulcerans subsp. shinshuense strains (16). However, this phenomenon was also observed with one strain of M. ulcerans, ITM 98-912, that was isolated in China (4). All eight bands were detected in the M. ulcerans strains isolated from Australia and Ghana. M. pseudoshottsii lacked the band representing P450, but the other seven bands were successfully amplified (Table 4).
Table 4.
PCR detection of eight pMUM001-associated genes in 10 M. ulcerans subsp. shinshuense isolates and related mycobacterial strains
| Strain | Country | Presence or absence of the following pMUM001 marker genea: |
|||||||
|---|---|---|---|---|---|---|---|---|---|
| repA | parA | STPK | mls (load) | mlsAT(II) | TEII | KSIII | P450 | ||
| M. ulcerans subsp. shinshuense | |||||||||
| ATCC 33728 | Japan | + | + | − | + | + | + | + | + |
| JATA753 | Japan | + | + | − | + | + | + | + | + |
| 0401 | Japan | + | + | − | + | + | + | + | + |
| 0501 | Japan | + | + | − | + | + | + | + | + |
| 0701 | Japan | + | + | − | + | + | + | + | + |
| 0702 | Japan | + | + | − | + | + | + | + | + |
| 0703 | Japan | + | + | − | + | + | + | + | + |
| 0801 | Japan | + | + | − | + | + | + | + | + |
| 0901 | Japan | + | + | − | + | + | + | + | + |
| 1001 | Japan | + | + | − | + | + | + | + | + |
| M. ulcerans | |||||||||
| ITM 98-912 | China | + | + | − | + | + | + | + | + |
| ATCC 19423T | Australia | + | + | + | + | + | + | + | + |
| Agy99 | Ghana | + | + | + | + | + | + | + | + |
| M. pseudoshottsii JCM 15466T | United States | + | + | + | + | + | + | + | − |
+, present; −, absent. STPK, serine/threonine protein kinase; TEII, type II thioesterase; KSIII, type III ketosynthase.
A commercially available DNA-DNA hybridization assay was used to verify species identity. The kit contained a reference panel of 18 mycobacterial strains that included M. marinum but not M. ulcerans, M. ulcerans subsp. shinshuense, or M. pseudoshottsii. All 10 isolates showed clear positive signals for M. marinum (Table 5, rightmost column).
Table 5.
Bacteriological characteristics of 10 M. ulcerans subsp. shinshuense isolates and closely related mycobacterial strains
| Strain | Country | Biochemical characteristic |
Identification of M. marinumb | ||||||
|---|---|---|---|---|---|---|---|---|---|
| Growth rate | Colony morphology | Pigment in dark | Urease activity | Tween 80 hydrolysis | PZasea activity | MPB64 production | |||
| M. ulcerans subsp. shinshuense | |||||||||
| ATCC 33728 | Japan | Low | Rough | Yellow | + | − | − | − | + |
| JATA753 | Japan | Low | Rough | Yellow | + | − | − | − | + |
| 0401 | Japan | Low | Rough | Yellow | + | − | − | − | + |
| 0501 | Japan | Low | Rough | Yellow | + | − | − | − | + |
| 0701 | Japan | Low | Rough | Yellow | + | − | − | − | + |
| 0702 | Japan | Low | Rough | Yellow | + | − | − | − | + |
| 0703 | Japan | Low | Rough | Yellow | + | − | − | − | + |
| 0801 | Japan | Low | Rough | Yellow | + | − | − | − | + |
| 0901 | Japan | Low | Rough | Yellow | + | − | − | − | + |
| 1001 | Japan | Low | Rough | Yellow | + | − | − | − | + |
| M. ulcerans | |||||||||
| ITM 98-912 | China | Low | Rough | Yellow | + | − | − | − | + |
| ATCC 19423T | Australia | Low | Rough | None | − | − | − | − | + |
| Agy99 | Ghana | Low | Rough | Yellow | − | − | − | − | + |
| M. marinum ATCC 927T | United States | Medium | Smooth | None | + | + | + | − | + |
PZase, pyrazinamidase.
By use of the DDH Mycobacteria kit (Kyokuto Pharmaceutical Industrial, Tokyo, Japan).
Biochemical characteristics.
The 10 isolates exhibited the same characteristics: rough colonies and yellow pigmentation, even when grown in the dark. The slowly growing mycobacterium formed visible colonies at 25°C and 32°C on a 2% Ogawa egg slant, but not at 37°C or 42°C. No growth was seen on a medium supplemented with 500 μg/ml p-nitrobenzoic acid or 5% NaCl. The isolates were negative for niacin, nitrate reduction, arylsulfatase (3 days), Tween 80 hydrolysis, pyrazinamidase, and iron uptake but were positive for semiquantitative catalase and 68°C catalase and urease. Comparisons between M. ulcerans subsp. shinshuense, M. ulcerans, and M. marinum are summarized in Table 5. These results were in accordance with those of a previous report (22) except for the positive result of M. ulcerans subsp. shinshuense on the urease test.
Drug susceptibility assays.
Table 6 shows the results of testing of the susceptibilities of M. ulcerans subsp. shinshuense ATCC 33728 and M. ulcerans subsp. shinshuense clinical isolate 0501 to antimicrobial agents. These isolates exhibited high susceptibilities to streptomycin, kanamycin, levofloxacin, and clarithromycin. Notably, M. ulcerans subsp. shinshuense was more susceptible to streptomycin, kanamycin, and clarithromycin than the M. ulcerans reference strains. Like the M. ulcerans reference strains, M. ulcerans subsp. shinshuense was susceptible to amikacin but resistant to ethambutol, isoniazid, and ethionamide.
Table 6.
Drug susceptibility test results
| Antimycobacterial druga | MIC (μg/ml) for: |
|||
|---|---|---|---|---|
|
M. ulcerans subsp. shinshuense |
M. ulcerans |
|||
| ATCC 33728 | 0501 | ATCC 19423T | Agy99 | |
| SM | 0.125 | 0.25 | 1 | 4 |
| EB | 16 | 8 | 16 | 128 |
| KM | 0.25 | 0.25 | 1 | 1 |
| INH | 8 | 8 | >32 | >32 |
| RFP | 0.06 | 0.06 | 0.06 | 0.06 |
| LVFX | 0.25 | 0.5 | 0.5 | 8 |
| CAM | 0.03 | 0.06 | 0.25 | 0.125 |
| TH | 16 | 8 | 16 | 16 |
| AMK | 0.5 | 0.5 | 0.5 | 0.5 |
SM, streptomycin; EB, ethambutol; KM, kanamycin; INH, isoniazid; RFP, rifampin; LVFX, levofloxacin; CAM, clarithromycin; TH, ethionamide; AMK, amikacin.
Treatment.
The 19 patients were treated with various antibiotic regimens. Clarithromycin was effective for many of the Japanese patients (12 cases). Rifampin was successful in the first case and was used thereafter in 9 cases. Attempts at treatment with other medications, alone and in combinations, were also made (Table 7). In 2 cases, the initial choice of antibiotics was ineffective, and they were changed. In 2 other cases, the antibiotic treatment was discontinued due to adverse effects. In addition to antibiotic treatment, 13 patients underwent surgical excision, and 9 needed skin grafting (Fig. 4). No relapses had been reported as of March 2011.
Table 7.
Antibiotic treatment regimens for BU cases
| Regimena | No. of cases |
|---|---|
| Single drug | |
| CAM | 2 |
| MINO | 1 |
| RFP | 1 |
| Two drugs | |
| CAM, RFP | 2 |
| ITZ, MINO | 1 |
| LVFX, MINO | 1 |
| Three drugs | |
| CAM, LVFX, RFP | 3 |
| CAM, CFPN-PI, NFLX | 1 |
| CFPN-PI, LVFX, MINO | 1 |
| CAM, MINO, NFLX | 1 |
| GRNX, LVFX, MINO | 1 |
| Four drugs (EB, LVFX, RFP, SM) | 1 |
| Six drugs | |
| AZM, CAM, CPFX, LVFX, MINO, RFP | 1 |
| CAM, EB, GFLX, INH, RFP, SM | 1 |
| CAM, CPFX, LVFX, MINO, PZFX, RFP | 1 |
AZM, azithromycin; CAM, clarithromycin; CFPN-PI, cefcapene-pivoxil; CPFX, ciprofloxacin; EB, ethambutol; GFLX, gatifloxacin; GRNX, garenoxacin; INH, isoniazid; ITZ, itraconazole; LVFX, levofloxacin; MINO, minocycline; NFLX, norfloxacin; RFP, rifampin; SM, streptomycin; PZFX, pazufloxacin.
DISCUSSION
This is the first report that comprehensively analyzes both the genotypic and the biochemical profiles of a causative agent of Buruli ulcer in Japan. It is noteworthy that BU in Japan was induced by Mycobacterium ulcerans subsp. shinshuense, not by M. ulcerans. We compared certain characteristics of M. ulcerans and M. ulcerans subsp. shinshuense by several analyses. They are relatively similar; detection of IS2404 by PCR was the most important test for early diagnosis and differential diagnosis for distinguishing both M. ulcerans subsp. shinshuense and M. ulcerans infections from M. marinum infection. Although the DDH Mycobacteria kit could not distinguish M. ulcerans and M. ulcerans subsp. shinshuense from M. marinum (Table 5), simultaneous detection of IS2404 would prevent misidentification. IS2404 was well amplified from clinical samples and/or isolates in all 19 cases (Table 2). The 16S rRNA gene sequences of M. ulcerans subsp. shinshuense and M. ulcerans are similar, but conserved sites that were different in M. ulcerans subsp. shinshuense versus M. ulcerans were seen (Table 3); these matched perfectly with the sequences reported by Portaels et al. (20) and subsequently found to be useful in discrimination (6, 16). PCR targeting of pMUM001 revealed that all M. ulcerans subsp. shinshuense isolates lack the band representing the STPK gene, suggesting a small but conservative mutation(s) in M. ulcerans subsp. shinshuense versus M. ulcerans sequences. This PCR test was also applied for detection of a virulent plasmid and for differential diagnosis of M. ulcerans versus M. ulcerans subsp. shinshuense (16). The DNA sequence of the ITS region and the 16S rRNA and hsp65 genes showed similarity between the M. ulcerans subsp. shinshuense isolates and M. ulcerans. However, the rpoB gene showed more similarity to M. marinum and M. pseudoshottsii than to M. ulcerans (Fig. 5). These data were suggestive of the evolutionary paths of these related mycobacterial species (9).
It is noteworthy that M. ulcerans subsp. shinshuense was identified in all of the isolates from Japanese patients diagnosed with BU. M. ulcerans subsp. shinshuense, not M. ulcerans, could be the primary etiological agent of BU in eastern Asia. It has been reported that the STPK gene was not amplified from the isolate of a BU patient in China (26). While there might be a taxonomical reason, this isolate was finally classified as M. ulcerans (4). A more precise genotypic examination might have revealed this to be a case of M. ulcerans subsp. shinshuense infection. If so, this finding would suggest that M. ulcerans subsp. shinshuense is distributed not only in Japan, but also in other areas of eastern Asia. Thorough field work and increased vigilance on the part of dermatologists and physicians are needed to determine the predominant cause of BU in eastern Asia. Because disease severity and susceptibility to antibacterial drugs are significantly different for M. ulcerans versus M. ulcerans subsp. shinshuense, they must be identified and distinguished in clinical settings.
The Japanese M. ulcerans subsp. shinshuense isolates and the Chinese strain of M. ulcerans presumably belong to the same cluster, based on genetic analyses such as microarray-based comparative genomic hybridization (9) and comparative sequence analysis of polymorphic variable-number tandem repeats (VNTR) (27). Their genomes were distinctly different from those of M. ulcerans strains that originated in other geographic regions. However, one of the VNTR loci can be used to distinguish between the Chinese and Japanese strains (1). Pidot et al. described the clear difference between the two strains by analyzing virulent plasmid genes and the resulting mycolactone production, noting that the Japanese strain produces mycolactone A/B, while the Chinese strain produces a unique mycolactone D (19). Further study is needed to elucidate the evolution and distribution of M. ulcerans, and its relation to M. ulcerans subsp. shinshuense, in Asia.
It is notable that most of the biochemical characteristics (Table 5) and drug susceptibilities (Table 6) of the isolates were the same as those found in a previous report (22), with the exception of the urease test. Interestingly, the Japanese M. ulcerans subsp. shinshuense isolates, the Chinese strain of M. ulcerans, and the related species M. marinum were all urease positive, though other strains of M. ulcerans originating from Ghana and Australia were urease negative. The urease test is a simple method with clear results that would be useful in distinguishing between M. ulcerans and M. ulcerans subsp. shinshuense.
Clinical manifestation of BU in Japan was essentially similar to that of BU in other countries, but distinct differences in management were observed. Ulcerated areas were usually smaller for Japanese (Fig. 3) than for African patients; however, the Japanese patients received both surgery and a large array of antimycobacterial drugs (Table 7). In addition, in Africa, most patients who had lesions with cross-sectional diameters of ≤10 cm showed excellent healing without surgery (17). Although the in vitro susceptibilities of the Japanese isolates to streptomycin, kanamycin, and clarithromycin are higher than those of the M. ulcerans strains from West Africa (Table 6), treatment has been fairly aggressive in Japan. It is speculated that because the majority of doctors and patients in Japan have not experienced and cannot recognize Buruli ulcer disease, they might fear the progression and recurrence of disease. Especially when patients complain of pain (9 patients in this study [47%] experienced pain [Fig. 4]), their doctors and family members are willing to initiate aggressive treatment, even in the absence of an immunodeficiency risk factor. Public information campaigns about the disease are needed, as is the establishment of guidelines for the treatment of Buruli ulcer in Japan. Clarification of the mode of transmission is also important. However, the occurrence of cases has been very sporadic, and none could be linked to an aquatic environment. Thus, the source and route of the infection remain unclear.
ACKNOWLEDGMENTS
This work was supported in part by a Grant-in-Aid for Research on Emerging and Re-emerging Infectious Diseases from the Ministry of Health, Labor, and Welfare of Japan (to Y.H., M.M., and N.I.), by a Grant-in-Aid for Scientific Research (C) from the Ministry of Education, Culture, Sports, Science and Technology of Japan (to Y.H.), and by a Grant-in-Aid for Scientific Research (C) from the Japan Society for the Promotion of Science (to K.N.).
Footnotes
Published ahead of print on 31 August 2011.
REFERENCES
- 1. Ablordey A., et al. 2005. Comparative nucleotide sequence analysis of polymorphic variable number tandem repeat loci in Mycobacterium ulcerans. J. Clin. Microbiol. 43:5281–5284 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Alsop D. G. 1972. The Bairnsdale ulcer. Aust. N. Z. J. Surg. 41:317–319 [PubMed] [Google Scholar]
- 3. Clancey J. K., Dodge O. G., Lunn H. F., Oduori M. L. 1961. Mycobacterial skin ulcers in Uganda. Lancet ii:951–954 [DOI] [PubMed] [Google Scholar]
- 4. Faber W. R., et al. 2000. First reported case of Mycobacterium ulcerans infection in a patient from China. Trans. R. Soc. Trop. Med. Hyg. 94:277–279 [DOI] [PubMed] [Google Scholar]
- 5. Fenner F. 1951. The significance of the incubation period in infectious diseases. Med. J. Aust. 2:813–818 [DOI] [PubMed] [Google Scholar]
- 6. Funakoshi T., et al. 2009. Intractable ulcer caused by Mycobacterium shinshuense: successful identification of mycobacterium strain by 16S ribosomal RNA 3′-end sequencing. Clin. Exp. Dermatol. 34:e712–e715 [DOI] [PubMed] [Google Scholar]
- 7. Imada H., et al. 2008. Cutaneous ulcer of a right olecranon due to Mycobacterium shinshuense; a case report. Seikeigeka 59:1440–1445 (In Japanese.) [Google Scholar]
- 8. Kaminuma E., et al. 2010. DDBJ launches a new archive database with analytical tools for next-generation sequence data. Nucleic Acids Res. 38(Database issue):D33–D38 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Käser M., et al. 2007. Evolution of two distinct phylogenetic lineages of the emerging human pathogen Mycobacterium ulcerans. BMC Evol. Biol. 7:177. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Kazumi Y., et al. 2004. Mycobacterium shinshuense isolated from cutaneous ulcer lesion of right lower extremity in a 37-year-old woman. Kekkaku 79:437–441 (In Japanese) [PubMed] [Google Scholar]
- 11. Kim B.-J., et al. 1999. Identification of mycobacterial species by comparative sequence analysis of the RNA polymerase gene (rpoB). J. Clin. Microbiol. 37:1714–1720 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Kondo M., et al. 2009. Leg ulcer caused by Mycobacterium ulcerans ssp. shinshuense infection. Int. J. Dermatol. 48:1330–1333 [DOI] [PubMed] [Google Scholar]
- 13. Kusunoki S., et al. 1991. Application of colorimetric microdilution plate hybridization for rapid genetic identification of 22 Mycobacterium species. J. Clin. Microbiol. 29:1596–1603 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. MacCallum P., Tolhurst J. C., Buckle G., Sissons H. I. 1948. A new mycobacterial infection in man. I. Clinical aspects. II. Experimental investigations in laboratory animals. III. Pathology of the experimental lesions in the rat. IV. Cultivation of the new mycobacterium. J. Pathol. Bacteriol. 60:93–12218876541 [Google Scholar]
- 15. Mikoshiba H., et al. 1982. A case of atypical mycobacteriosis due to Mycobacterium ulcerans-like organism. Nihon Hifukagakkaizassi 92:557–565 (In Japanese) [PubMed] [Google Scholar]
- 16. Nakanaga K., et al. 2007. “Mycobacterium ulcerans subsp. shinshuense” isolated from a skin ulcer lesion: identification based on 16S rRNA gene sequencing. J. Clin. Microbiol. 45:3840–3843 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Nienhuis W. A., et al. 2010. Antimicrobial treatment for early, limited Mycobacterium ulcerans infection: a randomized controlled trial. Lancet 375:664–672 [DOI] [PubMed] [Google Scholar]
- 18. Phillips R. C., et al. 2005. Sensitivity of PCR targeting the IS2404 insertion sequence of Mycobacterium ulcerans in an assay using punch biopsy specimens for diagnosis of Buruli ulcer. J. Clin. Microbiol. 43:3650–3656 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Pidot S. J., et al. 2008. Deciphering the genetic basis for polyketide variation among mycobacteria producing mycolactones. BMC Genomics 9:462. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Portaels F., et al. 1996. Variability in 3′ end of 16S rRNA sequence of Mycobacterium ulcerans is related to geographic origin of isolates. J. Clin. Microbiol. 34:962–965 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Portaels F., Silva M. T., Meyers W. M. 2009. Buruli ulcer. Clin. Dermatol. 27:291–305 [DOI] [PubMed] [Google Scholar]
- 22. Portaels F., Johnson P., Meyers W. M. (ed.). April 2001. Buruli ulcer: diagnosis of Mycobacterium ulcerans disease. A manual for health care providers. World Health Organization, Geneva, Switzerland: http://whqlibdoc.who.int/hq/2001/WHO_CDS_CPE_GBUI_2001.4.pdf [Google Scholar]
- 23. Roth A., et al. 1998. Differentiation of phylogenetically related slowly growing mycobacteria based on 16S–23S rRNA gene internal transcribed spacer sequences. J. Clin. Microbiol. 36:139–147 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Springer B., et al. 1996. Isolation and characterization of a unique group of slowly growing mycobacteria: description of Mycobacterium lentiflavum sp. nov. J. Clin. Microbiol. 34:1100–1107 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Stinear T. P., et al. 2004. Giant plasmid-encoded polyketide synthases produce the macrolide toxin of Mycobacterium ulcerans. Proc. Natl. Acad. Sci. U. S. A. 101:1345–1349 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Stinear T. P., et al. 2005. Common evolutionary origin for the unstable virulence plasmid pMUM found in geographically diverse strains of Mycobacterium ulcerans. J. Bacteriol. 187:1668–1676 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Stragier P., Ablordey A., Durnez L., Portaels F. 2007. VNTR analysis differentiates Mycobacterium ulcerans and IS2404 positive mycobacteria. Syst. Appl. Microbiol. 30:525–530 [DOI] [PubMed] [Google Scholar]
- 28. Suzuki S., et al. 2008. Skin ulcer caused by ‘Mycobacterium ulcerans subsp. shinshuense ’ infection. Hifubyou Shinryo 30:145–148 (In Japanese) [Google Scholar]
- 29. Tamura K., Dudley J., Nei M., Kumar S. 2007. MEGA4: molecular evolutionary genetic analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24:1596–1599 [DOI] [PubMed] [Google Scholar]
- 30. Telenti A., et al. 1993. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis. J. Clin. Microbiol. 31:175–178 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Tsukamura M., Mikoshiba H. 1989. A taxonomic study on a mycobacterium which caused skin ulcer in a Japanese girl and resembled Mycobacterium ulcerans. Kekkaku 64:691–697(In Japanese.) [PubMed] [Google Scholar]
- 32. Uganda Buruli Group 1971. Epidemiology of Mycobacterium ulcerans infection (Buruli ulcer) at Kinyara, Uganda. Trans. R. Soc. Trop. Med. Hyg. 65:763–775 [DOI] [PubMed] [Google Scholar]
- 33. Wallace R. J., Jr, Nash D. R., Steele L. C., Steingrube V. 1986. Susceptibility testing of slowly growing mycobacteria by a microdilution MIC method with 7H9 broth. J. Clin. Microbiol. 24:976–981 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Walsh D. S., Portaels F., Meyers W. M. 2011. Buruli ulcer: advances in understanding Mycobacterium ulcerans infection. Dermatol. Clin. 29:1–8 [DOI] [PubMed] [Google Scholar]
- 35. Watanabe T., et al. 2010. Buruli ulcer caused by “Mycobacterium ulcerans subsp. shinshuense.” Eur. J. Dermatol. 20:809–810 [DOI] [PubMed] [Google Scholar]
- 36. World Health Organization October 2004. Provisional guidance on the role of specific antibiotics in the management of Mycobacterium ulcerans disease (Buruli ulcer). World Health Organization, Geneva, Switzerland: http://whqlibdoc.who.int/hq/2004/WHO_CD5_CPE_GBUI_2004.10.pdf. [Google Scholar]