Characterization of Microevolution Events in Mycobacterium tuberculosis Strains Involved in Recent Transmission Clusters

Abstract

Under certain circumstances, it is possible to identify clonal variants of Mycobacterium tuberculosis infecting a single patient, probably as a result of subtle genetic rearrangements in part of the bacillary population. We systematically searched for these microevolution events in a different context, namely, recent transmission chains. We studied the clustered cases identified using a population-based universal molecular epidemiology strategy over a 5-year period. Clonal variants of the reference strain defining the cluster were found in 9 (12%) of the 74 clusters identified after the genotyping of 612 M. tuberculosis isolates by IS6110 restriction fragment length polymorphism analysis and mycobacterial interspersed repetitive units–variable-number tandem repeat typing. Clusters with microevolution events were epidemiologically supported and involved 4 to 9 cases diagnosed over a 1- to 5-year period. The IS6110 insertion sites from 16 representative isolates of reference and microevolved variants were mapped by ligation-mediated PCR in order to characterize the genetic background involved in microevolution. Both intragenic and intergenic IS6110 locations resulted from these microevolution events. Among those cases of IS6110 locations in intergenic regions which could have an effect on the regulation of adjacent genes, we identified the overexpression of cytochrome P450 in one microevolved variant using quantitative real-time reverse transcription-PCR. Our results help to define the frequency with which microevolution can be expected in M. tuberculosis transmission chains. They provide a snapshot of the genetic background of these subtle rearrangements and identify an event in which IS6110-mediated microevolution in an isogenic background has functional consequences.

INTRODUCTION

Mycobacterium tuberculosis is characterized by high genetic homogeneity (99.9% similarity at the nucleotide level) (40). Different mechanisms are involved in the acquisition of variability in M. tuberculosis and include single-nucleotide polymorphisms, insertions, deletions, genomic rearrangements, and transpositions (23). One of the mobile genetic elements involved in transposition events, the insertion sequence IS6110 (22, 42), is considered a key mechanism in the evolution of M. tuberculosis.

IS6110 transposition events are responsible not only for the specific genomic changes directly caused by insertion sequence mobility. Extensive chromosomal rearrangements involving large deletions by IS6110-mediated homologous recombination have also been described (10), and their entry can modify the expression profiles of adjacent genes (32).

IS6110 has been used extensively as a genotypic marker in epidemiological studies. Application of M. tuberculosis fingerprinting based on IS6110 restriction fragment length polymorphism (RFLP) has allowed us to refine the identification of recent transmission events. The M. tuberculosis isolates of cases involved in a recent transmission chain generally have identical fingerprints and thus constitute a cluster. However, it is also possible to find one or several cases sharing genotyping patterns that are highly similar, but not identical, to the pattern defining the cluster (7, 17, 45).

The existence of clonal variants in tuberculosis has been described in recurrent episodes (19), in M. tuberculosis isolates from a single episode (4, 9, 11, 37, 38), and in the respiratory and extrarespiratory isolates of a single case (12). The presence of these variants indicates a certain degree of genetic plasticity in M. tuberculosis. Similarly, subtle variations among the isolates involved in recent transmission chains could be the result of microevolution events selected by the sequential infection of independent hosts in a transmission chain.

We describe the frequency of microevolution events in the recent transmission chains of a population-based universal molecular epidemiology survey. We characterize these events in detail in order to understand the genetic background involved in microevolution and its potential functional significance.

MATERIALS AND METHODS

Sample.

Microevolution events were analyzed in a population sample (n = 612) that was analyzed in the context of a universal-genotyping molecular epidemiology survey (applying IS6110 RFLP analysis and mycobacterial interspersed repetitive units [MIRU]–variable-number tandem repeat [VNTR] typing) between 2003 and 2008 in Almeria (southeastern Spain; population, 699,560) (20). The incidence of tuberculosis in this area was 22.9 cases per 100,000 inhabitants, the highest in its Autonomous Community (Andalusia) and one of the highest in Spain.

Genotyping methods. (i) IS6110-based RFLP typing.

All isolates were analyzed using IS6110 RFLP following international standardization guidelines (43). RFLP types were used to establish identities/differences only when they had more than six IS6110 copies. Phylogenetic analysis of the patterns was performed with Bionumerics 4.6 (Applied Maths, Sint-Martens Laten, Belgium).

(ii) MIRU-VNTR typing.

MIRU-VNTR typing with the 15-locus set (MIRU-15) (41) was applied for the isolates clustered by IS6110 RFLP.

(iii) Selection of clusters for analysis of microevolution.

We selected clusters in which identical RFLP types and genotypic variants with similar genotypes were observed. We studied those clusters including four or more cases in which at least two isolates were identical by RFLP and MIRU (reference strain). The genotypic variants (variant strain) within the cluster had to display differences in fewer than two IS6110 bands and share MIRU types with the reference strain or display single-locus variations. Variants differing in three IS6110 bands were also considered, although only when they had a MIRU type identical to that of the reference strain.

(iv) Ligation-mediated PCR (LM-PCR).

The protocol used is that described by Prod'hom et al. (29), with some modifications. Briefly, DNA was digested with restriction enzyme SalI (Roche Diagnostics GmbH, Penzberg, Germany) and ligated with the adapter Saldg/Salpt by incubation with T4 DNA ligase (New England BioLabs, Ipswich, MA) at 16°C overnight. PCR was performed using primers ISA1 and ISA3 (25) and the linker primer Saldg. Amplification was achieved using 35 PCR cycles of 95°C for 45 s, 65°C for 45 s, and 72°C for 8 min. The DNA polymerase used was AmpliTaq Gold (Applied Biosystems, Foster City, CA). We performed LM-PCR using the restriction enzyme XmaI (New England BioLabs) and used XRxma24 (5′AGCACTCTCCAGCCTCTCAACGAC3′)/rxma12(5′CCGGGTCGTTGA3′) as an adapter (P. del Portillo, unpublished data). Amplified products were separated by electrophoresis in a 1.8% agarose gel and purified using GFX PCR DNA and the Gel Band Purification kit (GE Healthcare, Buckinghamshire, United Kingdom). The purified fragments were sequenced using the ISA1 and ISA3 primers in a 3130xl Genetic Analyzer (Applied Biosystems, Carlsbad, CA). The IS6110 insertion sites were mapped taking as a reference the homology of the LM-PCR product sequences with the H37Rv sequence genome in the TB Database (http://www.tbdb.org) (31). Once the insertion sites were identified in clusters C and D, we confirmed the location of IS6110 by amplification with specific primers (designed to anneal within IS6110 and its adjacent region) and subsequent sequencing.

In addition to mapping of the IS6110 bands responsible for the differences between the reference and variant strains within each cluster, additional bands (5 to 8) among those shared by the reference strain and variant strain within each microevolved cluster were mapped to confirm the certainty of clustering by identifying identical insertion sites.

Real-time reverse transcription (RT)-PCR. (i) Isolation of RNA.

M. tuberculosis cultures were grown to the stationary phase (determined by counting CFU plated on Middlebrook 7H11 plates) in mycobacterial growth indicator tube liquid medium at 37°C (Becton Dickinson, Sparks, MD). The cultures were pelleted by centrifugation (5 min, 14,000 rpm, 4°C) and resuspended in 5 M guanidinium thiocyanate. Cells were disrupted using TRIzol reagent (Invitrogen, Carlsbad, CA) and FastPrep FP120 (45 s/6.5 W; Bio 101 ThermoSavant, Vista, CA). Cell lysates were recovered by centrifugation (10 min, 7,500 × g, 4°C) and deproteinized using chloroform. RNA was purified using an RNeasy total RNA kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions. DNase treatment was performed on column. RNA underwent a second round of DNase treatment (Qiagen) for 15 min at 20°C, and the samples were eluted in 40 μl of RNase-free water.

(ii) qRT-PCR.

Quantitative RT-PCR (qRT-PCR) was performed by a one-step method using the LightCycler RNA Master SYBR green I kit (Roche). The qRT-PCR conditions used were RT of template RNA (61°C for 20 min), denaturation of cDNA/RNA hybrid (95°C for 30 s), and 45 cycles of 95°C for 10 s, 54°C for 10 s, and 72°C for 15 s. The specific primers for the target genes used for RT-PCR were as follows: CYT F (Rv3121), 5′GGT TTA ATC CGG CAA CTG AA 3′; CYT R (Rv3121), 5′TCG GAT TAC GTT CGA CAT CA 3′; HP F (Rv3188), 5′CTG CTC TCG GAT TCG CTT AC 3′; and HP R (Rv3188), 5′GTA GGC GCC GTC GAT AAA T 3′. The specificity of the PCR product was ensured by post-PCR melting curve analysis and running of the amplification product on a gel.

qRT-PCR assays of each strain were performed on two independent cultures, and the expression of the target genes was measured in five independent measurements. The calculated cycle threshold (C_T) value for the target genes was normalized with respect to the C_T value for the 16S rRNA (14).

RESULTS

Identification and description of microevolution events.

Our first objective was to measure the frequency of microevolution in a universal genotyping scheme from a population sample and describe the general features of the clusters that underwent these genotypic changes.

Of the 612 M. tuberculosis isolates genotyped during the study period, 231 (37.7%) were grouped in 74 clusters (two to nine members), as defined by IS6110 RFLP. Microevolution events were identified in nine clusters (12%), which involved four to nine cases occurring over a 1- to 5-year period (Table 1 and Fig. 1). The numbers of IS6110 copies in the clusters with or without microevolution were not markedly different (9 to 17 [median, 12] and 7 to 15 [median, 10], respectively). Proven or probable epidemiological links were found in all of the clusters with microevolution for which detailed epidemiological information was available (Fig. 1). In three clusters (B, E, and G), two variants were considered in addition to the reference strain; for the remaining six clusters, only one clonal variant was found. Among the 12 clonal variants identified by RFLP, differences in the MIRU types involving a single locus were also found in two cases (Fig. 1). Additionally, MIRU analysis split the reference pattern of four clusters into two MIRU types differing at a single locus. Three clusters involved only Spanish cases, one cluster involved Moroccan cases, and the remaining clusters were multinational (Fig. 1). In four of the microevolved clusters, a delay in administering therapy was recorded for some of the cases. All of the isolates were susceptible to isoniazid and rifampin, except one representative of the reference strain in cluster H, which was isoniazid resistant.

Table 1.

Distribution of IS6110 RFLP-defined clusters according to the existence of microevolved clonal variants

No. of members	No. of clusters
	Total	Without RFLP modification	With RFLP microevolution eventsa
4	14	9	5 (C, D, G, H, I)
5	3	2	1 (A)
6	1	-	1 (F)
7	3	2	1 (E)
9	2	1	1 (B)

^aLetters in parentheses correspond to cluster codes in Fig. 1.

Fig. 1.

Clusters including isolates with identical RFLP types (RS, reference strain) together with clonal variants (V). Values in parenthesis are the numbers of cases. RFLP bands that differ between the reference and variant strains are indicated by asterisks. Allelic differences between the MIRU types of the reference and variant strains are in bold.

Genotypic characterization of microevolution phenomena.

Our second objective was to map the IS6110 insertion sites responsible for the differences between RFLP patterns in the clonal variants selected in order to identify the genetic background involved in the microevolution events. The analysis could not be performed for two of the nine clusters (clusters A and E; Fig. 1) due to the lack of viability of some of the isolates. IS6110 insertion sites were mapped in the 16 representative isolates of the reference strain and variants observed in the clusters analyzed (Fig. 1).

The results of IS6110 mapping of the differential IS6110 bands are compiled in Fig. 2. Of the IS6110 bands differing with respect to the RFLP pattern defining the cluster, three were intragenic and interrupted coding regions, and the remaining nine, which led to differential RFLP hybridization bands, mapped to intergenic regions that were potentially involved in the regulation of the downstream genes (Fig. 2). In the intergenic regions, the promoter from IS6110 was oriented with the adjacent gene (i.e., potential upregulation) in five cases (68 to 422 nucleotides before), whereas in the remaining four it was oriented in the opposite direction (at 39 to 404 nucleotides) (i.e., potential downregulation) (Fig. 2). All 45 of the controls analyzed shared IS6110 bands that mapped to identical coordinates for the reference and variant strains.

Fig. 2.

Compilation of the IS6110 location sites mapped for the clusters with microevolution. The arrows indicate the direction of the transcription mediated by IS6110. nts, nucleotides.

Analysis of the effect of the insertion sequence IS6110 on the regulation of the transcription of downstream genes.

Five IS6110 locations (Fig. 2) involved in microevolution events mapped in potential regulatory regions which were located at a distance and in an orientation that were compatible with upregulation of the downstream genes by the promoter included in IS6110 (32). Our final objective was to document whether this potential regulation could occur. Therefore, we selected two clusters (C and D) as representatives of those in which the entry of IS6110 into the microevolved variant was duly oriented and at a suitable distance from the downstream genes.

Relative quantification assays were performed based on real-time RT-PCR with the isolate that was representative of each of the two clusters selected and its corresponding variants targeting the expression of the corresponding genes located downstream and coding for CYP141 (Rv3121) in cluster C and for a hypothetical protein (Rv3188) in cluster D. A Wilcoxon-Mann-Whitney test was used to assess differences in the expression of the genes studied. No differences in Rv3188 expression between the reference and variant strains were found. However, for Rv3121 (CYP141), higher expression levels (a 5.6-fold difference) were recorded when the median expression values measured for the variant were compared with those of the reference strain (P < 0.05; Fig. 3).

Fig. 3.

Box plot of the distribution of expression ratios for the reference and variant strains from cluster C, which lacked or included IS6110, respectively, upstream of Rv3121.

DISCUSSION

Several studies have found exceptions to the assumption that infection with M. tuberculosis involves a genetically homogeneous population of bacilli. The extensive application of IS6110 RFLP as a genotyping tool has revealed the existence of clonal variants from a common ancestor resulting from microevolution phenomena within individuals (1, 6, 12, 13, 34, 37). RFLP-defined clonal variants have also appeared in transmission chains or in outbreaks involving susceptible or resistant strains (2, 13, 26, 28, 36, 45). The existence of microevolution from an initial strain due to sequential host-to-host infection led to the proposal that if only identical genotypes are considered to define clusters, the percentage of recent transmission in a population is underestimated because epidemiological links are also found between cases infected by strains with RFLP patterns showing a certain degree of variation (7, 17, 45).

Most publications on microevolution in tuberculosis are case reports, except for the few systematic studies based on population samples (7, 9, 21, 37). Consequently, it is difficult to appreciate the true dimension of microevolution. The primary objective of our study was to screen microevolution phenomena at the population level. We found that 12% of the clusters grouping identical patterns in a 5-year universal genotyping-based molecular epidemiology survey in southeastern Spain (20) also grouped some clonal variants, indicating that this is not an anecdotal phenomenon. We decided to define clonal variants according to differences in RFLP patterns, although variants can also involve diverse genetic targets applied for epidemiological purposes other than IS6110, such as MIRU sites or the spacers in the direct-repeat region, thus increasing the rate at which clonal variants could be found in transmission chains. In our clusters showing RFLP variants, differences were also observed at individual MIRU loci. Clonal variants with simultaneous variation in RFLP and MIRU have been identified elsewhere (1, 15, 37). Among the clusters considered representative of microevolution, we found differences in one to three RFLP bands. Variations in up to four IS6110 bands between epidemiologically linked cases have been found in other studies (13). We found epidemiological links between patients in all but one of the selected microevolved clusters. The number of IS6110 bands in the shared patterns was greater than eight, and mapping of a high number of shared IS6110 bands between the reference strain and the variants reinforced the observation that comigrating IS6110 bands corresponded to identical insertion sites, thus supporting the genotypic relationship between them and the existence of a transmitted common ancestor undergoing genotypic changes through microevolution phenomena.

The appearance of clonal variants in M. tuberculosis can be facilitated by a series of factors. The existence of a long delay between infection and a diagnosis of tuberculosis enables the infecting bacterial population to increase in size and provides sufficient time for microevolution (1). Furthermore, the longer the transmission chain or the higher the number of clustered cases, the greater the possibility of finding clonal variants as a result of the length of time to microevolution, the sequential adaptation to multiple independent hosts, or both. In our study, microevolution leading to clonal variants was not restricted to these scenarios but was detected in different types of clusters, including the lowest number of cases (n = 4), in clusters from 1 to 5 years long, and in clusters involving Spanish-born patients, in clusters involving single-nationality immigrant cases, and in multinational clusters. Moreover, in most of the patients involved in microevolved clusters, a diagnostic delay was rare, and in the few cases where it occurred, it was too short (less than 3 months), thus making it an unlikely explanation for the variations observed. Taken together, our data suggest that microevolution may not be restricted to specific clinical/epidemiological circumstances.

Apart from the usefulness of targeting IS6110 bands to identify microevolution, we must remember that modifications in IS6110 insertion sites can have genetic consequences. IS6110 can directly disrupt genes when it is located intragenically, and its entry can modulate the expression of adjacent genes when it enters intergenic regions (23, 33).

The systematic application of LM-PCR allowed us not only to confirm the clonal relatedness of the isolates involved in the microevolved clusters but also to know the genetic background involved in the IS6110-mediated microevolution events observed in transmission chains. Unlike other studies analyzing the role of IS6110 sequences in specific strains by comparison with fully unrelated control strains, ours was a unique opportunity to evaluate the relevance of specific IS6110 insertions in an isogenic background (i.e., one shared by the reference strain and variant strain). In this context, the identification of a new microevolved variant strain by a new IS6110-transposition event in the reference strain suggests that the entry of IS6110 is advantageous. The IS6110 mobilization event is expected to occur initially in a single bacterium, and if we can detect it in the transmission chain, it may indicate that the variant strain has been positively selected in the host case to enrich its representativeness and to enable its transmission.

We observed both intragenic and intergenic locations of the IS6110 sequences involved in microevolution events. The genes disrupted by the intragenic entry of IS6110 in our study were previously found to be interrupted in other analyzed strains (35) and, as generally occurs with the intragenic entry of IS6110, corresponded to redundant genes; therefore, the loss of gene expression does not become deleterious for the strain, although we cannot rule out some effect due to this IS6110-mediated inactivation. In other cases, mobilization of IS6110 into intragenic regions could have an effect other than inactivation, and it is also possible to find a functional phenotype associated with a single IS6110-disrupted copy of a redundant gene. This could be the case, for example, for the microevolution event involving an IS6110 insertion in a PPE gene, which could disrupt antigenic determinants in an attempt to evade the immune response (23), as suggested by the frequent finding of IS6110 insertions in the PE/PPE gene family described for clinical isolates (46).

The majority of the IS6110 locations involved in microevolution mapped to intergenic regions, as has been found previously in clinical isolates (46). Unlike intragenic locations of IS6110, which systematically disrupt the genes involved, entry into intergenic regions could lead to a variety of effects, by either direct impairment of existing promoters or by driving expression using a promoter included in IS6110 itself (3, 5, 32, 39). The distances between IS6110 and the adjacent genes in our study were variable but within the range for modulation of expression. The regions involved in the regulation of the transcription of a specific gene are rather extensive and include not only the promoter itself but also distant regions with a role in secondary structure regulatory interactions or binding of transcription factors.

In our analysis, three cases in which transposition of IS6110 could modulate adjacent gene expression involved hypothetical proteins (Rv3188, Rv1762, and Rv1504) with an unknown role. However, in some of the remaining cases, IS6110 was adjacent to genes encoding proteins with well-known functions, as follows: (i) esxK (early secreted antigenic target), which belongs to the ESAT-6 family of proteins, a group of immunodominant M. tuberculosis antigens that are relevant in virulence (16, 30); (ii) the dnaA-dnaN intergenic region, which includes the oriC locus, a preferential site for IS6110 insertion (18) that is downregulated in hypoxia (8); (iii) PPE29, a member of the PPE/PE protein family, whose expression is controlled by diverse factors and which induces dynamic antigenic pattern modification depending on host microenvironments (44), thus helping to evade the immune response; and (iv) Rv3121, coding for the protein CYP141, one of 20 cytochrome P450 enzymes that exist in the genome of M. tuberculosis and are physiologically relevant monooxygenases involved in catabolic pathways (24) related to viability and virulence, thus making them good candidates as drug targets (27).

Expression of the adjacent gene must be measured to clarify the specific effect expected for intergenic entry. In our study, we selected two clusters as representative of microevolutions involving the entry of IS6110 into intergenic regions according to the orientation of the promoter included in IS6110 (OPIS6110) and the distance between the promoter and the adjacent gene (a hypothetical protein and CYP141). Differences in cytochrome P450 expression between the variant and the reference strain were found, thus indicating that microevolution events can have a functional consequence and are not always meaningless subtle variations. Given the proper proximity and orientation of the OPIS6110 promoter included in the transposable sequence, which is known to be upregulated during the stationary phase in broth culture (32), the entry of IS6110 led to increased expression of the downstream gene (CYP141).

We estimated the frequency with which microevolution can be expected in tuberculosis transmission chains at the population level and showed that it is not restricted to specific clinical-epidemiological circumstances. The microevolution mediated by IS6110 transposition detected here involves a variety of intragenic and intergenic genetic backgrounds. Functional consequences of the differential location of an IS6110 copy in an isogenic background were observed in one of the microevolution events. Further studies will help us to explore the as-yet-unrevealed meaning of microevolution in M. tuberculosis.