Abstract
We report a novel IS711 chromosomal location that is specific for the Brucella genotype ST27 previously associated with Pacific marine mammals and human zoonotic infection in New Zealand and Peru. Our data support the previous observation that this peculiar genotype is distinct from those commonly isolated from the Atlantic and currently classified within the species B. ceti and B. pinnipedialis.
TEXT
Brucellae are Gram-negative, facultative, intracellular bacteria that can infect humans and many species of animals. Six species were initially recognized within the genus Brucella: B. abortus, B. melitensis, B. suis, B. ovis, B. canis, and B. neotomae (13, 19, 29). This classification is based mainly on differences in pathogenicity, host preference, and phenotypic characteristics. Four additional species have been included since 2007 in the genus Brucella. These comprise the species B. ceti and B. pinnipedialis isolated from marine mammals, with cetaceans (dolphin, porpoise, and whale species) and pinnipeds (various seal species) as the preferred hosts, respectively (11, 12). Brucella microti, first described in 2008, was isolated initially from the common vole but later also from the red fox and from soil (21–23). The latest species is B. inopinata, which was isolated from a human breast implant infection and represents the most distant Brucella species at the phenotypic and molecular levels relative to the others (10, 24). The animal or environmental reservoir of the latter species is not known. New Brucella species will likely be described in the future, including isolates from baboons (20), from wild rodents in Australia (26), and for strain BO2 isolated from a patient with chronic destructive pneumonia (27). Strain BO2 and strains from wild Australian rodents have been proposed as novel lineages of the B. inopinata species (26, 27).
Molecular and phenotypic typing of marine mammal Brucella strains has led to their classification into two species for strains originating mostly from the Atlantic, i.e., B. ceti and B. pinnipedialis (12). However, several subgroups within each species have been identified by molecular typing methods, such as multilocus sequence analysis (MLSA), multilocus variable number of tandem repeats (VNTR) analysis (MLVA), or omp2a and omp2b porin gene diversity analysis (2, 4, 6, 8, 9, 14, 15, 16, 18, 28, 32). Among them, one subgroup within B. ceti, which is composed exclusively of strains isolated from various dolphin species, has been proposed to constitute a separate species with the name B. delphini (2, 14, 29). The isolates from cetaceans from the Pacific may also constitute a separate species (16). Three human cases with naturally acquired infection by Brucella strains presumably of marine origin have been reported, one case of spinal osteomyelitis from a patient in New Zealand (18), and two neurobrucellosis cases from Peruvian patients (25). Interestingly, these human isolates presented the same genotype as a strain from a cetacean from the Pacific (30).
The presence of the mobile genetic element IS711 (GenBank accession no. M94960) has been a useful target for molecular characterization of classical terrestrial mammal Brucella species and biovars based on the number and distribution of IS711 copies within the bacterial genomes. Among classical Brucella species, IS711-based fingerprints are stable, species specific (except B. canis), and to some extent biovar specific (3). Marine mammal Brucella strains have been shown to carry a higher number of the IS711 element in their genome than terrestrial mammal Brucella species and biovars, with the exception of B. ovis (3, 4, 9, 17). Several IS711-based molecular typing method studies have confirmed the classification into two marine mammal Brucella species with subgroups in each and correlating closely with classifications made using other molecular typing methods, such as MLSA and MLVA (32). It must be mentioned that this classification into B. ceti and B. pinnipedialis refers in particular to marine mammal strains isolated mostly from the Atlantic (around 300 strains isolated to date) (11, 16). Thus, for each of these marine mammal Brucella species and their subgroups, specific chromosomal IS711 locations have been identified and PCR detection methods developed (5, 6, 9, 15, 32). However, for marine mammal isolates from the Pacific and the three human cases indicated above which are of the MLSA ST27 genotype, found to be specifically associated with these strains (30), no specific IS711 location has been identified so far.
Recently, the complete genome sequence of B. pinnipedialis reference strain B2/94 has revealed the presence of 31 IS711 copies with specific or common chromosomal locations to other Brucella species or biovars (1). A phylogenetic analysis based on whole-genome sequences confirmed the MLSA- or MLVA-16-based molecular classification of clusters of marine mammal isolates. Interestingly, in this analysis, B. ceti strain Cudo, for which a high number of IS711 elements were also located was found to be closely related to Brucella sp. strain F5/99 isolated from a common dolphin from the Pacific, which may be considered the marine mammal type strain of genotype ST27. The aim of this study was to identify IS711 locations that would be specific of this ST27 genotype, taking advantage of other published complete Brucella genome sequences. Therefore, after genomic comparisons, several potential specific IS711 locations were selected from the genome sequence of B. ceti strain Cudo for PCR screening. These locations corresponded to locus tags BCETI_1000668, BCETI_2000199, BCETI_7000072, and BCETI_7000555 (GenBank accession no. NZ_ACJD01000001, NZ_ACJD01000002, NZ_ACJD01000007, and NZ_ACJD01000007, respectively). A first set of PCRs were performed using a forward primer in the open reading frame upstream of IS711 at these locations and the reverse IS711-specific primers IS2 or IS3 (Table 1). According to the PCR results for the four ST27 strains (common dolphin isolate F5/99 and the three human isolates) and representative strains of the other marine mammal ST genotypes described so far, only locus tag BCETI_7000072 appeared of interest (data not shown). This location is schematized in Fig. 1. It was further confirmed by sequencing of the PCR fragment of the human ST27 isolate 02/611 from New Zealand (GenBank accession no. JN383971). Consequently, a large panel of Brucella strains of marine mammal origin (Table 2 ) were used to screen this IS711 location by PCR. They were from diverse marine mammal species (seal, otter, dolphin, porpoise, whale species) and of diverse geographic origins (France, Norway, Scotland). Bacterial culture and DNA extraction were performed as described previously (7). PCR was performed using forward primer ST27IV-F and reverse IS711-specific primer IS2 (Table 1). This PCR was found positive with a fragment of the expected size (386 bp) only for the four ST27 strains in this study. Reference strains for all terrestrial mammal Brucella species and biovars were also negative in this PCR (data not shown). The IS711 ST27-specific location was further confirmed by Southern blotting on EcoRI-digested DNAs using an IS711-specific probe and a probe specific to the region upstream of this IS711 element (primers shown in Table 1), and the latter probe detected an EcoRI fragment with a shift in size in ST27 relative to the others as expected due to the presence of IS711 (Fig. 2).
Table 1.
Primers used in this study
| Procedure and target region | Fragment size (bp) | Primer name | Nucleotide sequence (5′–3′) |
|---|---|---|---|
| PCR | |||
| BCETI_1000667 to BCETI_1000668 (IS711) | 535 | ST27I-F | GACTATATGGTCGGCACGAT |
| IS3 | GGCTGTTCTCCTTCAACAAC | ||
| BCETI_2000198 to BCETI_1000199 (IS711) | 222 | ST27II-F | GAGGCTTGTCAGTGCAGAAA |
| IS3 | GGCTGTTCTCCTTCAACAAC | ||
| BCETI_7000071 to BCETI_7000072 (IS711) | 386 | ST27IV-F | GATAGCCAAGTCGGGCATAA |
| IS2 | GCTCACGGCTGTTCTCCTTT | ||
| BCETI_7000553 to BCETI_7000555 (IS711) | 283 | ST27V-F1 | AGAGCCATAGCGATGACCAC |
| IS2 | GCTCACGGCTGTTCTCCTTT | ||
| Southern blot | |||
| IS711 | 730 | ISA | TGTCTGCATTCAACGCAACC |
| ISB | GGATCGAAGCATATCTTCCG | ||
| BCETI_7000071 | 296 | ST27IV-F1 | GGTTGATGGCTATTGCTTCG |
| ST27IV-R1 | GGTTGCCGAATATCGTGAGT |
Fig. 1.
Schematic representation of the IS711-containing DNA fragment used for the ST27-specific PCR in this study. The nucleotide positions relative to the genome sequence of B. ceti Cudo chromosome II (GenBank accession no. NZ_ACJD01000007) are indicated. Locus tag BCETI_7000071 codes for endonuclease V. Locus tag BCETI_7000072 corresponds to IS711.
Table 2.
Brucella strains of marine mammal origin used in this study
| Species and strain | Host or source | Latin name | Geographic origin | MLVA-16 cluster (panel 1 genotype)a | MLSA STb | omp2b-omp2a RFLP patternc | IS711 RFLP patternd (cluster)e | IS711 copy no.d | IS711-anchored PCRf |
New PCR specific to ST27 locus tag BCETI_ 7000072 | |||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| A | B | C | D | ||||||||||
| B. pinnipedialis | |||||||||||||
| 9a-1 | Hooded seal | Cystophora cristata | Norway | C3 (76) | P-I | C | 19 | + | − | − | − | − | |
| 17a-1 | Hooded seal | Cystophora cristata | Norway | C3 (76) | P-I | C | 19 | + | − | − | − | − | |
| 22a-2 | Hooded seal | Cystophora cristata | Norway | C3 (76) | P-I | C | 19 | + | − | − | − | − | |
| 23a-1 | Hooded seal | Cystophora cristata | Norway | C3 (75) | P-I | C | 19 | + | − | − | − | − | |
| 24a-2 | Hooded seal | Cystophora cristata | Norway | C3 (75) | P-I | C | 19 | + | − | − | − | − | |
| 25a-1 | Hooded seal | Cystophora cristata | Norway | C3 (76) | P-I | C | 19 | + | − | − | − | − | |
| 30a-1 | Hooded seal | Cystophora cristata | Norway | C3 (74) | P-I | C | 19 | + | − | − | − | − | |
| 37a-1 | Hooded seal | Cystophora cristata | Norway | C3 (76) | P-I | C | 19 | + | − | − | − | − | |
| 38g-1 | Hooded seal | Cystophora cristata | Norway | C3 (76) | P-I | C | 19 | + | − | − | − | − | |
| 39a-1 | Hooded seal | Cystophora cristata | Norway | C3 (76) | P-I | C | 19 | + | − | − | − | − | |
| 53c-1 | Hooded seal | Cystophora cristata | Norway | C3 (76) | P-I | C | 19 | + | − | − | − | − | |
| M163/99/10 | Hooded seal | Cystophora cristata | Scotland | C3 (76) | ST25 | P-I | C (4) | 19 | + | − | − | − | − |
| M603/99/7 | Hooded seal | Cystophora cristata | Scotland | C3 (76) | ST25 | P-I | C (4) | 19 | + | − | − | − | − |
| M2006/94/6 | Hooded seal | Cystophora cristata | Scotland | C3 (76) | ST25 | P-I | C (4) | 19 | + | − | − | − | − |
| B2/94 (NCTC 12890; BCCN 94-73)g | Common seal | Phoca vitulina | Scotland | C2 (25) | L-I | D (1) | 23 | + | + | − | − | − | |
| M13/01/1 | Common seal | Phoca vitulina | Scotland | C2 (25) | ST25 | L-I | D (1) | 23 | + | + | − | − | − |
| M336/94/1 | Common seal | Phoca vitulina | Scotland | C2 (25) | L-I | D (1) | 23 | + | + | − | − | − | |
| M339/94/1 | Common seal | Phoca vitulina | Scotland | C2 (25) | L-I | D (1) | 23 | + | + | − | − | − | |
| M445/99/2 | Common seal | Phoca vitulina | Scotland | C2 (25) | ST25 | L-I | D (1) | 23 | + | + | − | − | − |
| M514/96/4 | Common seal | Phoca vitulina | Scotland | C2 (25) | ST25 | L-I | D (1) | 23 | + | + | − | − | − |
| M972/94/1 | Common seal | Phoca vitulina | Scotland | C2 (25) | L-I | D (1) | 23 | + | + | − | − | − | |
| M621/99/2 | Gray seal | Halichoerus grypus | Scotland | C2 (25) | ST25 | L-I | D (1) | 23 | + | + | − | − | − |
| M1771/94/1 | Otter | Lutra lutra | Scotland | C2 (25) | ST25 | L-I | D (1) | 23 | + | + | − | − | − |
| M292/94/1 | Common seal | Phoca vitulina | Scotland | C1 (71) | ST24 | O-I | E (1) | 24 | + | + | − | − | − |
| M449/02/2 | Common seal | Phoca vitulina | Scotland | C1 (71) | O-I | E (1) | 24 | + | + | − | − | − | |
| M2466/93/4 | Common seal | Phoca vitulina | Scotland | C2 (72) | L-I | E (1) | 24 | + | + | − | − | − | |
| M2533/93/1 | Common seal | Phoca vitulina | Scotland | C1 (71) | ST24 | O-I | E (1) | 24 | + | + | − | − | − |
| M2375/94/3 | Gray seal | Halichoerus grypus | Scotland | C2 (25) | ST25 | L-I | E (1) | 24 | + | + | − | − | − |
| M194/00/1 | Gray seal | Halichoerus grypus | Scotland | C2 (25) | L-I | E (1) | 24 | + | + | − | − | − | |
| M192/00/1 | Minke whale | Balaenoptera acutorostrata | Scotland | C1 (71) | ST24 | O-I | E (1) | 24 | + | + | − | − | − |
| B. ceti | |||||||||||||
| M490/95/1 | Common seal | Phoca vitulina | Scotland | B (23) | ST23 | M-J | F (2) | 30 | + | − | + | − | − |
| 05-0684-1144 | Porpoise | Phocoena phocoena | France | B (23) | M-J | F | 30 | + | − | + | − | − | |
| M23/03/4 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | F (2) | 30 | + | − | + | − | − | |
| M39/94/1 | Porpoise | Phocoena phocoena | Scotland | B (23) | ST23 | M-J | F (2) | 30 | + | − | + | − | − |
| M51/04/2 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | F (2) | 30 | + | − | + | − | − | |
| M58/05/1 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | F | 30 | + | − | + | − | − | |
| M78/05/2 | Porpoise | Phocoena phocoena | Scotland | B (23) | ST23 | M-J | F | 30 | + | − | + | − | − |
| M93/04/3 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | F (2) | 30 | + | − | + | − | − | |
| M117/01/1 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | F (2) | 30 | + | − | + | − | − | |
| M165/03/6 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | F (2) | 30 | + | − | + | − | − | |
| M195/03/10 | Porpoise | Phocoena phocoena | Scotland | B (70) | M-J | F (2) | 30 | + | − | + | − | − | |
| M234/05/2 | Porpoise | Phocoena phocoena | Scotland | B (23) | ST23 | M-J | F | 30 | + | − | + | − | − |
| M291/03/2 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | F (2) | 30 | + | − | + | − | − | |
| M499/99/10 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | F (2) | 30 | + | − | + | − | − | |
| M515/96/2 | Porpoise | Phocoena phocoena | Scotland | B (23) | ST23 | M-J | F | 30 | + | − | + | − | − |
| M615/99/1 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | F (2) | 30 | + | − | + | − | − | |
| M854/98/8 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | F (2) | 30 | + | − | + | − | − | |
| M1570/94/1 | Porpoise | Phocoena phocoena | Scotland | B (23) | ST23 | M-J | F | 30 | + | − | + | − | − |
| 7763/2 | Bottlenose dolphin | Tursiops truncatus | France | B (23) | ST23 | M-J | F | 30 | + | − | + | − | − |
| M452/97/2 | Common dolphin | Delphinus delphis | Scotland | B (23) | ST23 | M-J | F (2) | 30 | + | − | + | − | − |
| M2/00/1 | White-sided dolphin | Lagenorhyncus acutus | Scotland | B (23) | M-J | F (2) | 30 | + | − | + | − | − | |
| M52/01/1 | White-sided dolphin | Lagenorhyncus acutus | Scotland | B (23) | M-J | F (2) | 30 | + | − | + | − | − | |
| M181/97/1 | White-sided dolphin | Lagenorhyncus acutus | Scotland | B (23) | ST23 | M-J | F | 30 | + | − | + | − | − |
| M187/00/1 | White-sided dolphin | Lagenorhyncus acutus | Scotland | B (23) | ST23 | M-J | F (2) | 30 | + | − | + | − | − |
| M2438/95/1 | White-sided dolphin | Lagenorhyncus acutus | Scotland | B (23) | M-J | F | 30 | + | − | + | − | − | |
| B202R | Minke whale | Balaenoptera acutorostrata | Norway | B (23) | ST23 | M-J | F (2) | 30 | + | − | + | − | − |
| B1/94 (NCTC 12891; BCCN 94-74)g | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | G (2) | 29 | + | − | + | − | − | |
| M12/00/3 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | G (2) | 29 | + | − | + | − | − | |
| M38/04/3 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | G (2) | 29 | + | − | + | − | − | |
| M103/99/1 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | G (2) | 29 | + | − | + | − | − | |
| M199/04/2 | Porpoise | Phocoena phocoena | Scotland | B (23) | ST23 | M-J | G | 29 | + | − | + | − | − |
| M1747/98/3 | Porpoise | Phocoena phocoena | Scotland | B (23) | M-J | G (2) | 29 | + | − | + | − | − | |
| M870/97/1 | White-beaked dolphin | Lagenorhyncus albirostris | Scotland | B (23) | M-J | G | 29 | + | − | + | − | − | |
| M997/94/2 | White-sided dolphin | Lagenorhyncus acutus | Scotland | B (69) | M-J | G (2) | 29 | + | − | + | − | − | |
| M2788/97/1 | White-sided dolphin | Lagenorhyncus acutus | Scotland | B (23) | M-J | G (2) | 29 | + | − | + | − | − | |
| B14/94 | Common dolphin | Delphinus delphis | Scotland | A1 (24) | ST26 | N-K | H (3) | 26 | + | − | − | + | − |
| M13/05/1 | Striped dolphin | Stenella coeruleoalba | Scotland | A1 (24) | ST26 | N-K | H | 26 | + | − | − | + | − |
| M40/95/1 | Striped dolphin | Stenella coeruleoalba | Scotland | A1 (24) | ST26 | N-K | H (3) | 26 | + | − | − | + | − |
| M642/99/2 | Striped dolphin | Stenella coeruleoalba | Scotland | A1 (24) | ST26 | N-K | H (3) | 26 | + | − | − | + | − |
| M654/99/1 | Striped dolphin | Stenella coeruleoalba | Scotland | A2 (77) | ST26 | N-K | H (3) | 26 | + | − | − | + | − |
| M656/99/1 | Striped dolphin | Stenella coeruleoalba | Scotland | A1 (24) | ST26 | N-K | H (3) | 26 | + | − | − | + | − |
| M2194/94/1 | Striped dolphin | Stenella coeruleoalba | Scotland | A1 (24) | ST26 | N-K | H (3) | 26 | + | − | − | + | − |
| M18/96/1 | White-sided dolphin | Lagenorhyncus acutus | Scotland | A1 (24) | N-K | H | 26 | + | − | − | + | − | |
| Brucella spp. | |||||||||||||
| F5/99 | Bottlenose dolphin | Tursiops truncatus | United States (West Coast) | ST27 | Q-I | + | − | − | − | + | |||
| 02/611 | Human | Homo sapiens | New Zealand | (78) | ST27 | Q-I | I | 23 | + | − | − | − | + |
| 01A09163 | Human | Homo sapiens | Peru | ST27 | + | − | − | − | + | ||||
| 85A05748 | Human | Homo sapiens | Peru | ST27 | + | − | − | − | + | ||||
According to Maquart et al. (16).
According to Groussaud et al. (14).
According to Dawson et al. (9) for the strains indicated.
PCRs A to D are a summary of data published in references 6, 9, 15, 18, 25, and 32. PCR ST27 is the novel IS711-anchored PCR of this study; the locus tag of the IS711 position is indicated.
Reference strains are given in parentheses.
Fig. 2.
Southern blot of EcoRI-digested DNAs using an IS711-specific probe (A) or a probe specific for region BCETI_7000071 (B) (Table 1). Strains studied were representatives of those carrying a high IS711 copy number (Table 2) and are B. ovis 63/290 (lanes 1), B. pinnipedialis M163/99/10 (lanes 2), B. pinnipedialis B2/94 (lanes 3), B. pinnipedialis M292/94/1 (lanes 4), B. ceti M39/94/1 (lanes 5), B. ceti B1/94 (lanes 6), B. ceti B14/94 (lanes 7), and Brucella sp. 02/611 of genotype ST27 (lanes 8).
This novel IS711 location, the distinct IS711 locations in group of strains consisting only of dolphin isolates (proposed as B. delphini), and other molecular data support the suggestion of additional Brucella species in marine mammal Brucella isolates besides B. ceti and B. pinnipedialis (29). The specific IS711 location of ST27 identified in this study, together with others previously reported (5, 6, 31, 32), may be of further use for the molecular identification of Brucella isolates of marine origin.
Acknowledgments
We thank Jakub Muchowski for valuable technical assistance and Will Probert for supplying DNA of some of the human ST27 Brucella isolates.
Footnotes
Published ahead of print on 31 August 2011.
REFERENCES
- 1. Audic S., Lescot M., Claverie J. M., Cloeckaert A., Zygmunt M. S. 2011. The genome sequence of Brucella pinnipedialis B2/94 sheds light on the evolutionary history of the genus Brucella. BMC Evol. Biol. 11:200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Bourg G., O'Callaghan D., Boschiroli M. L. 2007. The genomic structure of Brucella strains isolated from marine mammals gives clues to evolutionary history within the genus. Vet. Microbiol. 125:375–380 [DOI] [PubMed] [Google Scholar]
- 3. Bricker B. J., Ewalt D. R., MacMillan A. P., Foster G., Brew S. 2000. Molecular characterization of Brucella strains isolated from marine mammals. J. Clin. Microbiol. 38:1258–1262 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Clavareau C., et al. 1998. Phenotypic and molecular characterization of a Brucella strain isolated from a minke whale (Balaenoptera acutorostrata). Microbiology 144:3267–3273 [DOI] [PubMed] [Google Scholar]
- 5. Cloeckaert A., Grayon M., Grépinet O. 2000. An IS711 element downstream of the bp26 gene is a specific marker of Brucella spp. isolated from marine mammals. Clin. Diagn. Lab. Immunol. 7:835–839 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Cloeckaert A., Grayon M., Grépinet O., Sidi Boumedine K. 2003. Classification of Brucella strains isolated from marine mammals by infrequent restriction site PCR and development of specific PCR identification tests. Microbes Infect. 5:593–602 [DOI] [PubMed] [Google Scholar]
- 7. Cloeckaert A., Verger J. M., Grayon M., Grépinet O. 1995. Restriction site polymorphism of the genes encoding the major 25 kDa and 36 kDa outer-membrane proteins of Brucella. Microbiology 141:2111–2121 [DOI] [PubMed] [Google Scholar]
- 8. Cloeckaert A., et al. 2001. Classification of Brucella spp. isolated from marine mammals by DNA polymorphism at the omp2 locus. Microbes Infect. 3:729–738 [DOI] [PubMed] [Google Scholar]
- 9. Dawson C. E., et al. 2008. Phenotypic and molecular characterisation of Brucella isolates from marine mammals. BMC Microbiol. 8:224. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. De B. K., et al. 2008. Novel Brucella strain (BO1) associated with a prosthetic breast implant infection. J. Clin. Microbiol. 46:43–49 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Foster G., et al. 2002. A review of Brucella sp. infection of sea mammals with particular emphasis on isolates from Scotland. Vet. Microbiol. 90:563–580 [DOI] [PubMed] [Google Scholar]
- 12. Foster G., Osterman B. S., Godfroid J., Jacques I., Cloeckaert A. 2007. Brucella ceti sp. nov. and Brucella pinnipedialis sp. nov. for Brucella strains with cetaceans and seals as their preferred hosts. Int. J. Syst. Evol. Microbiol. 57:2688–2693 [DOI] [PubMed] [Google Scholar]
- 13. Godfroid J., et al. 2005. From the discovery of the Malta fever's agent to the discovery of a marine mammal reservoir, brucellosis has continuously been a re-emerging zoonosis. Vet. Res. 36:313–326 [DOI] [PubMed] [Google Scholar]
- 14. Groussaud P., Shankster S. J., Koylass M. S., Whatmore A. M. 2007. Molecular typing divides marine mammal strains of Brucella into at least three groups with distinct host preferences. J. Med. Microbiol. 56:1512–1518 [DOI] [PubMed] [Google Scholar]
- 15. Maquart M., Fardini Y., Zygmunt M. S., Cloeckaert A. 2008. Identification of novel DNA fragments and partial sequence of a genomic island specific of Brucella pinnipedialis. Vet. Microbiol. 132:181–189 [DOI] [PubMed] [Google Scholar]
- 16. Maquart M., et al. 2009. MLVA-16 typing of 295 marine mammal Brucella isolates from different animal and geographic origins identifies 7 major groups within Brucella ceti and Brucella pinnipedialis. BMC Microbiol. 9:145. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Maquart M., Zygmunt M. S., Cloeckaert A. 2009. Marine mammal Brucella isolates with different genomic characteristics display a differential response when infecting human macrophages in culture. Microbes Infect. 11:361–366 [DOI] [PubMed] [Google Scholar]
- 18. McDonald W. L., et al. 2006. Characterization of a Brucella strain as a marine-mammal type despite isolation from a patient with spinal osteomyelitis in New Zealand. J. Clin. Microbiol. 44:4363–4370 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Moreno E., Cloeckaert A., Moriyón I. 2002. Brucella evolution and taxonomy. Vet. Microbiol. 90:209–227 [DOI] [PubMed] [Google Scholar]
- 20. Schlabritz-Loutsevitch N. E., et al. 2009. A novel Brucella isolate in association with two cases of stillbirth in non-human primates: first report. J. Med. Primatol. 38:70–73 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Scholz H. C., et al. 2009. Isolation of Brucella microti from mandibular lymph nodes of red foxes, Vulpes vulpes, in Lower Austria. Vector Borne Zoonotic Dis. 9:153–156 [DOI] [PubMed] [Google Scholar]
- 22. Scholz H. C., et al. 2008. Isolation of Brucella microti from soil. Emerg. Infect. Dis. 14:1316–1317 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Scholz H. C., et al. 2008. Brucella microti sp. nov., isolated from the common vole Microtus arvalis. Int. J. Syst. Evol. Microbiol. 58:375–382 [DOI] [PubMed] [Google Scholar]
- 24. Scholz H. C., et al. 2010. Brucella inopinata sp. nov., isolated from a breast implant infection. Int. J. Syst. Evol. Microbiol. 60:801–808 [DOI] [PubMed] [Google Scholar]
- 25. Sohn A. H., et al. 2003. Human neurobrucellosis with intracerebral granuloma caused by a marine mammal Brucella spp. Emerg. Infect. Dis. 9:485–488 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Tiller R. V., et al. 2010. Characterization of novel Brucella strains originating from wild native rodent species in North Queensland, Australia. Appl. Environ. Microbiol. 76:5837–5845 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Tiller R. V., et al. 2010. Identification of an unusual Brucella strain (BO2) from a lung biopsy in a 52 year-old patient with chronic destructive pneumonia. BMC Microbiol. 10:23. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Vizcaíno N., Caro-Hernández P., Cloeckaert A., Fernández-Lago L. 2004. DNA polymorphism in the omp25/omp31 family of Brucella spp.: identification of a 1.7-kb inversion in Brucella cetaceae and of a 15.1-kb genomic island, absent from Brucella ovis, related to the synthesis of smooth lipopolysaccharide. Microbes Infect. 6:821–834 [DOI] [PubMed] [Google Scholar]
- 29. Whatmore A. M. 2009. Current understanding of the genetic diversity of Brucella, an expanding genus of zoonotic pathogens. Infect. Genet. Evol. 9:1168–1184 [DOI] [PubMed] [Google Scholar]
- 30. Whatmore A. M., et al. 2008. Marine mammal Brucella genotype associated with zoonotic infection. Emerg. Infect. Dis. 14:517–518 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Zygmunt M. S., Blasco J. M., Letesson J. J., Cloeckaert A., Moriyón I. 2009. DNA polymorphism analysis of Brucella lipopolysaccharide genes reveals marked differences in O-polysaccharide biosynthetic genes between smooth and rough Brucella species and novel species-specific markers. BMC Microbiol. 9:92. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Zygmunt M. S., Maquart M., Bernardet N., Doublet B., Cloeckaert A. 2010. Novel IS711-specific chromosomal locations useful for identification and classification of marine mammal Brucella strains. J. Clin. Microbiol. 48:3765–3769 [DOI] [PMC free article] [PubMed] [Google Scholar]